Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 174
Filtrar
1.
Stud Mycol ; 105: 1-22, 2023 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38895705

RESUMO

The subphylum Saccharomycotina is a lineage in the fungal phylum Ascomycota that exhibits levels of genomic diversity similar to those of plants and animals. The Saccharomycotina consist of more than 1 200 known species currently divided into 16 families, one order, and one class. Species in this subphylum are ecologically and metabolically diverse and include important opportunistic human pathogens, as well as species important in biotechnological applications. Many traits of biotechnological interest are found in closely related species and often restricted to single phylogenetic clades. However, the biotechnological potential of most yeast species remains unexplored. Although the subphylum Saccharomycotina has much higher rates of genome sequence evolution than its sister subphylum, Pezizomycotina, it contains only one class compared to the 16 classes in Pezizomycotina. The third subphylum of Ascomycota, the Taphrinomycotina, consists of six classes and has approximately 10 times fewer species than the Saccharomycotina. These data indicate that the current classification of all these yeasts into a single class and a single order is an underappreciation of their diversity. Our previous genome-scale phylogenetic analyses showed that the Saccharomycotina contains 12 major and robustly supported phylogenetic clades; seven of these are current families (Lipomycetaceae, Trigonopsidaceae, Alloascoideaceae, Pichiaceae, Phaffomycetaceae, Saccharomycodaceae, and Saccharomycetaceae), one comprises two current families (Dipodascaceae and Trichomonascaceae), one represents the genus Sporopachydermia, and three represent lineages that differ in their translation of the CUG codon (CUG-Ala, CUG-Ser1, and CUG-Ser2). Using these analyses in combination with relative evolutionary divergence and genome content analyses, we propose an updated classification for the Saccharomycotina, including seven classes and 12 orders that can be diagnosed by genome content. This updated classification is consistent with the high levels of genomic diversity within this subphylum and is necessary to make the higher rank classification of the Saccharomycotina more comparable to that of other fungi, as well as to communicate efficiently on lineages that are not yet formally named. Taxonomic novelties: New classes: Alloascoideomycetes M. Groenew., Hittinger, Opulente & A. Rokas, Dipodascomycetes M. Groenew., Hittinger, Opulente & A. Rokas, Lipomycetes M. Groenew., Hittinger, Opulente, A. Rokas, Pichiomycetes M. Groenew., Hittinger, Opulente & A. Rokas, Sporopachydermiomycetes M. Groenew., Hittinger, Opulente & A. Rokas, Trigonopsidomycetes M. Groenew., Hittinger, Opulente & A. Rokas. New orders: Alloascoideomycetes: Alloascoideales M. Groenew., Hittinger, Opulente & A. Rokas; Dipodascomycetes: Dipodascales M. Groenew., Hittinger, Opulente & A. Rokas; Lipomycetes: Lipomycetales M. Groenew., Hittinger, Opulente & A. Rokas; Pichiomycetes: Alaninales M. Groenew., Hittinger, Opulente & A. Rokas, Pichiales M. Groenew., Hittinger, Opulente & A. Rokas, Serinales M. Groenew., Hittinger, Opulente & A. Rokas; Saccharomycetes: Phaffomycetales M. Groenew., Hittinger, Opulente & A. Rokas, Saccharomycodales M. Groenew., Hittinger, Opulente & A. Rokas; Sporopachydermiomycetes: Sporopachydermiales M. Groenew., Hittinger, Opulente & A. Rokas; Trigonopsidomycetes: Trigonopsidales M. Groenew., Hittinger, Opulente & A. Rokas. New families: Alaninales: Pachysolenaceae M. Groenew., Hittinger, Opulente & A. Rokas; Pichiales: Pichiaceae M. Groenew., Hittinger, Opulente & A. Rokas; Sporopachydermiales: Sporopachydermiaceae M. Groenew., Hittinger, Opulente & A. Rokas. Citation: Groenewald M, Hittinger CT, Bensch K, Opulente DA, Shen X-X, Li Y, Liu C, LaBella AL, Zhou X, Limtong S, Jindamorakot S, Gonçalves P, Robert V, Wolfe KH, Rosa CA, Boekhout T, Cadez N, Péter G, Sampaio JP, Lachance M-A, Yurkov AM, Daniel H-M, Takashima M, Boundy-Mills K, Libkind D, Aoki K, Sugita T, Rokas A (2023). A genome-informed higher rank classification of the biotechnologically important fungal subphylum Saccharomycotina. Studies in Mycology 105: 1-22. doi: 10.3114/sim.2023.105.01 This study is dedicated to the memory of Cletus P. Kurtzman (1938-2017), a pioneer of yeast taxonomy.

