Crop antiviral defense: Past and future perspective.

Viral pathogens not only threaten the health and life of humans and animals but also cause enormous crop yield losses and contribute to global food insecurity. To defend against viral pathogens, plants have evolved an intricate immune system to perceive and cope with such attacks. Although most of the fundamental studies were carried out in model plants, more recent research in crops has provided new insights into the antiviral strategies employed by crop plants. We summarize recent advances in understanding the biological roles of cellular receptors, RNA silencing, RNA decay, hormone signaling, autophagy, and ubiquitination in manipulating crop host-mediated antiviral responses. The potential functions of circular RNAs, the rhizosphere microbiome, and the foliar microbiome of crops in plant-virus interactions will be fascinating research directions in the future. These findings will be beneficial for the development of modern crop improvement strategies.

The plant-sucking insect selects assembly of the gut microbiota from environment to enhance host reproduction.

Plant-sucking insects have intricate associations with a diverse array of microorganisms to facilitate their adaptation to specific ecological niches. The midgut of phytophagous true bugs is generally structured into four distinct compartments to accommodate their microbiota. Nevertheless, there is limited understanding regarding the origins of these gut microbiomes, the mechanisms behind microbial community assembly, and the interactions between gut microbiomes and their insect hosts. In this study, we conducted a comprehensive survey of microbial communities within the midgut compartments of a bean bug Riptortus pedestris, soybean plant, and bulk soil across 12 distinct geographical fields in China, utilizing high-throughput sequencing of the 16 S rRNA gene. Our findings illuminated that gut microbiota of the plant-sucking insects predominantly originated from the surrounding soil environment, and plants also play a subordinate role in mediating microbial acquisition for the insects. Furthermore, our investigation suggested that the composition of the insect gut microbiome was probably shaped by host selection and/or microbe-microbe interactions at the gut compartment level, with marginal influence from soil and geographical factors. Additionally, we had unveiled a noteworthy dynamic in the acquisition of core bacterial taxa, particularly Burkholderia, which were initially sourced from the environment and subsequently enriched within the insect midgut compartments. This bacterial enrichment played a significant role in enhancing insect host reproduction. These findings contribute to our evolving understanding of microbiomes within the insect-plant-soil ecosystem, shedding additional light on the intricate interactions between insects and their microbiomes that underpin the ecological significance of microbial partnerships in host adaptation.

Engineering brassinosteroids pathway: a key strategy for enhancing crop yields.

KEY MESSAGE: Two significant studies have unveiled the pivotal role of BR regulation in shaping distinct features: the clustered-spikelet architecture in rice and the superior semi-dwarf stature in wheat.

Identification and Characterization of Three Novel Solemo-like Viruses in the White-Backed Planthopper, Sogatella furcifera.

Agricultural insects play a crucial role in transmitting plant viruses and host a considerable number of insect-specific viruses (ISVs). Among these insects, the white-backed planthoppers (WBPH; Sogatella furcifera, Hemiptera: Delphacidae) are noteworthy rice pests and are responsible for disseminating the southern rice black-streaked dwarf virus (SRBSDV), a significant rice virus. In this study, we analyzed WBPH transcriptome data from public sources and identified three novel viruses. These newly discovered viruses belong to the plant-associated viral family Solemoviridae and were tentatively named Sogatella furcifera solemo-like virus 1-3 (SFSolV1-3). Among them, SFSolV1 exhibited a prevalent existence in different laboratory populations, and its complete genome sequence was obtained using rapid amplification of cDNA ends (RACE) approaches. To investigate the antiviral RNA interference (RNAi) response in WBPH, we conducted an analysis of virus-derived small interfering RNAs (vsiRNAs). The vsiRNAs of SFSolV1 and -2 exhibited typical patterns associated with the host's siRNA-mediated antiviral immunity, with a preference for 21- and 22-nt vsiRNAs derived equally from both the sense and antisense genomic strands. Furthermore, we examined SFSolV1 infection and distribution in WBPH, revealing a significantly higher viral load of SFSolV1 in nymphs' hemolymph compared to other tissues. Additionally, in adult insects, SFSolV1 exhibited higher abundance in male adults than in female adults.

