Mechanical Stability and Unfolding Pathways of Parallel Tetrameric G-Quadruplexes Probed by Pulling Simulations.

Guanine quadruplex (GQ) is a noncanonical nucleic acid structure formed by guanine-rich DNA and RNA sequences. Folding of GQs is a complex process, where several aspects remain elusive, despite being important for understanding structure formation and biological functions of GQs. Pulling experiments are a common tool for acquiring insights into the folding landscape of GQs. Herein, we applied a computational pulling strategy─steered molecular dynamics (SMD) simulations─in combination with standard molecular dynamics (MD) simulations to explore the unfolding landscapes of tetrameric parallel GQs. We identified anisotropic properties of elastic conformational changes, unfolding transitions, and GQ mechanical stabilities. Using a special set of structural parameters, we found that the vertical component of pulling force (perpendicular to the average G-quartet plane) plays a significant role in disrupting GQ structures and weakening their mechanical stabilities. We demonstrated that the magnitude of the vertical force component depends on the pulling anchor positions and the number of G-quartets. Typical unfolding transitions for tetrameric parallel GQs involve base unzipping, opening of the G-stem, strand slippage, and rotation to cross-like structures. The unzipping was detected as the first and dominant unfolding event, and it usually started at the 3'-end. Furthermore, results from both SMD and standard MD simulations indicate that partial spiral conformations serve as a transient ensemble during the (un)folding of GQs.

Photoinduced charge separation and DNA self-repair depend on sequence directionality and stacking pattern.

Charge separation is one of the most common consequences of the absorption of UV light by DNA. Recently, it has been shown that this process can enable efficient self-repair of cyclobutane pyrimidine dimers (CPDs) in specific short DNA oligomers such as the GAT[double bond, length as m-dash]T sequence. The mechanism was characterized as sequential electron transfer through the nucleobase stack which is controlled by the redox potentials of nucleobases and their sequence. Here, we demonstrate that the inverse sequence T[double bond, length as m-dash]TAG promotes self-repair with higher quantum yields (0.58 ± 0.23%) than GAT[double bond, length as m-dash]T (0.44 ± 0.18%) in a comparative study involving UV-irradiation experiments. After extended exposure to UV irradiation, a photostationary equilibrium between self-repair and damage formation is reached at 33 ± 13% for GAT[double bond, length as m-dash]T and at 40 ± 16% for T[double bond, length as m-dash]TAG, which corresponds to the maximum total yield of self-repair. Molecular dynamics and quantum mechanics/molecular mechanics (QM/MM) simulations allowed us to assign this disparity to better stacking overlap between the G and A bases, which lowers the energies of the key A-˙G+˙ charge transfer state in the dominant conformers of the T[double bond, length as m-dash]TAG tetramer. These conformational differences also hinder alternative photorelaxation pathways of the T[double bond, length as m-dash]TAG tetranucleotide, which otherwise compete with the sequential electron transfer mechanism responsible for CPD self-repair. Overall, we demonstrate that photoinduced electron transfer is strongly dependent on conformation and the availability of alternative photodeactivation mechanisms. This knowledge can be used in the identification and prediction of canonical and modified DNA sequences exhibiting efficient electron transfer. It also further contributes to our understanding of DNA self-repair and its potential role in the photochemical selection of the most photostable sequences on the early Earth.

Molecular dynamics simulations reveal the parallel stranded d(GGGA)3GGG DNA quadruplex folds via multiple paths from a coil-like ensemble.

