Effect of Danhong injection on pharmacokinetics and pharmacodynamics of rivaroxaban in rats.

BACKGROUND AND OBJECTIVES: Rivaroxaban is often used in combination with DHI to treat thromboembolic disease. Whether the combination causing HDIs is still unknown. The purpose of this study was to evaluate effects of DHI on pharmacokinetics and pharmacodynamics of rivaroxaban in rats and effects on CYP3A2. METHODS: Plasma concentration of rivaroxaban with or without DHI was determined by HPLC. Pharmacokinetics parameters were calculated. Effect of DHI on pharmacodynamics of rivaroxaban was investigated by APTT, PT, TT, FIB, INR, length of tail thrombosis, vWF, t-PA, PAI-1, IL-1ß, TNF-α and histopathological sections. Effect of DHI on CYP3A2 in rats was investigated by probe drug method. RESULTS: Cmax and AUC of rivaroxaban increased significantly in combination group (P < 0.05). APTT, PT, INR and TT increased (P < 0.05), length of tail thrombosis, FIB, vWF, PAI-1, IL-1ß and TNF-α of combination group decreased significantly (P < 0.05) compared with rivaroxaban or DHI alone. Histopathologic section of tail thrombus had significant improvement. Cmax and AUC of dapsone increased (P < 0.05) in DHI group. CONCLUSION: In summary, DHI is an inhibitor of CYP3A2 and could significantly affect pharmacokinetics and pharmacodynamic of rivaroxaban, enhance anticoagulant and antithrombotic efficacy in rats. However, the combination of rivaroxaban and DHI might lead to potential HDIs. The dosage of rivaroxaban should be adjusted in clinical.

Associations of AMH in mid-reproductive years with bone mineral density and turnover markers in mid-life.

CONTEXT: Concentration of circulating anti-Müllerian hormone (AMH) predicts short-term (3-5 years) bone loss around menopause. Whether AMH during mid-reproductive years predicts bone health over a decade later is unknown. OBJECTIVE: To study the association of AMH levels in mid-reproductive years with bone density and turnover biomarkers measured after ∼14 years of follow-up. METHODS: We assessed plasma AMH in 2003-2006 (mean 37.0 years, SD 5.1) among 450 parous women (71% White) in a US longitudinal cohort, and bone mineral density (BMD; spine, hip, and femoral neck, measured by dual-energy X-ray absorptiometry) in 2017-2021 (mean 51.0 years, SD 5.1). Secondary outcomes were plasma levels of procollagen type I N-propeptide (PINP) and C-terminal telopeptide I (CTX-I). RESULTS: In linear regression models adjusted for demographics and lifestyle, compared to women with AMH >3.5 ng/mL, those with AMH <1.0 ng/mL had lower BMD (g/cm2) at follow-up (beta [95% CI]: spine: -0.06 [-0.10, -0.02]; hip: -0.05 [-0.08, -0.02]; femoral neck: -0.03 [-0.06, 0.00]) and higher bone turnover markers (beta [95% CI]: PINP: 0.36 SD [0.10, 0.63]; CTX-I: 0.34 SD [0.07, 0.60]). The association of AMH with spine BMD was more pronounced among post-menopausal women, in contrast to associations with bone turnover markers which were more pronounced among women who had not yet reached menopause. The associations between AMH and BMD were primarily mediated by menopausal status at follow-up. CONCLUSIONS: Lower AMH during mid-reproductive years is associated with lower BMD and higher bone turnover 14 years later. Ovarian reserve during mid-reproductive years may be a valuable predictor of long-term bone health.

History of infertility and anti-Müllerian hormone levels among participants in the Nurses' Health Study II.

OBJECTIVES: To better understand whether history of infertility is associated with anti-Müllerian hormone (AMH) levels later in life, outside of reproduction. METHODS: Among 1,758 premenopausal women in the Nurses' Health Study II with measured AMH, we used multivariable generalized linear models to compare log-transformed plasma AMH for women with a history of infertility compared with fertile women. We investigated AMH levels by cause of infertility and effect modification by menstrual cycle regularity. Lastly, we investigated AMH levels by history of primary and secondary infertility and age at reported infertility. RESULTS: Mean age at blood collection was 40 years. We observed no association between overall history of infertility and AMH levels (% difference AMH: -8.1% [CI, -19.4 to 4.8]). The association between overall infertility and AMH was strongest among women who first reported infertility at >30 years (-17.7% [CI, -32.1 to -0.3]). CONCLUSIONS: Overall, we observed no association between the history of infertility and AMH levels later in life. However, specific subgroups of women with a history of infertility may have lower AMH levels throughout life compared with fertile women. This association was observed among subgroups, such as those who first experienced infertility at >30 years. These findings have implications for mechanisms through which infertility may be associated with premature menopause and chronic disease risk.