The microbiota's role in flavivirus control: Rosenbergiella_YN46.

The transmission of flaviviruses, such as dengue virus (DENV) and Zika virus (ZIKV), poses a significant threat to global public health. Zhang et al. recently showed that Rosenbergiella sp. YN46 (Rosenbergiella_YN46), a bacterium from the mosquito gut, inhibits flavivirus transmission and thus offers a potential biocontrol strategy with broad public health implications.

Metatranscriptome and small RNA sequencing revealed a mixed infection of newly identified bymovirus and bean yellow mosaic virus on peas.

Peas (Pisum sativum L.) are widely cultivated in temperate regions and are susceptible hosts for various viruses across different families. The discovery and identification of new viruses in peas has significant implications for field disease management. Here, we identified a mixed infection of two viruses from field-collected peas exhibiting virus-like symptoms using metatranscriptome and small RNA sequencing techniques. Upon identification, one of the viruses was determined to be a newly isolated and discovered bymovirus from peas, named "pea bymovirus 1 (PBV1)". The other was identified as a novel variant of bean yellow mosaic virus (BYMV-HZ1). Subsequently, mechanical inoculation and RT-PCR assays confirmed that both viruses could be inoculated back onto peas and tobaccos, showing mixed infection by PBV1 and BYMV-HZ1. To our knowledge, this is the first isolation of a bymovirus from pea and the first documented case of mixed infection of peas by PBV1 and BYMV-HZ1 in China.

Identification and Functional Analysis of the fruitless Gene in a Hemimetabolous Insect, Nilaparvata lugens.

The fruitless (fru) gene functions as a crucial "tuner" in male insect courtship behavior through distinct expression patterns. In Nilaparvata lugens, our previous research showed doublesex (dsx) influencing male courtship songs, causing mating failures with virgin females. However, the impact of fru on N. lugens mating remains unexplored. In this study, the fru homolog (Nlfru) in N. lugens yielded four spliceosomes: Nlfru-374-a/b, Nlfru-377, and Nlfru-433, encoding proteins of 374aa, 377aa, and 433aa, respectively. Notably, only Nlfru-374b exhibited male bias, while the others were non-sex-specific. All NlFRU proteins featured the BTB conserved domain, with NlFRU-374 and NlFRU-377 possessing the ZnF domain with different sequences. RNAi-mediated Nlfru or its isoforms' knockdown in nymph stages blocked wing-flapping behavior in mating males, while embryonic knockdown via maternal RNAi resulted in over 80% of males losing wing-flapping ability, and female receptivity was reduced. Nlfru expression was Nldsx-regulated, and yet courtship signals and mating success were unaffected. Remarkably, RNAi-mediated Nlfru knockdown up-regulated the expression of flightin in macropterous males, which regulated muscle stiffness and delayed force response, suggesting Nlfru's involvement in muscle development regulation. Collectively, our results indicate that Nlfru functions in N. lugens exhibit a combination of conservation and species specificity, contributing insights into fru evolution, particularly in Hemiptera species.

Exploring the shared pathogenic strategies of independently evolved effectors across distinct plant viruses.

Plants have developed very diverse strategies to defend themselves against viral pathogens, among which plant hormones play pivotal roles. In response, some viruses have also deployed multifunctional viral effectors that effectively hijack key component hubs to counter or evade plant immune surveillance. Although significant progress has been made toward understanding counter-defense strategies that manipulate plant hormone regulatory molecules, these efforts have often been limited to an individual virus or specific host target/pathway. This review provides new insights into broad-spectrum antiviral responses in rice triggered by key components of phytohormone signaling, and highlights the common features of counter-defense strategies employed by distinct rice-infecting RNA viruses. These strategies involve the secretion of multifunctional virulence effectors that target the sophisticated phytohormone system, dampening immune responses by engaging with the same host targets. Additionally, the review provides an in-depth exploration of various viral effectors, emphasizing tertiary structure-based research and shared host targets. Understanding these conserved characteristics in detail may pave the way for molecular drug design, opening new opportunities to enhance broad-spectrum antiviral trials through precise engineering.