G-quadruplexes (G4s) are non-canonical nucleic acid structures that fold through complex processes. Characterization of the G4 folding landscape may help to elucidate biological roles of G4s but is challenging both experimentally and computationally. Here, we achieved complete folding of a three-quartet parallel DNA G4 with (GGGA)3GGG sequence using all-atom explicit-solvent enhanced-sampling molecular dynamics (MD) simulations. The simulations suggested early formation of guanine stacks in the G-tracts, which behave as semi-rigid blocks in the folding process. The folding continues via the formation of a collapsed compact coil-like ensemble. Structuring of the G4 from the coil then proceeds via various cross-like, hairpin, slip-stranded and two-quartet ensembles and can bypass the G-triplex structure. Folding of the parallel G4 does not appear to involve any salient intermediates and is a multi-pathway process. We also carried out an extended set of simulations of parallel G-hairpins. While parallel G-hairpins are extremely unstable when isolated, they are more stable inside the coil structure. On the methodology side, we show that the AMBER DNA force field predicts the folded G4 to be less stable than the unfolded ensemble, uncovering substantial force-field issues. Overall, we provide unique atomistic insights into the folding landscape of parallel-stranded G4 but also reveal limitations of current state-of-the-art MD techniques.

DNA Quadruplex Structure with a Unique Cation Dependency.

DNA quadruplex structures provide an additional layer of regulatory control in genome maintenance and gene expression and are widely used in nanotechnology. We report the discovery of an unprecedented tetrastranded structure formed from a native G-rich DNA sequence originating from the telomeric region of Caenorhabditis elegans. The structure is defined by multiple properties that distinguish it from all other known DNA quadruplexes. Most notably, the formation of a stable so-called KNa-quadruplex (KNaQ) requires concurrent coordination of K+ and Na+ ions at two distinct binding sites. This structure provides novel insight into G-rich DNA folding under ionic conditions relevant to eukaryotic cell physiology and the structural evolution of telomeric DNA. It highlights the differences between the structural organization of human and nematode telomeric DNA, which should be considered when using C. elegans as a model in telomere biology, particularly in drug screening applications. Additionally, the absence/presence of KNaQ motifs in the host/parasite introduces an intriguing possibility of exploiting the KNaQ fold as a plausible antiparasitic drug target. The structure's unique shape and ion dependency and the possibility of controlling its folding by using low-molecular-weight ligands can be used for the design or discovery of novel recognition DNA elements and sensors.

Simple Adjustment of Intranucleotide Base-Phosphate Interaction in the OL3 AMBER Force Field Improves RNA Simulations.

Molecular dynamics (MD) simulations represent an established tool to study RNA molecules. The outcome of MD studies depends, however, on the quality of the force field (ff). Here we suggest a correction for the widely used AMBER OL3 ff by adding a simple adjustment of the nonbonded parameters. The reparameterization of the Lennard-Jones potential for the -H8···O5'- and -H6···O5'- atom pairs addresses an intranucleotide steric clash occurring in the type 0 base-phosphate interaction (0BPh). The nonbonded fix (NBfix) modification of 0BPh interactions (NBfix0BPh modification) was tuned via a reweighting approach and subsequently tested using an extensive set of standard and enhanced sampling simulations of both unstructured and folded RNA motifs. The modification corrects minor but visible intranucleotide clash for the anti nucleobase conformation. We observed that structural ensembles of small RNA benchmark motifs simulated with the NBfix0BPh modification provide better agreement with experiments. No side effects of the modification were observed in standard simulations of larger structured RNA motifs. We suggest that the combination of OL3 RNA ff and NBfix0BPh modification is a viable option to improve RNA MD simulations.

Complexity of Guanine Quadruplex Unfolding Pathways Revealed by Atomistic Pulling Simulations.

Guanine quadruplexes (GQs) are non-canonical nucleic acid structures involved in many biological processes. GQs formed in single-stranded regions often need to be unwound by cellular machinery, so their mechanochemical properties are important. Here, we performed steered molecular dynamics simulations of human telomeric GQs to study their unfolding. We examined four pulling regimes, including a very slow setup with pulling velocity and force load accessible to high-speed atomic force microscopy. We identified multiple factors affecting the unfolding mechanism, i.e.,: (i) the more the direction of force was perpendicular to the GQ channel axis (determined by GQ topology), the more the base unzipping mechanism happened, (ii) the more parallel the direction of force was, GQ opening and cross-like GQs were more likely to occur, (iii) strand slippage mechanism was possible for GQs with an all-anti pattern in a strand, and (iv) slower pulling velocity led to richer structural dynamics with sampling of more intermediates and partial refolding events. We also identified that a GQ may eventually unfold after a force drop under forces smaller than those that the GQ withstood before the drop. Finally, we found out that different unfolding intermediates could have very similar chain end-to-end distances, which reveals some limitations of structural interpretations of single-molecule spectroscopic data.