Expression and characterization of recombinant antibodies against H7 subtype avian influenza virus and their diagnostic potential.

Introduction: Monoclonal antibodies (mAbs) play a pivotal role in disease diagnosis as well as immunotherapy interventions. Traditional monoclonal antibody generation relies on animal immunization procedures predominantly involving mice; however, recent advances in in-vitro expression methodologies have enabled large-scale production suitable for both industrial applications as well as scientific investigations. Methods: In this study, two mAbs against H7 subtype avian influenza viruses (AIV) were sequenced and analyzed, and the DNA sequences encoding heavy chain (HC) and light chain (LC) were obtained and cloned into pCHO-1.0 expression vector. Then, the HC and LC expression plasmids were transfected into CHO-S cells to establish stable cell lines expressing these mAbs using a two-phase selection scheme with different concentrations of methotrexate and puromycin. Recombinant antibodies were purified from the cell culture medium, and their potential applications were evaluated using hemagglutination inhibition (HI), western blotting (WB), confocal microscopy, and enzyme-linked immunosorbent assay (ELISA). Results: The results indicated that the obtained recombinant antibodies exhibited biological activity similar to that of the parent antibodies derived from ascites and could be used as a replacement for animal-derived mAbs. A kinetic analysis of the two antibodies to the AIV HA protein, conducted using surface plasmon resonance (SPR), showed concordance between the recombinant and parental antibodies. Discussion: The data presented in this study suggest that the described antibody production protocol could avoid the use of experimental animals and better conform to animal welfare regulations, and provides a basis for further research and development of mAbs-based diagnostic products.

Lifetime history of gestational diabetes and cognitive function in parous women in midlife.

AIMS/HYPOTHESIS: We aimed to determine whether a history of gestational diabetes mellitus (GDM) is associated with cognitive function in midlife. METHODS: We conducted a secondary data analysis of the prospective Nurses' Health Study II. From 1989 to 2001, and then in 2009, participants reported their history of GDM. A subset participated in a cognition sub-study in 2014-2019 (wave 1) or 2018-2022 (wave 2). We included 15,906 parous participants (≥1 birth at ≥18 years) who completed a cognitive assessment and were free of CVD, cancer and diabetes before their first birth. The primary exposure was a history of GDM. Additionally, we studied exposure to GDM and subsequent type 2 diabetes mellitus (neither GDM nor type 2 diabetes, GDM only, type 2 diabetes only or GDM followed by type 2 diabetes) and conducted mediation analysis by type 2 diabetes. The outcomes were composite z scores measuring psychomotor speed/attention, learning/working memory and global cognition obtained with the Cogstate brief battery. Mean differences (ß and 95% CI) in cognitive function by GDM were estimated using linear regression. RESULTS: The 15,906 participants were a mean of 62.0 years (SD 4.9) at cognitive assessment, and 4.7% (n=749) had a history of GDM. In models adjusted for age at cognitive assessment, race and ethnicity, education, wave of enrolment in the cognition sub-study, socioeconomic status and pre-pregnancy characteristics, women with a history of GDM had lower performance in psychomotor speed/attention (ß -0.08; 95% CI -0.14, -0.01) and global cognition (ß -0.06; 95% CI -0.11, -0.01) than those without a history of GDM. The lower cognitive performance in women with GDM was only partially explained by the development of type 2 diabetes. CONCLUSIONS/INTERPRETATION: Women with a history of GDM had poorer cognition than those without GDM. If replicated, our findings support future research on early risk modification strategies for women with a history of GDM as a potential avenue to decrease their risk of cognitive impairment.

TUDCA inhibits EV71 replication by regulating ER stress signaling pathway and suppressing autophagy.