2.
BMC Psychiatry ; 19(1): 104, 2019 04 03.
Artigo em Inglês | MEDLINE | ID: mdl-30943938

RESUMO

BACKGROUND: Controversial findings regarding the association between pro-inflammatory cytokines and depression have been reported in pregnant subjects. Scarce data about anxiety and its relationships with cytokines are available in pregnant women. To understand the association between anxiety and cytokines during pregnancy, we conducted the present study in women with or without depression. METHODS: Women exhibiting severe depression (SD) and severe anxiety (SA) during the 3rd trimester of pregnancy (n = 139) and control subjects exhibiting neither depression nor anxiety (n = 40) were assessed through the Hamilton Depression Rating Scale (HDRS) and the Hamilton Anxiety Rating Scale (HARS). Serum cytokines were measured by a multiplex bead-based assay. Correlation tests were used to analyze the data and comparisons between groups were performed. A general linear model of analysis of variance was constructed using the group as a dependent variable, interleukin concentrations as independent variables, and HDRS/HARS scores and gestational weeks as covariables. RESULTS: The highest levels of Th1- (IL-6, TNF-α, IL-2, IFN-γ), Th17- (IL-17A, IL-22), and Th2- (IL-9, IL-10, and IL-13) related cytokines were observed in women with SD + SA. The SA group showed higher concentrations of Th1- (IL-6, TNF-α, IL-2, IFN-γ) and Th2- (IL-4, and IL-10) related cytokines than the controls. Positive correlations were found between HDRS and IL-2, IL-6, and TNF-α in the SA group (p < 0.03), and between HDRS and Th1- (IL-2, IL-6, TNF-α), Th2- (IL-9, IL-10, IL-13) and Th17- (IL-17A) cytokines (p < 0.05) in the SD + SA group. After controlling the correlation analysis by gestational weeks, the correlations that remained significant were: HDRS and IL-2, IL-6, IL-9, and IL-17A in the SD + SA group (p < 0.03). HARS scores correlated with IL-17A in the SA group and with IL-17A, IL-17F, and IL-2 in the SD + SA group (p < 0.02). The linear model of analysis of variance showed that HDRS and HARS scores influenced cytokine concentrations; only IL-6 and TNF-α could be explained by the group. CONCLUSIONS: We found that the cytokine profiles differ when comparing pregnant subjects exhibiting SA with comorbid SD against those showing only SA without depression.


Assuntos
Ansiedade/imunologia , Depressão/imunologia , Complicações na Gravidez/imunologia , Adulto , Transtornos de Ansiedade , Estudos de Casos e Controles , Citocinas/sangue , Feminino , Humanos , Interleucina-10/sangue , Interleucina-17/sangue , Gravidez , Gestantes , Fator de Necrose Tumoral alfa/sangue , Adulto Jovem
3.
Osteoarthritis Cartilage ; 24(7): 1190-9, 2016 07.
Artigo em Inglês | MEDLINE | ID: mdl-26944197

RESUMO

OBJECTIVE: A number of promising compounds developed for osteoarthritic pain have failed to demonstrate clinical efficacy. To enhance preclinical translational research for osteoarthritis, a model of knee osteoarthritis pain was developed in Macaca fascicularis and the effects of two distinct pharmacological classes of drugs were tested on pain-related behavior. DESIGN: Behavioral assessments were developed specifically for the macaque. Baseline knee pressure threshold and weight bearing were assessed prior to a unilateral medial meniscectomy (MMx). Fifteen days following MMx, macaques underwent a once daily exercise regimen for 36 days. Sixty-seven days following MMx, macaques were assigned to one of three treatment groups (n = 3/group), either non-steroidal anti-inflammatory drug (NSAID) diclofenac, NK1 receptor antagonist aprepitant or vehicle, and treated for 5 days. Animals were tested 3-4 h after p.o. dosing and testing was performed blinded. Treatment utilized a crossover design-each animal received all treatments-and a 9-day washout period was utilized between treatments. RESULTS: Vehicle-treated macaques consistently demonstrated decreased ipsilateral pressure threshold ("hyperalgesia") and decreased weight bearing. While diclofenac increased weight bearing and pressure threshold, full attenuation of pain was not obtained. No significant improvement of either knee pressure or weight bearing was observed with aprepitant. CONCLUSIONS: Unilateral MMx in the macaque evoked pain-related behaviors and knee joint pathology reminiscent of osteoarthritis. The behavioral endpoints were sensitive to NSAID treatment but not sensitive to NK1 receptor block, which parallel clinical findings. The current macaque osteoarthritis model could be used to test potential treatments for osteoarthritis pain.


