The polymorphism analysis for CD36 among platelet donors.

CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.

[RHD Gene Analysis of A Blood Donor with Del Phenotype].

OBJECTIVE: To analyze the RHD genotype of a blood donor with Del phenotype in Yunnan. METHODS: Rh serological phenotype was identified. RHD gene was detected by PCR-SSP typing, and its 10 exons were sequenced. Exon 9 was amplified for sequencing and analysis. RHD zygosity was detected. RESULTS: The Rh phenotype of this specimen was CcDelee. Genomic DNA exhibited a 1 003 bp deletion spanning from intron 8, across exon 9 into intron 9. The deletion breakpoints occurred between two 7-bp short tandem repeat sequences. There was no variation in the sequences of the remaining exons. The Rh hybridization box test showed that there was one RHD negative allele. CONCLUSION: This specimen is Del type caused by deletion of RHD exon 9.

Frequency and molecular basis of CD36 deficiency among platelet donors in Kunming, China.

CD36 is a multifunctional receptor expressed on the surface of many cell types. Among healthy individuals, CD36 may be absent on platelets and monocytes (type I deficiency) or platelets alone (type II deficiency). However, the exact molecular mechanisms underlying CD36 deficiency remain unclear. In this study, we aimed to identify individuals with CD36 deficiency and investigate the molecular basis underlying it. Blood samples were collected from platelet donors at Kunming Blood Center. Platelets and monocytes were isolated and CD36-expression levels were analyzed using flow cytometry. DNA from whole blood and mRNA isolated from monocytes and platelets of individuals with CD36 deficiency were analyzed using polymerase chain reaction (PCR) testing. The PCR products were cloned and sequenced. Among the 418 blood donors,7 (1.68%) were CD36 deficient: 1 (0.24%) with type I deficiency and 6(1.44%) with type II deficiency. Six heterozygous mutations occurred, including c.268C>T (in type I individuals), c.120 + 1 G>T, c.268C>T, c.329_330del/AC, c.1156 C>T, c.1163A>C, and c.1228_1239del/ATTGTGCCTATT (in type II individuals). Mutations were not detected in one type II individual . At the cDNA level, only mutant, but not wild-type, transcripts were detected in the platelets and monocytes of type I individual. In type II individuals, only mutant transcripts were found in platelets, whereas monocytes possessed wild-type and mutant transcripts. Interestingly, only alternative splicing transcripts were observed in the individual without mutation. We report the incidence rates of type I and II CD36 deficiencies among platelet donors in Kunming. Molecular genetic analyses of DNA and cDNA demonstrated that homozygous mutations on the cDNA level in platelets and monocytes or platelets alone identified type I and II deficiencies, respectively. Furthermore, alternatively spliced products also potentially contribute to the mechanism of CD36 deficiency.

What is the context? Healthy individuals may lack CD36 on platelets and (or) monocytes, which are defined as Type I and Type II CD36 deficiency. These individuals could develop anti-CD36 antibodies associated with immune-mediated disorders. However, the mechanism underlying the CD36 deficiency is still unclear. In this study, we reported the incidence of CD36 deficiency in Kunming platelet donors and found the new molecular basis of CD36 deficiency individuals.What's new? Molecular genetic analysis of cDNA derived from type I subjects showed the presence of mutant transcript only, both in platelets and monocytes. In type II subjects, platelets only carry mutant transcript, whereas monocytes possessed both wild-type and mutant transcripts. Furthermore, we found that alternatively spliced product of CD36 transcript could also contribute to the mechanism of CD36 deficiencies.What's the impact? Our finding indicates that analysis of CD36 at cDNA level is mandatory to verify different forms of CD36 deficiencies. This information may help us to understand the development of anti-CD36 antibodies in CD36 deficient individuals.

Polymorphism of Antifolate Drug Resistance in Plasmodium vivax From Local Residents and Migrant Workers Returned From the China-Myanmar Border.

Drug-resistant Plasmodium vivax malaria impedes efforts to control, eliminate, and ultimately eradicate malaria in Southeast Asia. P. vivax resistance to antifolate drugs derives from point mutations in specific parasite genes, including the dihydropteroate synthase (pvdhps), dihydrofolate reductase (pvdhfr), and GTP cyclohydrolase I (pvgch1) genes. This study aims to investigate the prevalence and spread of drug resistance markers in P. vivax populating the China-Myanmar border. Blood samples were collected from symptomatic patients with acute P. vivax infection. Samples with single-clone P. vivax infections were sequenced for pvdhps and pvdhfr genes and genotyped for 6 flanking microsatellite markers. Copy number variation in the pvgch1 gene was also examined. Polymorphisms were observed in six different codons of the pvdhps gene (382, 383, 512, 549, 553, and 571) and six different codons of the pvdhfr gene (13, 57, 58, 61, 99, 117) in two study sites. The quadruple mutant haplotypes 57I/L/58R/61M/117T of pvdhfr gene were the most common (comprising 76% of cases in Myitsone and 43.7% of case in Laiza). The double mutant haplotype 383G/553G of pvdhps gene was also prevalent at each site (40.8% and 31%). Microsatellites flanking the pvdhfr gene differentiated clinical samples from wild type and quadruple mutant genotypes (FST= 0.259-0.3036), as would be expected for a locus undergoing positive selection. The lack of copy number variation of pvgch1 suggests that SP-resistant P. vivax may harbor alternative mechanisms to secure sufficient folate.