Tauroursodeoxycholic acid (TUDCA) is a naturally occurring hydrophilic bile acid that alleviates endoplasmic reticulum (ER) stress and inhibits apoptosis, thereby protecting cells. Previous studies have shown that enterovirus 71 (EV71) infection modulates ER stress and induces autophagy to assist viral replication. This study observed the effects of TUDCA pretreatment on HeLa and Vero cells infected with EV71, finding that TUDCA inhibits EV71 replication in TUDCA pretreated HeLa and Vero cells in a dose-dependent manner. We found that TUDCA pretreatment inhibited EV71 replication by regulating three branches of UPR, that is up-regulated ATF6, down-regulated both PERK and IRE1. The results also indicated that autophagy which is downstream of UPR, was inhibited either. The results indicate that TUDCA inhibits EV71 replication by regulating UPR sensor proteins and autophagy following ER stress.

Gut microbiota: a potential influencer of insomnia occurring after COVID-19 infection.

The prevalence of insomnia has increased in recent years, significantly affecting the lives of many individuals. Coronavirus disease 2019 (COVID-19) infection has been found to have a substantial impact on the human gut microbiota (GM). Clinical studies have shown that the high prevalence, prolonged duration, and refractory treatment of insomnia symptoms following the COVID-19 pandemic may be related to the effect of COVID-19 infection on the GM. Therefore, the GM may be a potential target for the treatment of insomnia following COVID-19 infection. However, relevant studies have not been well-documented, and the GM has not been sufficiently analyzed in the context of insomnia treatment. Herein, we review the interaction between sleep and the GM, summarize the characteristics of COVID-19-induced abnormal changes in the GM and metabolites in patients with insomnia, and discuss potential mechanisms, including metabolic, immune, and neural pathways, by which these abnormal changes in the GM cause insomnia as well as the factors affecting the GM. Finally, we discuss the prospect of modulating the host GM community for the effective treatment of insomnia after COVID-19 infection and the need for further clinical studies.

A study on the accumulation model of the Santos basin in Brazil utilizing the source-reservoir dynamic evaluation method.

The exploration potential within deep-water petroliferous basins holds great promise for oil and gas resources. However, the dearth of geochemical and isotopic data poses a formidable challenge in comprehending the intricate hydrocarbon charging processes, thereby impeding the comprehensive understanding of hydrocarbon accumulation mechanisms and models. Consequently, the establishment of robust source-reservoir relationships in deep-water petroliferous basins represents a pivotal challenge that significantly influences the exploration strategies and the comprehension of hydrocarbon enrichment dynamics within such basins. In this study, we introduce a novel approach, termed the "source-reservoir dynamic evaluation method," tailored to investigate reservoir accumulation models in deep-water petroliferous basins. This method uses basin simulation technology to recover the thermal evolution history and hydrocarbon generation and expulsion history of source rocks, and on this basis delimits the hydrocarbon kitchen range. At the same time, the maturity of source rocks corresponding to crude oil and natural gas in typical reservoirs is calculated. Then, when the thermal evolution degree of source rocks adjacent to the reservoir reaches this maturity, the corresponding geological period is the main charging period of hydrocarbon. As a typical deep-water petroliferous basin, the Santos Basin in Brazil has abundant oil and gas reservoirs under the thick salt rock, but there are still some fundamental problems such as unclear oil-gas accumulation process and model. Therefore, in this paper, the main charging periods of typical hydrocarbon reservoirs are determined based on the internal relationship between the thermal evolution history of the main source rocks and the maturity of crude oil and natural gas, and then the hydrocarbon accumulation process is analyzed and the dynamic accumulation model is established. Finally, the favorable prospecting direction is pointed out. The results show that the oil and gas in the Barra Velha Formation in the Santos basin are mainly derived from the Itapema Formation lacustrine shale source rock, and the source rock is mainly developed in the Eastern Sag of the Central Depression, and its main hydrocarbon generation period is from the deposition period of Florianopolis Formation to the deposition period of Santos Formation. The main hydrocarbon expulsion period was from the deposition period of the Santos Formation to the Early deposition of the Iguape Formation. The oil and gas in the Barra Velha Formation were mainly charged from the Late deposition period of the Santos Formation to the Early deposition period of the Iguape Formation. During this period, the hydrocarbon migrated vertically along the normal fault formed in the rift period to the trap of the adjacent inheritance structural highs and accumulated in the reservoir, which was dominated by the accumulation model of the "lower generation-upper reservoir-salt cap". Since the Barra Velha Formation has the characteristics of near-source accumulation, based on the hydrocarbon expulsion center and hydrocarbon expulsion intensity of the source rock of the Itapema Formation, the distribution ranges of 85% and 50% Pre-salt accumulation probability in the Santos basin were calculated by using the quantitative analysis model of the hydrocarbon distribution threshold. It is suggested that the next oil and gas exploration should be carried out in the paleo-structural highs and slope of Class I favorable area (the hydrocarbon accumulation probability is more than 85%) and Class II favorable area (the hydrocarbon accumulation probability is 85-50%).