Spontaneous binding of single-stranded RNAs to RRM proteins visualized by unbiased atomistic simulations with a rescaled RNA force field.

Recognition of single-stranded RNA (ssRNA) by RNA recognition motif (RRM) domains is an important class of protein-RNA interactions. Many such complexes were characterized using nuclear magnetic resonance (NMR) and/or X-ray crystallography techniques, revealing ensemble-averaged pictures of the bound states. However, it is becoming widely accepted that better understanding of protein-RNA interactions would be obtained from ensemble descriptions. Indeed, earlier molecular dynamics simulations of bound states indicated visible dynamics at the RNA-RRM interfaces. Here, we report the first atomistic simulation study of spontaneous binding of short RNA sequences to RRM domains of HuR and SRSF1 proteins. Using a millisecond-scale aggregate ensemble of unbiased simulations, we were able to observe a few dozen binding events. HuR RRM3 utilizes a pre-binding state to navigate the RNA sequence to its partially disordered bound state and then to dynamically scan its different binding registers. SRSF1 RRM2 binding is more straightforward but still multiple-pathway. The present study necessitated development of a goal-specific force field modification, scaling down the intramolecular van der Waals interactions of the RNA which also improves description of the RNA-RRM bound state. Our study opens up a new avenue for large-scale atomistic investigations of binding landscapes of protein-RNA complexes, and future perspectives of such research are discussed.

Early steps of oxidative damage in DNA quadruplexes are position-dependent: Quantum mechanical and molecular dynamics analysis of human telomeric sequence containing ionized guanine.

Guanine radical cation (G•+) is a key intermediate in many oxidative processes occurring in nucleic acids. Here, by combining mixed Quantum Mechanical/Molecular Mechanics calculations and Molecular Dynamics (MD) simulations, we study how the structural behaviour of a tract GGG(TTAGGG)3 (hereafter Tel21) of the human telomeric sequence, folded in an antiparallel quadruple helix, changes when one of the G bases is ionized to G•+ (Tel21+). Once assessed that the electron-hole is localized on a single G, we perform MD simulations of twelve Tel21+ systems, differing in the position of G•+ in the sequence. When G•+ is located in the tetrad adjacent to the diagonal loop, we observe substantial structural rearrangements, which can decrease the electrostatic repulsion with the inner Na+ ions and increase the solvent exposed surface of G•+. Analysis of solvation patterns of G•+ provides new insights on the main reactions of G•+, i.e. the deprotonation at two different sites and hydration at the C8 atom, the first steps of the processes producing 8oxo-Guanine. We suggest the main structural determinants of the relative reactivity of each position and our conclusions, consistent with the available experimental trends, can help rationalizing the reactivity of other G-quadruplex topologies.

The beginning and the end: flanking nucleotides induce a parallel G-quadruplex topology.

Genomic sequences susceptible to form G-quadruplexes (G4s) are always flanked by other nucleotides, but G4 formation in vitro is generally studied with short synthetic DNA or RNA oligonucleotides, for which bases adjacent to the G4 core are often omitted. Herein, we systematically studied the effects of flanking nucleotides on structural polymorphism of 371 different oligodeoxynucleotides that adopt intramolecular G4 structures. We found out that the addition of nucleotides favors the formation of a parallel fold, defined as the 'flanking effect' in this work. This 'flanking effect' was more pronounced when nucleotides were added at the 5'-end, and depended on loop arrangement. NMR experiments and molecular dynamics simulations revealed that flanking sequences at the 5'-end abolish a strong syn-specific hydrogen bond commonly found in non-parallel conformations, thus favoring a parallel topology. These analyses pave a new way for more accurate prediction of DNA G4 folding in a physiological context.

