Complete mitochondrial genome of Acanthopsyche nigraplaga (Lepidoptera: Psychidae).

We report the mitochondrial genome (mitogenome) of a case-making moth Acanthopsyche nigraplaga Wileman, 1911 (Lepidoptera: Psychidae). The 15,704 bp long complete mitogenome comprises a typical set of genes [13 protein-coding genes (PCGs), 2 rRNA genes, and 22 tRNA genes] and one major non-coding, A + T-rich region, with an arrangement identical to that observed in most lepidopteran mitogenomes. Twelve of the 13 PCGs of the A. nigraplaga mitogenome initiate with a typical ATN start codon, however COI contains the atypical CGA start codon that is common for lepidopteran COI genes. A phylogenetic analysis using concatenated nucleotide sequences of the 13 PCGs and 2 rRNA genes using the Bayesian inference method fully resolved A. nigraplaga in a monophyletic clade within the Psychidae. Acanthopsyche nigraplaga was situated in a sister position to Eumeta variegata and Mahasena oolona with high nodal support. As more mitogenome sequences are available further scrutinized analysis for the superfamily Tineoidea including Psychidae will be possible.

First report of the forensically important fly, Stearibia nigriceps (Diptera: Piophilidae) in South Korea: Confirmation of specimens from human corpses based on cytochrome c oxidase subunit I barcodes.

Piophilidae are a relatively small family of Diptera that is frequently associated with cadavers at advanced stages of decomposition and are, therefore, considered potentially useful forensic indicators. However, their use in forensic investigations is typically hampered by a deficiency in reliable identification tools. This is particularly evident in countries such as South Korea, where forensic entomology is still in its infancy and the diversity of forensically relevant insect taxa remains largely undocumented. In the present study, we used cytochrome c oxidase subunit I (COI) barcodes to identify samples of piophilid larvae collected during medicolegal investigations performed in South Korea. A total of 174 COI sequences were obtained and have been made publicly available, thus augmenting the reference barcode library for forensically important Piophilidae species. Of the 174 sequenced samples, 172 were identified as Stearibia nigriceps (Meigen), whereas the two remaining samples may represent a previously unsequenced piophilid species. Stearibia nigriceps is recorded from South Korea for the first time, and our results suggest that it might be a particularly relevant forensic indicator in certain case types and scenarios in that country. The findings of this study highlight the utility of COI barcodes for achieving accurate identification of entomological samples, even by non-specialist forensic practitioners. They also contribute to the further development and consolidation of forensic entomology in South Korea and eastern Asia.

Single-nucleotide polymorphism markers in mitochondrial genomes for identifying Varroa destructor-resistant and -susceptible strains of Apis mellifera (Hymenoptera: Apidae).

Mitogenome sequences have a high potential for possessing single-nucleotide polymorphisms (SNPs) that can be used to identify different strains of an organism bred based on maternal lines. The European honey bee, Apis mellifera ligustica (Hymenoptera: Apidae), with a high-hygienic behaviour (HHB) against the external parasitic mite Varroa destructor has been bred for several years in Korea. To distinguish this strain from low-hygienic behaviour (LHB) strains, the complete mitogenome of the two strains were sequenced using next-generation sequencing techniques to detect SNPs. The two mitogenomes with lengths of 16,449 and 16,426 base pairs (bp) in the HHB and LHB strains, respectively, contained a typical set of genes (13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes, plus one non-coding region), exhibited similar-nucleotide compositions, and had an identical gene arrangement compared to other available A. mellifera mitogenomes. The major differences between the HHB and LHB strains included the length of the intergenic spacer sequences located at the COIII and trnG junction (88 vs. 70 bp) and ND4 and ND4L junction (45 vs. 33 bp) and the presence or absence of a duplicated sequence block (CTTTTTTAAAAAAATAAAAA) in the A + T-rich region. Comparison of the mitogenome sequences from the two strains of A. m. ligustica revealed 23 SNPs in 11 protein-coding genes which were confirmed by sequencing of 10 randomly selected individuals from each strain, indicating the usefulness of these SNP markers for identifying the HHB strain of A. m. ligustica. Therefore, mitogenome sequences are a promising genome source for detecting SNP markers, particularly those in inbred female lines.

Complete mitochondrial genome sequence of Cicindela anchoralis Chevrolat, 1845 (Coleoptera: Carabidae).