Association between childhood abuse and risk of post-COVID-19 conditions: Results from three large prospective cohort studies.

BACKGROUND: Significant early life adversities, such as childhood sexual and physical/emotional abuse, are associated with risk of poor health outcomes but are understudied risk factors for post-COVID-19 conditions. In this prospective study, we examined the associations between combined exposure to sexual and physical/emotional abuse during childhood with risk of post-COVID-19 conditions in adulthood. Additionally, we explored the extent to which lifestyle, health-related and psychological factors explain this association. METHODS: We used data from three large, ongoing cohorts: Nurses' Health Study (NHS)-II, NHS3, and the Growing Up Today Study. Between April 2020 and November 2021, participants responded to periodic COVID-19 surveys. Participants were included if they responded to a questionnaire about childhood abuse, subsequently tested positive for SARS-CoV-2 infection and responded to questions about post-COVID-19 conditions. Childhood sexual abuse was measured before the COVID-19 pandemic with the Sexual Maltreatment Scale of the Parent-Child Conflict Tactics Scale, and physical/emotional abuse was measured with the Physical and Emotional Abuse Subscale of the Childhood Trauma Questionnaire. Post-COVID-19 conditions, defined as COVID-19-related symptoms lasting 4 weeks or longer (e.g., fatigue, dyspnea), were self-reported in the final COVID-19 questionnaire in November 2021. Sexual abuse and physical/emotional abuse were examined separately and jointly in relation to post-COVID-19 conditions. Data on key lifestyle (e.g., cigarette smoking), health-related (e.g., asthma, diabetes), and psychological factors (e.g., depression and anxiety) were obtained. RESULTS: Of 2851 participants, the mean age (range) was 55.8 (22.0-75.0) years; 2789 (97.8 %) were females, and 2750 (96.5 %) were whites. We observed a dose-dependent relationship between severity of childhood abuse and post-COVID conditions (p-trend:<0.0001); participants with severe versus no childhood abuse had a 42 % higher subsequent risk of post-COVID conditions [relative risk (95 % confidence interval): 1.42 (1.25 to 1.61)]. Key lifestyle, health-related, and psychological factors mediated 25.5 % of this association. Both sexual and physical/emotional abuse, were independently associated with post-COVID conditions. CONCLUSIONS: In this prospective study of 2851 participants, childhood abuse was significantly associated with increased risk of post-COVID conditions. Biological pathways connecting childhood abuse with subsequent risk of post-COVID conditions should be investigated.

3D Printing Properties of Heat-Induced Sodium Alginate-Whey Protein Isolate Edible Gel.

The objective of this study was to develop a food 3D printing gel and investigate the effects of whey protein isolate (WPI), sodium alginate (SA), and water-bath heating time on the 3D printing performance of the gel. Initially, the influence of these three factors on the rheological properties of the gel was examined to determine the suitable formulation ranges for 3D printing. Subsequently, the formulation was optimized using response surface methodology, and texture analysis, scanning electron microscopy (SEM), and Fourier-transform infrared (FTIR) spectroscopy were conducted. The rheological results indicated that gels with WPI concentrations of 6-7 g, SA concentrations of 0.8-1.2 g, and water-bath heating times of 10-12 min exhibited lower yield stress and better self-supporting properties. The optimized formulation, determined through response surface methodology, consisted of 1.2 g SA, 6.5 g WPI, and a heating time of 12 min. This optimized formulation demonstrated enhanced extrusion capability and superior printing performance. SEM analysis revealed that the optimized gel possessed good mechanical strength, and FTIR spectroscopy confirmed the successful composite formation of the gel. Overall, the results indicate that the optimized gel formulation can be successfully printed and exhibits excellent 3D printing performance.