Assuntos
Dor , Animais , Anti-Inflamatórios não Esteroides , Articulação do Joelho , Macaca , Meniscectomia , Osteoartrite do Joelho
4.
Stud Mycol ; 81: 27-53, 2015 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-26955197

RESUMO

In addition to rusts, the subphylum Pucciniomycotina (Basidiomycota) includes a large number of unicellular or dimorphic fungi which are usually studied as yeasts. Ribosomal DNA sequence analyses have shown that the current taxonomic system of the pucciniomycetous yeasts which is based on phenotypic criteria is not concordant with the molecular phylogeny and many genera are polyphyletic. Here we inferred the molecular phylogeny of 184 pucciniomycetous yeast species and related filamentous fungi using maximum likelihood, maximum parsimony and Bayesian inference analyses based on the sequences of seven genes, including the small subunit ribosomal DNA (rDNA), the large subunit rDNA D1/D2 domains, the internal transcribed spacer regions (ITS 1 and 2) of rDNA including the 5.8S rDNA gene; the nuclear protein-coding genes of the two subunits of DNA polymerase II (RPB1 and RPB2) and the translation elongation factor 1-α (TEF1); and the mitochondrial gene cytochrome b (CYTB). A total of 33 monophyletic clades and 18 single species lineages were recognised among the pucciniomycetous yeasts employed, which belonged to four major lineages corresponding to Agaricostilbomycetes, Cystobasidiomycetes, Microbotryomycetes and Mixiomycetes. These lineages remained independent from the classes Atractiellomycetes, Classiculomycetes, Pucciniomycetes and Tritirachiomycetes formed by filamentous taxa in Pucciniomycotina. An updated taxonomic system of pucciniomycetous yeasts implementing the 'One fungus = One name' principle will be proposed based on the phylogenetic framework presented here.

5.
Water Sci Technol ; 62(11): 2647-54, 2010.
Artigo em Inglês | MEDLINE | ID: mdl-21099053

RESUMO

The effectiveness of acidic thermal treatment (ATT) was examined in a 106-day continuous experiment, when applied to one- or two-stage anaerobic digestion of sewage sludge (4.3% TS). The ATT was performed at 170 °C and pH 5 for 1 hour (sulfuric acid for lowering pH). The one-stage process was mesophilic at 20 days hydraulic retention time (HRT), and incorporated the ATT as pre-treatment. The two-stage process consisted of a thermophilic digester at 5 days HRT and a mesophilic digester at 15 days HRT, and incorporated the ATT as interstage-treatment. On average, VSS reduction was 48.7% for the one-stage control, 65.8% for the one-stage ATT, 52.7% for the two-stage control and 67.6% for the two-stage ATT. Therefore, VSS reduction was increased by 15-17%, when the ATT was combined in both one- and two-stage processes. In addition, the dewaterability of digested sludge was remarkably improved, and phosphate release was enhanced. On the other hand, total methane production did not differ significantly, and color generation was noted in the digested sludge solutions with the ATT. In conclusion, the anaerobic digestion with ATT can be an attractive alternative for sludge reduction, handling, and phosphorus recovery.


Assuntos
Temperatura Alta , Esgotos/química , Anaerobiose , Concentração de Íons de Hidrogênio , Fósforo/química , Fatores de Tempo , Poluentes Químicos da Água
6.
J Oral Rehabil ; 37(12): 884-91, 2010 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-20557434

RESUMO

Fibroptic endoscopic evaluation of swallowing (FEES) is a useful way for dentists to evaluate oropharyngeal dysfunction. However, no study has paid attention to inter- and intra-rater reliability of FEES evaluation about oropharyngeal dysfunction. The purpose of this study is to verify whether dentist who trained and experienced for evaluation of dysphagia could diagnose oropharyngeal function with FEES. Nine dentists independently evaluated FEES images of 10 cases four times each. At first, evaluators performed the first evaluation without consulting the evaluative criteria. Subsequently, evaluators independently re-evaluated at 1-week intervals for three consecutive weeks, consulting the evaluative criteria. And then, inter- and intra-rater reliability was calculated. Cohen's Kappa was used to assess reliability. The results found that overall inter-rater reliability was 0·35±0·04 (first evaluation), 0·45±0·05 (s), 0·44±0·05 (third) and 0·46±0·04 (fourth). Most of inter-rater reliability related to aspiration was moderate to high, but lower for categories that evaluated timing of swallowing and mastication. In contrast, intra-rater reliability was moderate to high for overall categories, at 0·53±0·04 (first vs. second evaluation), 0·55±0·04 (first vs. third), 0·53±0·04 (first vs. fourth), 0·55±0·03 (second vs. third), 0·60±0·03 (second vs. fourth) and 0·78±0·03 (third vs. fourth). FEES is reliable for experienced dentists to diagnose oropharyngeal function. Moreover, repeated evaluation with the aids of evaluative criteria is useful to improve the reliability of FEES.