Salivary proteins potentially derived from horizontal gene transfer are critical for salivary sheath formation and other feeding processes.

Herbivorous insects employ an array of salivary proteins to aid feeding. However, the mechanisms behind the recruitment and evolution of these genes to mediate plant-insect interactions remain poorly understood. Here, we report a potential horizontal gene transfer (HGT) event from bacteria to an ancestral bug of Eutrichophora. The acquired genes subsequently underwent duplications and evolved through co-option. We annotated them as horizontal-transferred, Eutrichophora-specific salivary protein (HESPs) according to their origin and function. In Riptortus pedestris (Coreoidea), all nine HESPs are secreted into plants during feeding. The RpHESP4 to RpHESP8 are recently duplicated and found to be indispensable for salivary sheath formation. Silencing of RpHESP4-8 increases the difficulty of R. pedestris in probing the soybean, and the treated insects display a decreased survivability. Although silencing the other RpHESPs does not affect the salivary sheath formation, negative effects are also observed. In Pyrrhocoris apterus (Pyrrhocoroidea), five out of six PaHESPs are secretory salivary proteins, with PaHESP3 being critical for insect survival. The PaHESP5, while important for insects, no longer functions as a salivary protein. Our results provide insight into the potential origin of insect saliva and shed light on the evolution of salivary proteins.

Two different viral proteins suppress NUCLEAR FACTOR-YC-mediated antiviral immunity during infection in rice.

Plant viruses have multiple strategies to counter and evade the host's antiviral immune response. However, limited research has been conducted on the antiviral defense mechanisms commonly targeted by distinct types of plant viruses. In this study, we discovered that NUCLEAR FACTOR-YC (NF-YC) and NUCLEAR FACTOR-YA (NF-YA), 2 essential components of the NF-Y complex, were commonly targeted by viral proteins encoded by 2 different rice (Oryza sativa L.) viruses, rice stripe virus (RSV, Tenuivirus) and southern rice black streaked dwarf virus (SRBSDV, Fijivirus). In vitro and in vivo experiments showed that OsNF-YCs associate with OsNF-YAs and inhibit their transcriptional activation activity, resulting in the suppression of OsNF-YA-mediated plant susceptibility to rice viruses. Different viral proteins RSV P2 and SRBSDV SP8 directly disrupted the association of OsNF-YCs with OsNF-YAs, thereby suppressing the antiviral defense mediated by OsNF-YCs. These findings suggest an approach for conferring broad-spectrum disease resistance in rice and reveal a common mechanism employed by viral proteins to evade the host's antiviral defense by hindering the antiviral capabilities of OsNF-YCs.

Histone deacetylase OsHDA706 orchestrates rice broad-spectrum antiviral immunity and is impeded by a viral effector.

Lysine acetylation is a dynamic post-translational modification of proteins. Extensive studies have revealed that the acetylation modulated by histone acetyltransferases and histone deacetylases (HDACs) plays a crucial role in regulating protein function. However, there has been limited focus on how HDACs regulate jasmonic acid (JA) biosynthesis in plants. Here, we uncover that the protein stability of OsLOX14, a critical enzyme involved in JA biosynthesis, is regulated by a histone deacetylase, OsHDA706, and is hindered by a viral protein. Our results show that OsHDA706 deacetylates OsLOX14 and enhances the stability of OsLOX14, leading to JA accumulation and an improved broad-spectrum rice antiviral defense. Furthermore, we found that the viral protein P2, encoded by the destructive rice stripe virus, disrupts the association of OsHDA706-OsLOX14, promoting viral infection. Overall, our findings reveal how HDAC manipulates the interplay of deacetylation and protein stability of a JA biosynthetic enzyme to enhance plant antiviral responses.