A non-canonical role for a small nucleolar RNA in ribosome biogenesis and senescence.

Cellular senescence is an irreversible state of cell-cycle arrest induced by various stresses, including aberrant oncogene activation, telomere shortening, and DNA damage. Through a genome-wide screen, we discovered a conserved small nucleolar RNA (snoRNA), SNORA13, that is required for multiple forms of senescence in human cells and mice. Although SNORA13 guides the pseudouridylation of a conserved nucleotide in the ribosomal decoding center, loss of this snoRNA minimally impacts translation. Instead, we found that SNORA13 negatively regulates ribosome biogenesis. Senescence-inducing stress perturbs ribosome biogenesis, resulting in the accumulation of free ribosomal proteins (RPs) that trigger p53 activation. SNORA13 interacts directly with RPL23, decreasing its incorporation into maturing 60S subunits and, consequently, increasing the pool of free RPs, thereby promoting p53-mediated senescence. Thus, SNORA13 regulates ribosome biogenesis and the p53 pathway through a non-canonical mechanism distinct from its role in guiding RNA modification. These findings expand our understanding of snoRNA functions and their roles in cellular signaling.

Association between COVID-19 vaccination and menstruation: a state of the science review.

INTRODUCTION: Menstrual health is a key patient-reported outcome beyond its importance as a general indicator of health and fertility. However, menstrual function was not measured in the clinical trials of COVID-19 vaccines. The purpose of this review was to synthesise the existing literature on the relationship between COVID-19 vaccination and menstrual health outcomes. METHODS: A PubMed search to 31 October 2023 identified a total of 53 publications: 11 prospective cohort studies, 11 retrospective cohort studies or registry-based cohort studies, and 31 cross-sectional or retrospective case-control studies. RESULTS: Identified studies were generally at moderate-to-high risk of bias due to retrospective design, interviewer bias, and failure to include a non-vaccinated control group. Nonetheless, the bulk of the literature demonstrates that COVID-19 vaccine is associated with temporary changes in menstrual characteristics (cycle length and flow) and menstrual pain. Follicular phase (at the time of vaccination) is associated with greater increases in cycle length. Evidence suggests temporary post-vaccine menstrual changes in adolescents, abnormal vaginal bleeding in postmenopausal individuals, and a potential protective effect of using hormonal contraception. CONCLUSIONS: In this review we found evidence supporting an association between the COVID-19 vaccine and menstrual health outcomes. Given the importance of menstrual function to overall health, we recommend that all future vaccine trials include menstruation as a study outcome. Future vaccine studies should include rigorous assessment of the menstrual cycle as an outcome variable to limit sources of bias, identify biological mechanisms, and elucidate the impact of stress.

Lifetime History of Low Birth Weight Delivery and Cognitive Function in Middle-Aged Parous Women.

BACKGROUND AND OBJECTIVES: Pregnancy outcomes such as low birth weight (LBW) delivery may reflect vascular or metabolic dysfunction in mothers and presage future cognitive impairment and dementia. However, the evidence is currently limited. Our objective was to examine the extent to which a lifetime history of LBW delivery was associated with cognitive function in parous middle-aged women. METHODS: We studied participants from the Nurses' Health Study II, an ongoing longitudinal cohort of female nurses enrolled in 1989. In 2009, participants completed a reproductive history questionnaire. Participants who completed at least one of 2 post-traumatic stress disorder questionnaires were invited to participate in a cognition substudy with 2 waves of baseline data collection (2014 or 2018). We restricted the analysis to participants with one valid cognitive assessment who reported ≥1 birth at 18 years and older. We defined LBW delivery history as having delivered offspring with a birth weight <2,500 g (<5.5 lbs) in any pregnancy. The outcome was a single assessment of cognitive function evaluated with the self-administered Cogstate Brief Battery. The battery comprises 4 tasks, which we used to create 2 composite z-scores measuring psychomotor speed/attention and learning/working memory (higher z-scores = better cognitive function). We used multivariable linear regression models. RESULTS: The analysis included 15,323 participants with a mean age of 62 (standard deviation: 4.9 years) at cognitive assessment. Among them, 1,224 (8%) had a history of LBW delivery. After adjusting for age at cognitive assessment, race, and ethnicity, participants' education, wave of baseline cognitive assessment, socioeconomic status, and prepregnancy characteristics, women with a history of LBW delivery had lower z-scores in the psychomotor speed/attention (ß, -0.06; 95% CI -0.12 to -0.01) and learning/working memory (ß, -0.05; 95% CI -0.09 to -0.01) composites than parous women without a history of LBW delivery. We observed a gradient of lower z-scores with an increasing number of LBW deliveries. DISCUSSION: History of LBW delivery may be marker of future poorer cognition. If confirmed, our findings support future investigations into the value of early preventive efforts targeting women with a history of LBW delivery to reduce the burden of cognitive impairment in women.