The tiger beetle, Cicindela anchoralis Chevrolat, 1845 (Coleoptera: Carabidae), has been listed as an Endangered insect in South Korea. We sequenced the complete mitochondrial genome (mitogenome) of this organism (16,388 bp). The genome includes a typical set of genes (13 protein-coding genes (PCGs), 2 rRNA genes, and 22 tRNA genes) and 1 non-coding region with an arrangement identical to that observed in most insect genomes. Twelve PCGs had the typical ATN start codon, whereas ND1 had the atypical TTG codon. The AT-rich region is 1629-bp long, composed of 80.0% A + T nucleotides, and has no long repeat sequences. Phylogenetic analyses with concatenated sequences of the 13 PCGs and 2 rRNA genes, using the Bayesian inference (BI) method, placed C. anchoralis as a sister to the within-subfamilial species Habrodera capensis, with the highest nodal support presented by both BI and maximum likelihood (ML) methods. Three subfamilies represented by more than one species (Cicindelinae, Harpalinae, and Carabinae) were all determined by both BI and ML analyses to form strong monophyletic groups.

Complete mitochondrial genome sequence of Macromia daimoji Okumura, 1949 (Odonata: Macromiidae).

The dragonfly Macromia daimoji Okumura, 1949 (Odonata: Macromiidae) has been listed as an Endangered insect in South Korea. We sequenced the complete 15,198 bp mitochondrial genome (mitogenome) of this organism, which is the first mitogenome sequence reported from the family Macromiidae. The genome includes a typical set of genes [13 protein-coding genes (PCGs), 2 rRNA genes, and 22 tRNA genes) and one non-coding region with an arrangement identical to that observed in most insect genomes. Phylogenetic analyses using concatenated sequences of the 13 PCGs and 2 rRNA genes using the Bayesian inference (BI) method placed Macromiidae, represented by M. daimoji, as a sister group to Libellulidae with the highest nodal support [Bayesian posterior probabilities (BPP) = 1]. Unlike conventional phylogenetic analysis, the suborders Anisozygoptera and Zygoptera formed a strong sister group (BPP =1), justifying the use of different molecular markers for phylogenetic analysis.

Complete mitochondrial genome of the earthworm, Amynthas jiriensis (Clitellata: Megascolecidae).

To date, a very limited number of complete clitellate mitochondrial genome (mitogenome) sequences are available. Therefore, in the present study, we elucidated the complete mitogenome sequence of Amynthas jiriensis (Clitellata: Megascolecidae), a species endemic to South Korea. Its 15 151-bp-long genome contains the 37 genes typical of metazoan mitogenomes [13 protein-coding genes (PCG), 2 rRNA genes, and 22 tRNA genes], and one major non-coding control region. All 37 genes were transcribed from the same DNA strand. The arrangement of the A. jiriensis mitogenome is identical to those of all available clitellate mitogenomes. All the 13 PCGs start with the ATG codon. Five PCGs (COI, ND6, CytB, ATP6, and ND4L) end with TAA, and COII ends with TAG, whereas the remaining PCGs end with the incomplete stop codon. The phylogenetic analysis using 13 PCGs has shown the species of Pheretimoid genera, including A. jiriensis, formed a complexity.

Complete mitochondrial genome of the Burmese giant earthworm, Tonoscolex birmanicus (Clitellata: Megascolecidae).

Until now the complete mitochondrial genome (mitogenome) sequences of only three species of clitellate have been available. We have determined the complete mitogenome sequences of the elusive Burmese giant earthworm Tonoscolex birmanicus (Clitellata: Megascolecidae), which is endemic to Myanmar. The 15,170-bp long genome contains the 37 genes typical of metazoan mitogenomes [13 protein-coding genes (PCG), 2 rRNA genes and 22 tRNA genes] and 1 major non-coding region. All of the 37 genes are transcribed from the same DNA strand. The arrangement of the T. birmanicus mitogenome is identical to that of two within-ordinal species Lumbricus terrestris and Perionyx excavates. All 13 PCGs start with the ATG. For the stop codon, only six PCGs end with the TAA, whereas the remaining ones ends with the incomplete stop codon, T. Genes overlap in a total of 14 bp in five locations, and harbor a total of 16 bp of intergenic spacer sequences in nine locations.

The mitochondrial genome of the black dwarf honey bee, Apis andreniformis (Hymenoptera: Apidae).

We sequenced 17,329 bp of the black dwarf honey bee, Apis andreniformis (Hymenoptera: Apidae) mitochondrial genome (mitogenome) that lacked ∼200 bp of the A+T-rich region for the complete genomic sequence. The gene arrangement of the A. andreniformis mitogenome was identical to that of A. cerana. However, the genome contained five additional tRNALeu(CUN); four copies were located between tRNAMet and tRNAGln, and one copy was between tRNAGln and tRNAAla, along with the typical sets of genes (13 protein-coding genes, 22 tRNAs, and 2 rRNAs) including regular tRNALeu(CUN) and the A+T-rich region (at least 923 bp). Only one copy of tRNALeu(CUN) differed by 1 bp from the other four copies of tRNALeu(CUN). Each additional tRNALeu(CUN) was followed by a nearly identical 68-bp long repeat sequence (95.6% identity). All 13 protein coding genes had typica start codons found in insect mitochondrial protein coding genes (two ATA, nine ATT and two ATG).