Co-option of a non-retroviral endogenous viral element in planthoppers.

Non-retroviral endogenous viral elements (nrEVEs) are widely dispersed throughout the genomes of eukaryotes. Although nrEVEs are known to be involved in host antiviral immunity, it remains an open question whether they can be domesticated as functional proteins to serve cellular innovations in arthropods. In this study, we found that endogenous toti-like viral elements (ToEVEs) are ubiquitously integrated into the genomes of three planthopper species, with highly variable distributions and polymorphism levels in planthopper populations. Three ToEVEs display exon‒intron structures and active transcription, suggesting that they might have been domesticated by planthoppers. CRISPR/Cas9 experiments revealed that one ToEVE in Nilaparvata lugens, NlToEVE14, has been co-opted by its host and plays essential roles in planthopper development and fecundity. Large-scale analysis of ToEVEs in arthropod genomes indicated that the number of arthropod nrEVEs is currently underestimated and that they may contribute to the functional diversity of arthropod genes.

Occurrence of Watermelon silver mottle virus in Peanut in China.

Watermelon silver mottle virus (WSMoV), a member of the genus Orthotospovirus of the family Bunyaviridae, was first identified in watermelon in Okinawa prefecture, in Japan (Iwaki et al. 1984). Subsequently, it was reported in a variety of solanaceae and cucurbitaceae crops such as tomato, pepper, and watermelon (Jones et al. 2005). WSMoV is naturally transmitted by vector thrips, and cause chlorotic, ring spots, and crinkling in the hosts (Yeh et al. 1992; Jones et al. 2005). So far, no confirmed reports exist regarding the WSMoV infecting peanut (Arachis hypogaea L.). In a field survey conducted in Yunnan Province, China during July 2022, young peanut plants were observed that were severely stunted (Fig. S1A). The leaves of five symptomatic peanut plants were randomly collected and used to identify potential pathogens via high throughput sequencing (HTS) analysis. Total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Approximately 10 µg of total RNA was purified using magnetic beads (Thermo Fischer Scientific, U.S.A.). A TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA) was utilized for constructing the RNA sequencing library and transcriptome sequencing was performed on an Illumina HiSeq4000 platform (LC Sciences, USA) with a paired-end 150 bp manner. After RNA-seq, 35962944 raw reads were generated as paired-end data. Following quality control, a total of 34026806 clean reads were retained and subsequently assembled into contigs using Trinity software (version 2.8.5). The BLASTn analysis showed that three contigs mapped to the L, M, and S RNA segments of the WSMoV isolates, respectively (accession no. AY863200.1; no. AB042650.1; no. U75379.1). The lengths of three contigs were 8913 bp, 4921 bp, and 3558 bp, and the breadth coverage were 99.97%, 100%, and 100%, respectively. The sequences for L, M and S RNA segments of the WSMoV isolate from Yunnan were submitted to NCBI with the accession number OR123869-OR123871. Specific primers were designed for the nucleocapsid protein (NP) on WSMoV S RNA (5'-ATGTCTAACGTTAAGCAGCT-3'; 5'-TTACACTTCTAAGGAGGTGCT-3'; 828 bp) and the RNA-dependent RNA polymerase (RdRP) on WSMoV L RNA (5'-CTATATGTGCAGGGGGCTGG-3'; 5'- ACCCCTCAATTATGCTCGGC -3'; 948 bp) to verify the presence of WSMoV in peanut plants by RT-PCR. The expected PCR products were successfully amplified from each of the symptomatic tested plants, while not in negative controls (Fig. S1, B and C). Furthermore, the extracted total RNA was subjected to small RNA sequencing, and the results showed the detected small RNAs present a major peak at 21 nt and 22 nt (Fig. S1D). This further confirmed the natural infection of WSMoV in stunted peanut plants. RDRP, an important conserved protein in RNA viruses, which is in the L RNA segment of WSMoV, was selected to construct the phylogenetic tree. The results showed that the WSMoV isolate from Yunnan (OR123869) clustered separately from previously reported isolates (Fig. S2). Numerous economically important crops infected with WSMoV in China have experienced severe economic losses (Rao et al. 2011; Tang et al. 2015). Our data has provided the first confirmation of WSMoV naturally infecting peanuts in China, increasing our knowledge of the virus's host range. Further research is needed to determine this virus's specific vectors, the scope of its spread, and its impact on China's peanut production.

Horizontally Transferred Salivary Protein Promotes Insect Feeding by Suppressing Ferredoxin-Mediated Plant Defenses.

Herbivorous insects such as whiteflies, planthoppers, and aphids secrete abundant orphan proteins to facilitate feeding. Yet, how these genes are recruited and evolve to mediate plant-insect interaction remains unknown. In this study, we report a horizontal gene transfer (HGT) event from fungi to an ancestor of Aleyrodidae insects approximately 42 to 190 million years ago. BtFTSP1 is a salivary protein that is secreted into host plants during Bemisia tabaci feeding. It targets a defensive ferredoxin 1 in Nicotiana tabacum (NtFD1) and disrupts the NtFD1-NtFD1 interaction in plant cytosol, leading to the degradation of NtFD1 in a ubiquitin-dependent manner. Silencing BtFTSP1 has negative effects on B. tabaci feeding while overexpressing BtFTSP1 in N. tabacum benefits insects and rescues the adverse effect caused by NtFD1 overexpression. The association between BtFTSP1 and NtFD1 is newly evolved after HGT, with the homologous FTSP in its fungal donor failing to interact and destabilize NtFD1. Our study illustrates the important roles of horizontally transferred genes in plant-insect interactions and suggests the potential origin of orphan salivary genes.

Alternative splicing impacts the rice stripe virus response transcriptome.

Alternative splicing (AS) is an important form of post transcriptional modification present in both animals and plants. However, little information was obtained about AS events in response to plant virus infection. In this study, we conducted a genome-wide transcriptome analysis on AS change in rice infected by a devastating virus, Rice stripe virus (RSV). KEGG analysis was performed on the differentially expressed (DE) genes and differentially alternative spliced (DAS) genes. The results showed that DE genes were significantly enriched in the pathway of interaction with plant pathogens. The DAS genes were mainly enriched in basal metabolism and RNA splicing pathways. The heat map clustering showed that DEGs clusters were mainly enriched in regulation of transcription and defense response while differential transcript usage (DTU) clusters were strongly enriched in mRNA splicing and calcium binding. Overall, our results provide a fundamental basis for gene-wide AS changes in rice after RSV infection.

Road Narrow-Inspired Strain Concentration to Wide-Range-Tunable Gauge Factor of Ionic Hydrogel Strain Sensor.

The application of stretchable strain sensors in human movement recognition, health monitoring, and soft robotics has attracted wide attention. Compared with traditional electronic conductors, stretchable ionic hydrogels are more attractive to organization-like soft electronic devices yet suffer poor sensitivity due to limited ion conduction modulation caused by their intrinsic soft chain network. This paper proposes a strategy to modulate ion transport behavior by geometry-induced strain concentration to adjust and improve the sensitivity of ionic hydrogel-based strain sensors (IHSS). Inspired by the phenomenon of vehicles slowing down and changing lanes when the road narrows, the strain redistribution of ionic hydrogel is optimized by structural and mechanical parameters to produce a strain-induced resistance boost. As a result, the gauge factor of the IHSS is continuously tunable from 1.31 to 9.21 in the strain range of 0-100%, which breaks through the theoretical limit of homogeneous strain-distributed ionic hydrogels and ensures a linear electromechanical response simultaneously. Overall, this study offers a universal route to modulate the ion transport behavior of ionic hydrogels mechanically, resulting in a tunable sensitivity for IHSS to better serve different application scenarios, such as health monitoring and human-machine interface.