Assuntos
Transtornos de Deglutição/diagnóstico , Deglutição/fisiologia , Odontólogos/normas , Endoscópios , Fibras Ópticas , Adulto , Tosse/etiologia , Glote/fisiopatologia , Humanos , Processamento de Imagem Assistida por Computador , Mastigação/fisiologia , Contração Muscular/fisiologia , Variações Dependentes do Observador , Orofaringe/fisiopatologia , Músculos Faríngeos/fisiopatologia , Faringe/fisiopatologia , Nervo Laríngeo Recorrente/fisiopatologia , Reflexo Anormal/fisiologia , Reprodutibilidade dos Testes , Aspiração Respiratória/diagnóstico , Fatores de Tempo , Paralisia das Pregas Vocais/diagnóstico
7.
Artigo em Inglês | MEDLINE | ID: mdl-20424495

RESUMO

BACKGROUND/AIMS: To determine if patients with benign paroxysmal positional vertigo (BPPV) have a higher frequency of rhinosinusitis than people with normal vestibular function. METHODS: The subjects were 52 patients with BPPV and 46 normal people. Every subject had a sinus CT scan, a blood draw for IgE and a rhinologic examination by an otolaryngologist. RESULTS: The frequency of rhinosinusitis based on physician diagnosis was 49% and based on CT scan findings 59%. This difference approached significance (p = 0.08). The observed frequency of rhinosinusitis was higher than predicted by survey data about the southern US region. The data trended toward higher prevalence of rhinosinusitis (by physician diagnosis) in the BPPV patients versus controls (58 vs. 39%, p = 0.06). CONCLUSION: BPPV patients have a higher frequency of sinus disease compared to people with normal vestibular systems, perhaps due to age differences, but physiologic factors may also be involved. The higher frequency of rhinosinusitis in this geographical area than reported rates based on survey data raises concerns about the usefulness of questionnaire data for estimating population prevalence.


Assuntos
Doenças dos Seios Paranasais/complicações , Doenças dos Seios Paranasais/epidemiologia , Vertigem/complicações , Vertigem/epidemiologia , Estudos de Casos e Controles , Distribuição de Qui-Quadrado , Feminino , Humanos , Imunoglobulina E/sangue , Masculino , Pessoa de Meia-Idade , Doenças dos Seios Paranasais/diagnóstico por imagem , Fatores de Risco , Texas/epidemiologia , Tomografia Computadorizada por Raios X , Vertigem/fisiopatologia
8.
Int J Syst Evol Microbiol ; 60(Pt 5): 1215-1218, 2010 May.
Artigo em Inglês | MEDLINE | ID: mdl-19666804

RESUMO

Three isolates, typified by Pro94 Y29(T) (=JCM 13290(T) =CBS 9278(T) =DBVPG 7841(T)), that represent a novel species, Rhodotorula arctica sp. nov., were studied. R. arctica differed from its only close relative, Bensingtonia yamatoana, by requiring thiamine and by failing to assimilate maltose and quinate, but strain Pro94 Y29(T) could be most readily identified using the rDNA sequence of the LSU D1/D2 region, which differed from that of B. yamatoana CBS 7423(T) at four positions, and the ITS sequence, which differed at nine positions. One R. arctica isolate, Pro94 Y56 (=JCM 13292 =CBS 9280 =DBVPG Y7843), was unique in requiring either l-arginine or l-citrulline as a source of nitrogen.


Assuntos
Rhodotorula/classificação , Rhodotorula/isolamento & purificação , Microbiologia do Solo , Regiões Árticas , Arginina/metabolismo , Citrulina/metabolismo , Meios de Cultura , DNA Fúngico/análise , DNA Ribossômico/análise , DNA Espaçador Ribossômico/análise , Genótipo , Dados de Sequência Molecular , Técnicas de Tipagem Micológica , Fenótipo , Filogenia , Rhodotorula/genética , Rhodotorula/fisiologia , Análise de Sequência de DNA , Especificidade da Espécie , Tiamina/metabolismo
9.
Anim Genet ; 39(3): 207-16, 2008 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-18371128

RESUMO

The human chromodomain protein, Y-like (CDYL) gene family consists of three members, one on the Y chromosome (CDY) and two on autosomes (CDYL and CDYL2). Studies in the human and mouse showed that genes in the CDYL family are abundantly expressed in testis and play an important role in spermatogenesis. In this study, we have characterized the bovine CDYL (bCDYL) and CDYL2 (bCDYL2) genes. We found that bCDYL and bCDYL2 are very similar to the human orthologues at both mRNA (79% and 85%) and protein (89% and 93%) levels. However, the similarity between the bCDYL and bCDYL2 proteins is low (41%). The bCDYL gene is composed of nine exons, and the bCDYL2 has seven exons. The bCDYL and bCDYL2 genes were mapped by radiation hybrid mapping to bovine chromosomes (BTA) 24 and 18 respectively. The bCDYL gene has four transcript variants that produce four protein isoforms. RT-PCR expression analysis in 12 bovine tissues showed that bCDYL variant 2 was expressed in the testis only, bCDYL variants 1, 3 and 4 were expressed predominantly in the testis and at very low or undetectable levels in the remaining tissues and bCDYL2 was expressed ubiquitously. Examination of bovine testis with in situ hybridization revealed that the bCDYL and bCDYL2 transcripts were found mainly in spermatids, though the amounts of transcripts varied among genes/variants. In addition, antisense transcripts were detected in bCDYL variants 2/3 and 4, as well as in the bCDYL2 gene.