Complete mitochondrial genomes of five skippers (Lepidoptera: Hesperiidae) and phylogenetic reconstruction of Lepidoptera.

We sequenced mitogenomes of five skippers (family Hesperiidae, Lepidoptera) to obtain further insight into the characteristics of butterfly mitogenomes and performed phylogenetic reconstruction using all available gene sequences (PCGs, rRNAs, and tRNAs) from 85 species (20 families in eight superfamilies). The general genomic features found in the butterflies also were found in the five skippers: a high A+T composition (79.3%-80.9%), dominant usage of TAA stop codon, similar skewness pattern in both strands, consistently length intergenic spacer sequence between tRNA(Gln) and ND2 (64-87 bp), conserved ATACTAA motif between tRNA(Ser (UCN)) and ND1, and characteristic features of the A+T-rich region (the ATAGA motif, varying length of poly-T stretch, and poly-A stretch). The start codon for COI was CGA in four skippers as typical, but Lobocla bifasciatus evidently possessed canonical ATG as start codon. All species had the ancestral arrangement tRNA(Asn)/tRNA(Ser (AGN)), instead of the rearrangement tRNA(Ser (AGN))/tRNA(Asn), found in another skipper species (Erynnis). Phylogenetic analyses using all available genes (PCGs, rRNAS, and tRNAs) yielded the consensus superfamilial relationships ((((((Bombycoidea+Noctuoidea+Geometroidea)+Pyraloidea)+Papilionoidea)+Tortricoidea)+Yponomeutoidea)+Hepialoidea), confirming the validity of Macroheterocera (Bombycoidea, Noctuoidea, and Geometroidea in this study) and its sister relationship to Pyraloidea. Within Rhopalocera (butterflies and skippers) the familial relationships (Papilionidae+(Hesperiidae+(Pieridae+((Lycaenidae+Riodinidae)+Nymphalidae)))) were strongly supported in all analyses (0.98-1 by BI and 96-100 by ML methods), rendering invalid the superfamily status for Hesperioidea. On the other hand, current mitogenome-based phylogeny did not find consistent superfamilial relationships among Noctuoidea, Geometroidea, and Bombycoidea and the familial relationships within Bombycoidea between analyses, requiring further taxon sampling in future studies.

The complete mitochondrial genome of the mountainous duskywing, Erynnis montanus (Lepidoptera: Hesperiidae): a new gene arrangement in Lepidoptera.

The mountainous duskywing, Erynnis montanus, belongs to a lepidopteran family Hesperiidae. The 15,530-bp long complete mitochondrial genome (mitogenome) of the species has the typical gene content of animals (13 protein-coding genes, two rRNA genes, 22 tRNA genes and one major non-coding A+T-rich region). As typical in lepidopteran mitogenome E. montanus mitogenome also contained a high A/T content in the whole genome (81.7%) and the CGA (arginine) as the start codon for the COI gene. Unlike other lepidopteran species, including two sequenced skippers, the E. montanus mitogenome has a unique arrangement tRNA(Ser)-tRNA(Asn), instead of the tRNA(Asn)-tRNA(Ser) found unanimously in other lepidopteran species, providing a new gene arrangement in Lepidoptera. Such rearrangement probably was likely caused by duplication of gene block tRNA(Ser)-tRNA(Asn) and subsequent random loss of tRNA(Asn) in the first copy and tRNA(Ser) in the second copy, resulting in the arrangement tRNA(Ser)-tRNA(Asn).

Complete mitochondrial genome of the dwarf honeybee, Apis florea (Hymenoptera: Apidae).

In this study, the 17,694-bp long complete mitochondrial genome (mitogenome) of the dwarf honeybee, Apis florea (Hymenoptera: Apidae), was described, and a noteworthy triplicated tRNA(ser)(AGN) region and an extraordinary long A+T-rich region with repeat regions were identified. The gene arrangement of A. florea mitogenome was identical to that of Apis mellifera, but it contained three tRNA(Ser)(AGN), each of which was preceded by a 44-bp-long repeat unit and followed by a 64-bp-long repeat unit plus one complete first repeat adjacent to tRNA(Met). A total of 1610-bp long two repeat regions in 1987-bp long A+T-rich region were composed of nearly identical 141-219-bp long 5 tandem repeats and 50-52-bp long 12 tandem repeats that were encompassed by three non-repeat sequences. One potential explanation for this repeat sequence is slipped-strand mispairing and unequal crossing-over events during DNA replication.