G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly.

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.

2,6-diaminopurine promotes repair of DNA lesions under prebiotic conditions.

High-yielding and selective prebiotic syntheses of RNA and DNA nucleotides involve UV irradiation to promote the key reaction steps and eradicate biologically irrelevant isomers. While these syntheses were likely enabled by UV-rich prebiotic environment, UV-induced formation of photodamages in polymeric nucleic acids, such as cyclobutane pyrimidine dimers (CPDs), remains the key unresolved issue for the origins of RNA and DNA on Earth. Here, we demonstrate that substitution of adenine with 2,6-diaminopurine enables repair of CPDs with yields reaching 92%. This substantial self-repairing activity originates from excellent electron donating properties of 2,6-diaminopurine in nucleic acid strands. We also show that the deoxyribonucleosides of 2,6-diaminopurine and adenine can be formed under the same prebiotic conditions. Considering that 2,6-diaminopurine was previously shown to increase the rate of nonenzymatic RNA replication, this nucleobase could have played critical roles in the formation of functional and photostable RNA/DNA oligomers in UV-rich prebiotic environments.

Insights into G-Quadruplex-Hemin Dynamics Using Atomistic Simulations: Implications for Reactivity and Folding.

Guanine quadruplex nucleic acids (G4s) are involved in key biological processes such as replication or transcription. Beyond their biological relevance, G4s find applications as biotechnological tools since they readily bind hemin and enhance its peroxidase activity, creating a G4-DNAzyme. The biocatalytic properties of G4-DNAzymes have been thoroughly studied and used for biosensing purposes. Despite hundreds of applications and massive experimental efforts, the atomistic details of the reaction mechanism remain unclear. To help select between the different hypotheses currently under investigation, we use extended explicit-solvent molecular dynamics (MD) simulations to scrutinize the G4/hemin interaction. We find that besides the dominant conformation in which hemin is stacked atop the external G-quartets, hemin can also transiently bind to the loops and be brought to the external G-quartets through diverse delivery mechanisms. The simulations do not support the catalytic mechanism relying on a wobbling guanine. Similarly, the catalytic role of the iron-bound water molecule is not in line with our results; however, given the simulation limitations, this observation should be considered with some caution. The simulations rather suggest tentative mechanisms in which the external G-quartet itself could be responsible for the unique H2O2-promoted biocatalytic properties of the G4/hemin complexes. Once stacked atop a terminal G-quartet, hemin rotates about its vertical axis while readily sampling shifted geometries where the iron transiently contacts oxygen atoms of the adjacent G-quartet. This dynamics is not apparent from the ensemble-averaged structure. We also visualize transient interactions between the stacked hemin and the G4 loops. Finally, we investigated interactions between hemin and on-pathway folding intermediates of the parallel-stranded G4 fold. The simulations suggest that hemin drives the folding of parallel-stranded G4s from slip-stranded intermediates, acting as a G4 chaperone. Limitations of the MD technique are briefly discussed.

Insight into formation propensity of pseudocircular DNA G-hairpins.

We recently showed that Saccharomyces cerevisiae telomeric DNA can fold into an unprecedented pseudocircular G-hairpin (PGH) structure. However, the formation of PGHs in the context of extended sequences, which is a prerequisite for their function in vivo and their applications in biotechnology, has not been elucidated. Here, we show that despite its 'circular' nature, PGHs tolerate single-stranded (ss) protrusions. High-resolution NMR structure of a novel member of PGH family reveals the atomistic details on a junction between ssDNA and PGH unit. Identification of new sequences capable of folding into one of the two forms of PGH helped in defining minimal sequence requirements for their formation. Our time-resolved NMR data indicate a possibility that PGHs fold via a complex kinetic partitioning mechanism and suggests the existence of K+ ion-dependent PGH folding intermediates. The data not only provide an explanation of cation-type-dependent formation of PGHs, but also explain the unusually large hysteresis between PGH melting and annealing noted in our previous study. Our findings have important implications for DNA biology and nanotechnology. Overrepresentation of sequences able to form PGHs in the evolutionary-conserved regions of the human genome implies their functionally important biological role(s).