Assuntos
Bovinos/genética , Cromossomos de Mamíferos , Espermátides/metabolismo , Testículo/metabolismo , Sequência de Aminoácidos , Animais , Sequência de Bases , Proteínas Correpressoras , Mapeamento de Sequências Contíguas , DNA Complementar/genética , Etiquetas de Sequências Expressas , Expressão Gênica , Biblioteca Gênica , Variação Genética , Histona Acetiltransferases , Humanos , Hidroliases , Masculino , Camundongos , Dados de Sequência Molecular , Proteínas Nucleares/genética , Fases de Leitura Aberta , Proteínas/genética , RNA Antissenso , Mapeamento de Híbridos Radioativos
10.
Vet Parasitol ; 146(3-4): 281-7, 2007 May 31.
Artigo em Inglês | MEDLINE | ID: mdl-17391851

RESUMO

A monoclonal antibody produced against ovary extracts from the worm Ascaris suum showed immunoreactivity against granules in the rachis and oocytes, the inner layer of the eggshell and the middle layer of some egg, but not against either ovary wall or uterus wall. Furthermore, the same antigens were detected on the body surface of migrated larva in guinea pig lung, whereas none were detected in adult male worm or adult female worm, except for the female reproductive organs. The ovary extracts were passed through an affinity column and the eluted fractions analyzed by SDS-PAGE, Western blotting and native-PAGE. Western blotting after SDS-PAGE detected chemiluminescence primarily as three bands of about 70, 78 and 90 kDa. However, Western blotting after native-PAGE of the partially purified ovary extracts demonstrated only one band at a position of about 230 kDa. LC-nanoESI-MS/MS analysis of protein band gel slices from silver-stained SDS-PAGE revealed one peptide sequence "ILVGLIGTNR", that matched only the hypothetical protein F14D2.8 of Caenorhabditis elegans (gi/7499081).


Assuntos
Anticorpos Anti-Helmínticos/imunologia , Anticorpos Monoclonais/imunologia , Antígenos de Helmintos/química , Ascaris suum/imunologia , Animais , Antígenos de Helmintos/imunologia , Eletroforese , Feminino , Imunoglobulina G/imunologia , Ovário
11.
Med Mycol ; 43(1): 21-6, 2005 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-15712605

RESUMO

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.


Assuntos
Doenças do Gato/microbiologia , DNA Espaçador Ribossômico/genética , Dermatomicoses/veterinária , Doenças do Cão/microbiologia , Variação Genética , Malassezia/classificação , Animais , Sequência de Bases , Gatos , DNA Fúngico/análise , DNA Espaçador Ribossômico/análise , Dermatomicoses/microbiologia , Cães , Malassezia/genética , Dados de Sequência Molecular , RNA Ribossômico/genética , Análise de Sequência de DNA , Pele/microbiologia
12.
Environ Technol ; 24(1): 17-22, 2003 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-12641248

RESUMO

Polyurethane foam sponge media were examined with respect to their ability to control filamentous bulking in a sequencing batch reactor process. In a high-rate nutrient removal study conducted with a 201 lab-scale reactor and synthetic wastewater of approximately 200 mgBOD 1(1), the presence of 20% v/v sponge media in the reactor improved the settling properties of biomass significantly, resulting in enhanced nutrient removal performance, i.e., < 10 mgT-N 1(-1) and < 1 mgT-P 1(-1) even at the HRT of 0.67 day. Without the support of sponge media, the suspended biomass was so bulky as to lead to its heavy washout from the reactor. A microscopic study under filamentous bulking revealed that the sponge media physically cut or broke biomass to shorter filaments and smaller flocs, mitigating the severe bulking condition. Indirect effects derived from the physical breakdown of biomass, such as more aerobic conditions in flocs, are expected to further create favorable conditions for suppressing filamentous bulking.


Assuntos
Reatores Biológicos , Materiais de Construção , Poliuretanos/química , Eliminação de Resíduos Líquidos/métodos , Bactérias , Biomassa , Floculação , Dinâmica Populacional , Porosidade
13.
Vet J ; 165(2): 164-8, 2003 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-12573606

RESUMO

The location and separation of Ascaris suum antigen for serological testing was investigated. The antigenic constituent was rich in the ovary of the adult worm and was obtained by dialysis with 50% ammonium sulphate saturated solution. Sodium dodecyl sulphate polyacrylamide gel electrophoresis and immunoblotting analysis demonstrated that the heat labile antigenic preparation showed one major and seven faint bands. The major band seemed also to be a glycoprotein. The sera from pigs with/without hepatic milk spot showed relatively high precipitation titres, while, those from the specific pathogen free pigs manifested low titres.