Genetic polymorphisms in IL-7 and IL-7R are correlated with lung cancer risk in the Chinese Han population.

PURPOSE: IL-7/IL-7R axis participates in the initiation and progression of lung cancer (LC). This study aimed to explore the potential influence of IL-7/IL-7R polymorphisms on LC risk. PATIENTS AND METHODS: In total, 1,010 participants (507 LC patients and 503 healthy controls) were enrolled. Five single-nucleotide polymorphisms (SNPs) in IL-7R and one SNP in IL-7 were genotyped in included samples with Agena MassARRAY system. OR and 95% CIs were computed by logistic regression analysis after adjusting for age and gender. Stratified analyses with demographic and clinical characteristics were also performed. Finally, linkage disequilibrium (LD) analysis was conducted with the PLINK version 1.07 software . RESULTS: IL-7R rs10053847 variant was related to a decreased LC risk under the allele gene (OR =0.78, P=0.043) and additive model (OR =0.77, P=0.042). The results of stratified analysis indicated that this SNP was associated with a lower LC risk among nonsmokers (AA/GG: OR =0.09, P=0.033; AA/AG+GG: OR =0.10 P=0.037) or nondrinkers (AA/GG: OR =0.07, P=0.047; AA/AG+GG: OR =0.18 P=0.049). Moreover, carriers of IL-7R rs10213865-C allele had an increased lung adenocarcinoma risk (CA/AA: OR =1.60, P=0.011; CC+CA/AA: OR =1.62, P=0.007; CA/CA/AA: OR =1.50, P=0.007). Additionally, AGAA haplotype (rs10213865, rs969129, rs118137916 and rs10053847) increased LC risk (OR =1.30, P=0.041). CONCLUSION: IL-7R rs10053847 was correlated with a decreased LC risk, while IL-7R rs10213865 was correlated with an elevated lung adenocarcinoma risk, implying these two SNPs might play essential roles in LC risk evaluation.

Characterization of the novel KIR2DL4*037 allele identified in a Chinese Hani individual.

The novel KIR2DL4*037 allele differs from the closest allele KIR2DL4*00501 by a single missense mutation.

Description of the novel KIR2DL4*00603 allele identified in a Chinese Hani individual.

The novel KIR2DL4*00603 allele differs from the closest allele KIR2DL4*00602 by a silent mutation.

Identification of the novel KIR2DL4*036 allele in a Chinese Hani individual.

The novel KIR2DL4*036 allele differs from the closest allele KIR2DL4*00102 by a single missense mutation.

The novel KIR2DL4*038 allele identified by sequencing-based typing in a Chinese Naxi individual.

The novel KIR2DL4*038 allele differs from the closest allele KIR2DL4*00102 by a single missense mutation.

HNA-3a and HNA-3b antigens among 9 ethnic populations and the Han population in Southwest China.

BACKGROUND: Human neutrophil antigen 3 (HNA-3) is encoded by the SLC44A2 gene. Antibodies against HNAs can cause severe, often fatal, transfusion reactions, known as transfusion-related acute lung injury, and neonatal neutropenia. We explored the 2 common HNA-3 variants in 9 ethnic populations residing in Sichuan and Yunnan provinces of China as compared to the Han population. METHODS: We genotyped for SLC44A2 (rs2288904) by polymerase chain reaction sequence-based typing among blood donors, for a total of 2206 individuals in Yunnan and 376 in Sichuan. RESULTS: The SLC44A2*02 allele (HNA-3b antigen) frequency varied between 0.24 and 0.33 for all 9 ethnic populations in Yunnan, including Zhuang, Derung, Hani, Lisu, Bai, Miao, Dai, Naxi, and Yi. Specifically, the Yi ethnicity did not present an unusually great SLC44A2*02 frequency at any of the 4 locations examined in Yunnan. Except of the Yi ethnicity in Sichuan (0.40), the Han ethnicity, as the majority population group, had the greatest SLC44A2*02 frequency with 0.39 in Yunnan and 0.35 in Sichuan. CONCLUSION: The ethnic populations in Southwest China are not at an increased risk for anti-HNA3a compared to the Han population, with the possible exception of Yi in Sichuan. Our data, however, corroborated the known high prevalence of SLC44A2*02 in Han populations. Hence, the Han populations in Yunnan, Sichuan and elsewhere in China are at a comparatively great risk for developing HNA-3a antibodies.