Stability of Two-Quartet G-Quadruplexes and Their Dimers in Atomistic Simulations.

G-quadruplexes (GQs) are four-stranded noncanonical DNA and RNA architectures that can be formed by guanine-rich sequences. The stability of GQs increases with the number of G-quartets, and three G-quartets generally form stable GQs. However, the stability of two-quartet GQs is an open issue. To understand the intrinsic stability of two-quartet GQ stems, we have carried out a series of unbiased molecular dynamics (MD) simulations (505 µs in total) of two- and four-quartet DNA and RNA GQs, with attention paid mainly to parallel-stranded arrangements. We used AMBER DNA parmOL15 and RNA parmOL3 force fields and tested different ion and water models. Two-quartet parallel-stranded DNA GQs unfolded in all the simulations, while the equivalent RNA GQ was stable in most of the simulations. GQs composed of two stacked units of two-quartet GQs were stable for both DNA and RNA. The simulations suggest that a minimum of three quartets are needed to form an intrinsically stable all-anti parallel-stranded DNA GQ. Parallel two-quartet DNA GQ may exist if substantially stabilized by another molecule or structural element, including multimerization. On the other hand, we predict that isolated RNA two-quartet parallel GQs may form, albeit being weakly stable. We also show that ionic parameters and water models should be chosen with caution because some parameter combinations can cause spurious instability of GQ stems. Some in-so-far unnoticed limitations of force-field description of multiple ions inside the GQs are discussed, which compromise the capability of simulations to fully capture the effect of increase in the number of quartets on the GQ stability.

UV-induced hydrogen transfer in DNA base pairs promoted by dark nπ* states.

Dark nπ* states were shown to have substantial contribution to the destructive photochemistry of pyrimidine nucleobases. Based on quantum-chemical calculations, we demonstrate that the characteristic hydrogen bonding pattern of the GC base pair could facilitate the formation of a wobble excited-state charge-transfer complex. This entails a barrierless electron-driven proton transfer (EDPT) process which enables damageless photodeactivation of the base pair. These photostabilizing properties are retained even when guanine is exchanged to hypoxanthine. The inaccessibility of this process in the AT base pair sheds further light on the reasons why cytosine is less susceptible to the formation of photodimers in double-stranded DNA.

Parallel G-triplexes and G-hairpins as potential transitory ensembles in the folding of parallel-stranded DNA G-Quadruplexes.

Guanine quadruplexes (G4s) are non-canonical nucleic acids structures common in important genomic regions. Parallel-stranded G4 folds are the most abundant, but their folding mechanism is not fully understood. Recent research highlighted that G4 DNA molecules fold via kinetic partitioning mechanism dominated by competition amongst diverse long-living G4 folds. The role of other intermediate species such as parallel G-triplexes and G-hairpins in the folding process has been a matter of debate. Here, we use standard and enhanced-sampling molecular dynamics simulations (total length of ∼0.9 ms) to study these potential folding intermediates. We suggest that parallel G-triplex per se is rather an unstable species that is in local equilibrium with a broad ensemble of triplex-like structures. The equilibrium is shifted to well-structured G-triplex by stacked aromatic ligand and to a lesser extent by flanking duplexes or nucleotides. Next, we study propeller loop formation in GGGAGGGAGGG, GGGAGGG and GGGTTAGGG sequences. We identify multiple folding pathways from different unfolded and misfolded structures leading towards an ensemble of intermediates called cross-like structures (cross-hairpins), thus providing atomistic level of description of the single-molecule folding events. In summary, the parallel G-triplex is a possible, but not mandatory short-living (transitory) intermediate in the folding of parallel-stranded G4.

Structural Dynamics of Lateral and Diagonal Loops of Human Telomeric G-Quadruplexes in Extended MD Simulations.

The NMR solution structures of human telomeric (Htel) G-quadruplexes (GQs) are characterized by the presence of two lateral loops complemented by either diagonal or propeller loops. Bases of a given loop can establish interactions within the loop as well as with other loops and the flanking bases. This can lead to a formation of base alignments above and below the GQ stems. These base alignments are known to affect the loop structures and relative stabilities of different Htel GQ folds. We have carried out a total of 217 µs of classical (unbiased) molecular dynamics (MD) simulations starting from the available solution structures of Htel GQs to characterize structural dynamics of the lateral and diagonal loops, using several recent AMBER DNA force-field variants. As the loops are involved in diverse stacking and H-bonding interactions, their dynamics is slow, and extended sampling is required to capture different conformations. Nevertheless, although the simulations are far from being quantitatively converged, the data suggest that multiple 10 µs-scale simulations can provide a quite good assessment of the loop conformational space as described by the force field. The simulations indicate that the lateral loops may sample multiple coexisting conformations, which should be considered when comparing simulations with the NMR models as the latter include ensemble averaging. The adenine-thymine Watson-Crick arrangement was the most stable base pairing in the simulations. Adenine-adenine and thymine-thymine base pairs were also sampled but were less stable. The data suggest that the description of lateral and diagonal GQ loops in contemporary MD simulations is considerably more realistic than the description of propeller loops, though definitely not flawless.

Structural dynamics of propeller loop: towards folding of RNA G-quadruplex.

We have carried out an extended set of standard and enhanced-sampling MD simulations (for a cumulative simulation time of 620 µs) with the aim to study folding landscapes of the rGGGUUAGGG and rGGGAGGG parallel G-hairpins (PH) with propeller loop. We identify folding and unfolding pathways of the PH, which is bridged with the unfolded state via an ensemble of cross-like structures (CS) possessing mutually tilted or perpendicular G-strands interacting via guanine-guanine H-bonding. The oligonucleotides reach the PH conformation from the unfolded state via a conformational diffusion through the folding landscape, i.e. as a series of rearrangements of the H-bond interactions starting from compacted anti-parallel hairpin-like structures. Although isolated PHs do not appear to be thermodynamically stable we suggest that CS and PH-types of structures are sufficiently populated during RNA guanine quadruplex (GQ) folding within the context of complete GQ-forming sequences. These structures may participate in compact coil-like ensembles that involve all four G-strands and already some bound ions. Such ensembles can then rearrange into the fully folded parallel GQs via conformational diffusion. We propose that the basic atomistic folding mechanism of propeller loops suggested in this work may be common for their formation in RNA and DNA GQs.

Sequential electron transfer governs the UV-induced self-repair of DNA photolesions.

Cyclobutane pyrimidine dimers (CpDs) are among the most common DNA lesions occurring due to the interaction with ultraviolet light. While photolyases have been well known as external factors repairing CpDs, the intrinsic self-repairing capabilities of the GAT[double bond, length as m-dash]T DNA sequence were discovered only recently and are still largely obscure. Here, we elucidate the mechanistic details of this self-repair process by means of MD simulations and QM/MM computations involving the algebraic diagrammatic construction to the second order [ADC(2)] method. We show that local UV-excitation of guanine may be followed by up to three subsequent electron transfers, which may eventually enable efficient CpD ring opening when the negative charge resides on the T[double bond, length as m-dash]T dimer. Consequently, the molecular mechanism of GAT[double bond, length as m-dash]T self-repair can be envisaged as sequential electron transfer (SET) occurring downhill along the slope of the S1 potential energy surface. Even though the general features of the SET mechanism are retained in both of the studied stacked conformers, our optimizations of different S1/S0 state crossings revealed minor differences which could influence their self-repair efficiencies. We expect that such assessment of the availability and efficiency of the SET process in other DNA oligomers could hint towards other sequences exhibiting similar photochemical properties. Such explorations will be particularly fascinating in the context of the origins of biomolecules on Earth, owing to the lack of external repairing factors in the Archean age.