Assuntos
Antígenos de Helmintos/análise , Ascaris suum/imunologia , Doenças dos Suínos/parasitologia , Animais , Eletroforese em Gel de Poliacrilamida/veterinária , Feminino , Immunoblotting , Masculino , Ovário , Análise para Determinação do Sexo/veterinária , Suínos , Doenças dos Suínos/diagnóstico
14.
Aliment Pharmacol Ther ; 16(4): 799-806, 2002 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-11929399

RESUMO

AIMS: To investigate the effects of Helicobacter pylori infection and eradication on nutrition. METHODS: The body weight, height, blood pressure, gastric juice pH and fasting serum levels of glucose, total protein, albumin, total cholesterol and triglyceride were measured in H. pylori-positive and H. pylori-negative subjects, and the effect of eradication of H. pylori on these parameters was determined. The development of gastro-oesophageal reflux disease after treatment was also examined. Eight patients underwent a pancreatic function test before and after H. pylori eradication therapy. RESULTS: The incidence of hypoproteinaemia in H. pylori-positive subjects was significantly higher than that in H. pylori-negative subjects. After eradication of H. pylori, the gastric juice pH values were significantly decreased, and the body weight and serum levels of total cholesterol, total protein and albumin were significantly increased. The incidence of hyperlipidaemia significantly increased and that of hypoproteinaemia significantly decreased in the group with eradication. Pancreatic function improved significantly after eradication of H. pylori. No significant changes in these parameters were observed in the group without eradication. Obese patients had a higher risk of the development of gastro-oesophageal reflux disease after eradication of H. pylori infection. CONCLUSIONS: The eradication of H. pylori appears to improve some nutritional parameters.


Assuntos
Infecções por Helicobacter/fisiopatologia , Helicobacter pylori , Estado Nutricional/fisiologia , Pressão Sanguínea/fisiologia , Peso Corporal/fisiologia , Quimioterapia Combinada , Feminino , Determinação da Acidez Gástrica , Refluxo Gastroesofágico/etiologia , Infecções por Helicobacter/complicações , Infecções por Helicobacter/tratamento farmacológico , Humanos , Hiperlipidemias/etiologia , Hipoproteinemia/etiologia , Masculino , Pessoa de Meia-Idade , Obesidade/etiologia , Testes de Função Pancreática
15.
Aliment Pharmacol Ther ; 15(12): 1929-37, 2001 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-11736724

RESUMO

BACKGROUND: Omeprazole is mainly metabolized in the liver by CYP2C19, a genetically determined enzyme, whereas rabeprazole is mainly reduced non-enzymatically and partially metabolized by CYP2C19. The therapeutic effects of rabeprazole are therefore assumed to be less affected by an individual's CYP2C19 status. AIM: To investigate the acid inhibitory effects and plasma levels of omeprazole and rabeprazole with reference to different CYP2C19 genotypes. METHODS: Fifteen healthy volunteers took a daily dose of 20 mg of omeprazole or rabeprazole for 8 days. On post-dose days 1 and 8, 24-h profiles of intragastric pH were recorded and plasma concentrations of omeprazole, rabeprazole and their metabolites were determined. RESULTS: After single and repeated doses of omeprazole, the intragastric pH values and plasma concentrations of omeprazole and its metabolites were significantly dependent on the CYP2C19 genotype. Significant differences in the same kinetic and dynamic parameters were also observed after single doses of rabeprazole. Although the plasma levels of rabeprazole differed among the different CYP2C19 genotype groups after repeated doses, no significant differences in intragastric pH values were observed. CONCLUSIONS: The acid inhibitory effects of omeprazole and rabeprazole are significantly dependent on the CYP2C19 genotype status, as well as on their intrinsic pharmacokinetic and pharmacodynamic characteristics and dosing schemes.


Assuntos
Antiulcerosos/farmacocinética , Hidrocarboneto de Aril Hidroxilases , Benzimidazóis/farmacocinética , Sistema Enzimático do Citocromo P-450/metabolismo , Oxigenases de Função Mista/metabolismo , Omeprazol/farmacocinética , 2-Piridinilmetilsulfinilbenzimidazóis , Adulto , Antiulcerosos/sangue , Antiulcerosos/metabolismo , Benzimidazóis/sangue , Benzimidazóis/metabolismo , Estudos Cross-Over , Citocromo P-450 CYP2C19 , Sistema Enzimático do Citocromo P-450/genética , Método Duplo-Cego , Feminino , Determinação da Acidez Gástrica , Genótipo , Humanos , Concentração de Íons de Hidrogênio , Fígado/enzimologia , Masculino , Oxigenases de Função Mista/genética , Omeprazol/sangue , Omeprazol/metabolismo , ATPases Translocadoras de Prótons/antagonistas & inibidores , Rabeprazol
16.
Infect Immun ; 69(12): 7380-6, 2001 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-11705911