HLA-B*07, HLA-DRB1*07, HLA-DRB1*12, and HLA-C*03:02 Strongly Associate With BMI: Data From 1.3 Million Healthy Chinese Adults.

Strong associations between HLA alleles and infectious and autoimmune diseases are well established. Although obesity is also associated with these diseases, the relationship between HLA and obesity has not been systematically investigated in a large cohort. In the current study, we analyzed the association of HLA alleles with BMI using data from 1.3 million healthy adult donors from the Chinese Marrow Donor Program (CMDP). We found 23 HLA alleles, including 12 low-resolution and 11 high-resolution alleles, were significantly associated with BMI after correction for multiple testing. Alleles associated with high BMI were enriched in haplotypes that were common in both Chinese and European populations, whereas the alleles associated with low BMI were enriched in haplotypes common only in Asians. Alleles B*07, DRB1*07, DRB1*12, and C*03:02 provided the strongest associations with BMI (P = 6.89 × 10-10, 1.32 × 10-9, 1.52 × 10-9, and 4.45 × 10-8, respectively), where B*07 and DRB1*07 also had evidence for sex-specific effects (Pheterogeneity = 0.0067 and 0.00058, respectively). These results, which identify associations between alleles of HLA-B, DRB1, and C with BMI in Chinese young adults, implicate a novel biological connection between HLA alleles and obesity.

Overview of the improvement of the ring-stage survival assay-a novel phenotypic assay for the detection of artemisinin-resistant Plasmodium falciparum.

Artemisinin resistance in Plasmodium falciparum threatens the remarkable efficacy of artemisinin-based combination therapies worldwide. Thus, greater insight into the resistance mechanism using monitoring tools is essential. The ring-stage survival assay is used for phenotyping artemisinin-resistance or decreased artemisinin sensitivity. Here, we review the progress of this measurement assay and explore its limitations and potential applications.

Genetic diversity of Plasmodium falciparum populations in southeast and western Myanmar.

BACKGROUND: The genetic diversity of malaria parasites reflects the complexity and size of the parasite populations. This study was designed to explore the genetic diversity of Plasmodium falciparum populations collected from two southeastern areas (Shwekyin and Myawaddy bordering Thailand) and one western area (Kyauktaw bordering Bangladesh) of Myanmar. METHODS: A total of 267 blood samples collected from patients with acute P. falciparum infections during 2009 and 2010 were used for genotyping at the merozoite surface protein 1 (Msp1), Msp2 and glutamate-rich protein (Glurp) loci. RESULTS: One hundred and eighty four samples were successfully genotyped at three genes. The allelic distributions of the three genes were all significantly different among three areas. MAD20 and 3D7 were the most prevalent alleles in three areas for Msp1 and Msp2, respectively. The Glurp allele with a bin size of 700-750 bp was the most prevalent both in Shwekyin and Myawaddy, whereas two alleles with bin sizes of 800-850 bp and 900-1000 bp were the most prevalent in the western site Kyauktaw. Overall, 73.91% of samples contained multiclonal infections, resulting in a mean multiplicity of infection (MOI) of 1.94. Interestingly, the MOI level presented a rising trend with the order of Myawaddy, Kyauktaw and Shwekyin, which also paralleled with the increasing frequencies of Msp1 RO33 and Msp2 FC27 200-250 bp alleles. Msp1 and Msp2 genes displayed higher levels of diversity and higher MOI rates than Glurp. PCR revealed four samples (two from Shwekyin and two from Myawaddy) with mixed infections of P. falciparum and P. vivax. CONCLUSIONS: This study genotyped parasite clinical samples from two southeast regions and one western state of Myanmar at the Msp1, Msp2 and Glurp loci, which revealed high levels of genetic diversity and mixed-strain infections of P. falciparum populations at these sites. The results indicated that malaria transmission intensity in these regions remained high and more strengthened control efforts are needed. The genotypic data provided baseline information for monitoring the impacts of malaria elimination efforts in the region.

[Association between CYP1A1 gene polymorphism and intrahepatic cholestasis of pregnancy].

OBJECTIVE: To study the relationship between CYP1A1 genetic polymorphism and intrahepatic cholestasis of pregnancy (ICP) in Chengdu of China. METHODS: MspI and Ile/Val genotypes of CYP1A1 gene were detected with polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and allele-specific amplification-PCR (ASA-PCR) in a case-control study, including 100 cases of ICP and 100 controls. RESULTS: There was no significant correlation between MspI polymorphism and ICP susceptibility (P>0.05). However, the Ile/Val+Val/Val genotypes of CYP1A1 significantly increased the risk of ICP (P=0.047, OR=1.768). CONCLUSION: The Ile/Val polymorphism in exon 7 of CYP1A1 may be associated with the susceptibility of ICP in Chengdu. The MspI polymorphism of CYP1A1 is not associated with the risk of ICP in Chengdu.