On-Site and Visual Detection of the H5 Subtype Avian Influenza Virus Based on RT-RPA and CRISPR/Cas12a.

Avian influenza viruses (AIVs) of the H5 subtype rank among the most serious pathogens, leading to significant economic losses in the global poultry industry and posing risks to human health. Therefore, rapid and accurate virus detection is crucial for the prevention and control of H5 AIVs. In this study, we established a novel detection method for H5 viruses by utilizing the precision of CRISPR/Cas12a and the efficiency of RT-RPA technologies. This assay facilitates the direct visualization of detection results through blue light and lateral flow strips, accurately identifying H5 viruses with high specificity and without cross-reactivity against other AIV subtypes, NDV, IBV, and IBDV. With detection thresholds of 1.9 copies/µL (blue light) and 1.9 × 103 copies/µL (lateral flow strips), our method not only competes with but also slightly surpasses RT-qPCR, demonstrating an 80.70% positive detection rate across 81 clinical samples. The RT-RPA/CRISPR-based detection method is characterized by high sensitivity, specificity, and independence from specialized equipment. The immediate field applicability of the RT-RPA/CRISPR approach underscores its importance as an effective tool for the early detection and management of outbreaks caused by the H5 subtype of AIVs.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Streamlining social media information retrieval for public health research with deep learning.

OBJECTIVE: Social media-based public health research is crucial for epidemic surveillance, but most studies identify relevant corpora with keyword-matching. This study develops a system to streamline the process of curating colloquial medical dictionaries. We demonstrate the pipeline by curating a Unified Medical Language System (UMLS)-colloquial symptom dictionary from COVID-19-related tweets as proof of concept. METHODS: COVID-19-related tweets from February 1, 2020, to April 30, 2022 were used. The pipeline includes three modules: a named entity recognition module to detect symptoms in tweets; an entity normalization module to aggregate detected entities; and a mapping module that iteratively maps entities to Unified Medical Language System concepts. A random 500 entity samples were drawn from the final dictionary for accuracy validation. Additionally, we conducted a symptom frequency distribution analysis to compare our dictionary to a pre-defined lexicon from previous research. RESULTS: We identified 498 480 unique symptom entity expressions from the tweets. Pre-processing reduces the number to 18 226. The final dictionary contains 38 175 unique expressions of symptoms that can be mapped to 966 UMLS concepts (accuracy = 95%). Symptom distribution analysis found that our dictionary detects more symptoms and is effective at identifying psychiatric disorders like anxiety and depression, often missed by pre-defined lexicons. CONCLUSIONS: This study advances public health research by implementing a novel, systematic pipeline for curating symptom lexicons from social media data. The final lexicon's high accuracy, validated by medical professionals, underscores the potential of this methodology to reliably interpret, and categorize vast amounts of unstructured social media data into actionable medical insights across diverse linguistic and regional landscapes.

BMI status and weight trajectories across females' reproductive years and risk of adverse pregnancy outcomes: a prospective cohort study.