RESUMO

During infection, parasites evade the host immune system by modulating or exploiting the immune system; e.g., they suppress expression of major histocompatibility complex class II molecules or secrete cytokine-like molecules. However, it is not clear whether helminths disturb the immune responses of their hosts by controlling the antigen-processing pathways of the hosts. In this study, we identified a new cysteine protease inhibitor, nippocystatin, derived from excretory-secretory (ES) products of an intestinal nematode, Nippostrongylus brasiliensis. Nippocystatin, which belongs to cystatin family 2, consists of 144 amino acids and is secreted as a 14-kDa mature form. In vivo treatment of ovalbumin (OVA)-immunized mice with recombinant nippocystatin (rNbCys) profoundly suppressed OVA-specific proliferation of splenocytes but not non-antigen-specific proliferation of splenocytes. OVA-specific cytokine production was also greatly suppressed in rNbCys-treated mice. Although the serum levels of both OVA-specific immunoglobulin G1 (IgG1) and IgG2a were not affected by rNbCys treatment, OVA-specific IgE was preferentially downregulated in rNbCys-treated mice. In vitro rNbCys inhibited processing of OVA by lysosomal cysteine proteases from the spleens of mice. Mice with anti-nippocystatin antibodies became partially resistant to infection with N. brasiliensis. Based on these findings, N. brasiliensis appears to skillfully evade host immune systems by secreting nippocystatin, which modulates antigen processing in antigen-presenting cells of hosts.


Assuntos
Apresentação de Antígeno/efeitos dos fármacos , Antígenos de Helmintos/imunologia , Cistatinas/farmacologia , Inibidores de Cisteína Proteinase/farmacologia , Nippostrongylus/imunologia , Sequência de Aminoácidos , Animais , Especificidade de Anticorpos , Cistatinas/genética , Cistatinas/metabolismo , Inibidores de Cisteína Proteinase/genética , Inibidores de Cisteína Proteinase/metabolismo , Camundongos , Camundongos Endogâmicos BALB C , Modelos Moleculares , Dados de Sequência Molecular , Ovalbumina/imunologia , Homologia de Sequência de Aminoácidos , Baço/citologia , Baço/imunologia , Infecções por Strongylida/imunologia
17.
Brain Res ; 915(1): 112-7, 2001 Oct 05.
Artigo em Inglês | MEDLINE | ID: mdl-11578628

RESUMO

We determined the anti-convulsion activity of phenytoin (PHT) using the maximum electron shock method in mice fed diets containing various concentrations of iron for 18 weeks. Dietary iron reduces the anti-convulsion activity of PHT in a dose-dependent manner (0-6100 ppm). High concentrations of PHT are detected in the plasma of mice fed a high iron diet compared with those fed normal and low iron diets, in contrast to the pharmacological effect. However, the concentration of PHT in the brains of mice fed high amounts of dietary iron decreased significantly 3 h after treatment with PHT, consistent with the anti-convulsion effect of PHT. The relationship between brain and plasma-unbound concentrations of PHT indicates that the penetration of PHT into brain is significantly inhibited by dietary iron.


Assuntos
Anticonvulsivantes/sangue , Encéfalo/efeitos dos fármacos , Epilepsia/sangue , Epilepsia/tratamento farmacológico , Alimentos Formulados/efeitos adversos , Ferro/sangue , Fenitoína/sangue , Animais , Barreira Hematoencefálica/efeitos dos fármacos , Barreira Hematoencefálica/fisiologia , Encéfalo/metabolismo , Encéfalo/fisiopatologia , Relação Dose-Resposta a Droga , Interações Medicamentosas/fisiologia , Eletrochoque , Epilepsia/fisiopatologia , Hematócrito , Deficiências de Ferro , Masculino , Camundongos
18.
Hinyokika Kiyo ; 47(6): 411-4, 2001 Jun.
Artigo em Japonês | MEDLINE | ID: mdl-11496397

RESUMO

A 43-year-old male visited our hospital with the complaint of right flank colicky pain. Computed tomographic (CT)-scan and angiography showed large renal tumor with liver invasion and tumor thrombosis in the vena cava. Multiple lung and bone tumors were also recognized. Percutaneous biopsy of the renal tumor revealed small cell carcinoma. Multiple lung masses were diagnosed as metastatic tumors according to the results of bronchoscopic biopsy. Chemotherapy including cisplatinum and etoposide was performed without success. He died 6 months after the diagnosis. Autopsy specimen revealed primary small cell carcinoma of the right kidney. To our knowledge, this is the seventh case as primary renal small cell carcinoma in the world literature.


Assuntos
Carcinoma de Células Pequenas/patologia , Neoplasias Renais/patologia , Adulto , Neoplasias Ósseas/secundário , Carcinoma de Células Pequenas/terapia , Evolução Fatal , Humanos , Neoplasias Renais/terapia , Neoplasias Hepáticas/patologia , Neoplasias Pulmonares/secundário , Masculino , Invasividade Neoplásica , Células Neoplásicas Circulantes
19.
Pharmacogenetics ; 11(4): 341-8, 2001 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-11434512