BACKGROUND: Prepregnancy body mass index (BMI) is a well-established risk factor of adverse pregnancy outcomes (APOs). The associations of long-term and short-term weight trajectories with APOs are less clear. OBJECTIVES: This study aimed to determine the associations of weight trajectories during females' reproductive years, before and between pregnancies, with risk of APOs. METHODS: We followed 16,241 females (25,386 singleton pregnancies) participating in a prospective cohort, the Nurses' Health Study II. Weight at age 18 y, current weight, and height were assessed at baseline (1989), and weight was updated biennially. Pregnancy history was self-reported in 2009. The primary outcome was a composite of hypertensive disorders of pregnancy (HDP), gestational diabetes (GDM), preterm birth, and stillbirth. Secondary outcomes were individual APOs. The associations of weight change with APOs were estimated using log-binomial regression, adjusting for demographic, lifestyle, reproductive factors, and baseline BMI (in kg/m2). RESULTS: The mean (standard deviation [SD]) age at first in-study pregnancy was 33.7 (4.1) y. The mean (SD) time from age 18 y to pregnancy, baseline to pregnancy, and between pregnancies was 16.3 (4.0), 6.1 (3.0), and 2.9 (1.6) y, with a corresponding weight change of 6.4 (9.1), 3.1 (5.8), and 2.3 (4.8) kg, respectively. Of the pregnancies, 4628 (18.2%) were complicated by ≥1 APOs. Absolute weight change since age 18 y was most strongly associated with APOs. Compared with females whose weight remained stable (0-2 kg) since age 18, females who gained >2 kg had higher risk of APO (2.1-9.9 kg, relative risk [RR]: 1.12; 95% confidence interval [CI]: 1.02, 1.23; 10.0-14.9 kg, RR: 1.43; 95% CI: 1.29, 1.60; ≥15 kg, RR: 1.87; 95% CI: 1.69, 2.08), primarily driven by HDP and GDM. The associations of per 1 kg weight gain before and between pregnancies with HDP were nearly identical. CONCLUSIONS: Weight trajectories prior to and between pregnancies were associated with the risk of APOs, particularly HDP. Longer periods of weight gain, corresponding to greater absolute weight gain, were most strongly associated with higher risk of APOs.

Neutrophils in glioma microenvironment: from immune function to immunotherapy.

Glioma is a malignant tumor of the central nervous system (CNS). Currently, effective treatment options for gliomas are still lacking. Neutrophils, as an important member of the tumor microenvironment (TME), are widely distributed in circulation. Recently, the discovery of cranial-meningeal channels and intracranial lymphatic vessels has provided new insights into the origins of neutrophils in the CNS. Neutrophils in the brain may originate more from the skull and adjacent vertebral bone marrow. They cross the blood-brain barrier (BBB) under the action of chemokines and enter the brain parenchyma, subsequently migrating to the glioma TME and undergoing phenotypic changes upon contact with tumor cells. Under glycolytic metabolism model, neutrophils show complex and dual functions in different stages of cancer progression, including participation in the malignant progression, immune suppression, and anti-tumor effects of gliomas. Additionally, neutrophils in the TME interact with other immune cells, playing a crucial role in cancer immunotherapy. Targeting neutrophils may be a novel generation of immunotherapy and improve the efficacy of cancer treatments. This article reviews the molecular mechanisms of neutrophils infiltrating the central nervous system from the external environment, detailing the origin, functions, classifications, and targeted therapies of neutrophils in the context of glioma.

Investigation of Additive-Manufactured Carbon Fiber-Reinforced Polyethylene Terephthalate Honeycomb for Application as Non-Pneumatic Tire Support Structure.

A non-pneumatic tire (NPT) overcomes the shortcomings of a traditional pneumatic tire such as wear, punctures and blowouts. In this respect, it shows great potential in improving driving safety, and has received great attention in recent years. In this paper, a carbon fiber-reinforced polyethylene terephthalate (PET/CF) honeycomb is proposed as a support structure for NPTs, which can be easily prepared using 3D printing technology. The experimental results showed that the PET/CF has high strength and modulus and provides excellent mechanical properties. Then, a finite element (FE) model was established to predict the compression performance of auxetic honeycombs. Good agreement was achieved between the experimental data and FE analysis. The influence of the cell parameters on the compressive performance of the support structure were further analyzed. Both the wall thickness and the vertically inclined angle could modulate the mechanical performance of the NPT. Finally, the application of vertical force is used to analyze the static load of the structure. The PET/CF honeycomb as the support structure of the NPT showed outstanding bearing capacity and stiffness in contrast with elastomer counterparts. Consequently, this study broadens the material selection for NPTs and proposes a strategy for manufacturing a prototype, which provides a reference for the design and development of non-pneumatic tires.