RESUMO

Rabeprazole is a potent proton pump inhibitor and is mainly reduced to thioether rabeprazole by a non-enzymatic pathway and partially metabolized to demethylated rabeprazole by CYP2C19 in the liver. We intended to determine a cure rate for Helicobacter pylori infection by dual rabeprazole/amoxicillin therapy in relation to CYP2C19 genotype status prospectively. Ninety-seven patients with gastritis and H. pylori infection completed the dual therapy with 10 mg of rabeprazole bid and 500 mg of amoxicillin tid for 2 weeks. At 1 month after treatment, cure of H. pylori infection was assessed on the basis of histology, a rapid urease test, culture, polymerase chain reaction (PCR), and 13C-urea breath test. CYP2C19 genotype status was determined by a PCR-restriction fragment length polymorphism method. Of the 97 patients, 33 were homozygous extensive metabolizers (homEM), 48 were heterozygous extensive metabolizers (hetEM), and 16 were poor metabolizers (PM). Cure of H. pylori infection was achieved in 79 of the 97 patients (81.4%, 95%CI = 71.9-88.7). Significant differences in cure rates among the homEM, hetEM, and PM groups were observed; 60.6% (95%CI = 42.1-77.3), 91.7% (95%CI = 80.0-97.7), and 93.8% (95%CI = 69.8-99.8), respectively (P = 0.0007). Twelve patients without cure after initial treatment (10 homEMs and 2 hetEMs) were successfully retreated with rabeprazole 10 mg q.i.d. and amoxicillin 500 mg q.i.d. for 2 weeks. The cure rates for H. pylori infection by dual rabeprazole/amoxicillin therapy depended on the CYP2C19 genotype status. This dual therapy appears to be effective for hetEM and PM patients. However, high dose dual rabeprazole/amoxicillin therapy was effective even for homEM patients. Therefore, the genotyping test of CYP2C19 appears to be a clinically useful tool for the optimal dual treatment with rabeprazole plus amoxicillin.


Assuntos
Amoxicilina/administração & dosagem , Hidrocarboneto de Aril Hidroxilases , Benzimidazóis/administração & dosagem , Sistema Enzimático do Citocromo P-450/genética , Infecções por Helicobacter/tratamento farmacológico , Infecções por Helicobacter/genética , Helicobacter pylori , Oxigenases de Função Mista/genética , 2-Piridinilmetilsulfinilbenzimidazóis , Adulto , Idoso , Alelos , Benzimidazóis/metabolismo , Citocromo P-450 CYP2C19 , Quimioterapia Combinada , Feminino , Genótipo , Infecções por Helicobacter/enzimologia , Heterozigoto , Homozigoto , Humanos , Masculino , Pessoa de Meia-Idade , Omeprazol/análogos & derivados , Penicilinas/administração & dosagem , Polimorfismo de Fragmento de Restrição , Inibidores da Bomba de Prótons , Rabeprazol
20.
Otolaryngol Head Neck Surg ; 125(1): 30-3, 2001 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-11458210

RESUMO

OBJECTIVES: Our objective was to compare the results of thyroid surgery performed by residents in a large metropolitan public hospital (MPH) with those performed by faculty in a large private hospital (PH) setting. METHODS: All records of thyroid surgery performed by otolaryngologists for the period between 1986 and 1998 were reviewed. Inclusion criteria were adequacy of data and follow-up. Ninety-two thyroid procedures performed by residents in an MPH were compared with 181 thyroid operations in a PH setting performed by the faculty of these residents for differences in accuracy of diagnostic studies, operative parameters, and complication rates. RESULTS: The demographic distribution in both groups was similar. Presenting symptoms were twice as frequent in the MPH group (45% vs 22%). More total thyroidectomies were performed in the PH group (49% vs 32%). Blood loss, operative time, and hospitalization days were similar in both groups. Preoperative fine needle aspiration and intraoperative frozen section results showed sensitivities and specificities that were comparable. No permanent vocal cord paralysis was observed in either group. Permanent hypocalcemia was more frequent in the PH group (8.8%:PH vs 5.1%:MPH). CONCLUSIONS: The results of thyroid surgery performed by residents in training in an Otolaryngology-Head & Neck Surgery program in an MPH, measured by rates of complications, length of hospitalization, and duration of surgery, are similar to those of faculty at a PH setting in groups of patients with very similar characteristics.


Assuntos
Competência Clínica , Avaliação de Resultados em Cuidados de Saúde , Complicações Pós-Operatórias/epidemiologia , Doenças da Glândula Tireoide/patologia , Doenças da Glândula Tireoide/cirurgia , Tireoidectomia/métodos , Adulto , Biópsia por Agulha , Feminino , Seguimentos , Humanos , Internato e Residência , Masculino , Corpo Clínico Hospitalar , Pessoa de Meia-Idade , Otolaringologia/educação , Otolaringologia/métodos , Cuidados Pré-Operatórios , Sistema de Registros , Medição de Risco , Sensibilidade e Especificidade , Texas , Testes de Função Tireóidea , Neoplasias da Glândula Tireoide/patologia , Neoplasias da Glândula Tireoide/cirurgia , Resultado do Tratamento
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA