Quantitative analysis of chest MRI images for benign malignant diagnosis of pulmonary solid nodules.

Background: In this study, we developed and validated machine learning (ML) models by combining radiomic features extracted from magnetic resonance imaging (MRI) with clinicopathological factors to assess pulmonary nodule classification for benign malignant diagnosis. Methods: A total of 333 consecutive patients with pulmonary nodules (233 in the training cohort and 100 in the validation cohort) were enrolled. A total of 2,824 radiomic features were extracted from the MRI images (CE T1w and T2w). Logistic regression (LR), Naïve Bayes (NB), support vector machine (SVM), random forest (RF), and extreme gradient boosting (XGBoost) classifiers were used to build the predictive models, and a radiomics score (Rad-score) was obtained for each patient after applying the best prediction model. Clinical factors and Rad-scores were used jointly to build a nomogram model based on multivariate logistic regression analysis, and the diagnostic performance of the five prediction models was evaluated using the area under the receiver operating characteristic curve (AUC). Results: A total of 161 women (48.35%) and 172 men (51.65%) with pulmonary nodules were enrolled. Six important features were selected from the 2,145 radiomic features extracted from CE T1w and T2w images. The XGBoost classifier model achieved the highest discrimination performance with AUCs of 0.901, 0.906, and 0.851 in the training, validation, and test cohorts, respectively. The nomogram model improved the performance with AUC values of 0.918, 0.912, and 0.877 in the training, validation, and test cohorts, respectively. Conclusion: MRI radiomic ML models demonstrated good nodule classification performance with XGBoost, which was superior to that of the other four models. The nomogram model achieved higher performance with the addition of clinical information.

Oral delivery of bi-autoantigens by bacterium-like particles (BLPs) against autoimmune diabetes in NOD mice.

Induction of oral tolerance by vaccination with type 1 diabetes mellitus (T1DM)-associated autoantigens exhibits great potential in preventing and treating this autoimmune disease. However, antigen degradation in the gastrointestinal tract (GIT) limits the delivery efficiency of oral antigens. Previously, bacterium-like particles (BLPs) have been used to deliver a single-chain insulin (SCI-59) analog (BLPs-SCI-59) or the intracellular domain of insulinoma-associated protein 2 (IA-2ic) (BLPs-IA-2ic). Both monovalent BLPs vaccines can suppress T1DM in NOD mice by stimulating the corresponding antigen-specific oral tolerance, respectively. Here, we constructed two bivalent BLPs vaccines which simultaneously deliver SCI-59 and IA-2ic (Bivalent vaccine-mix or Bivalent vaccine-SA), and evaluated whether there is an additive beneficial effect on tolerance induction and suppression of T1DM by treatment with BLPs-delivered bi-autoantigens. Compared to the monovalent BLPs vaccines, oral administration of the Bivalent vaccine-mix could significantly reduce morbidity and mortality in T1DM. Treatment with the bivalent BLPs vaccines (especially Bivalent vaccine-mix) endowed the mice with a stronger ability to regulate blood glucose and protect the integrity and function of pancreatic islets than the monovalent BLPs vaccines treatment. This additive effect of BLPs-delivered bi-autoantigens on T1DM prevention may be related to that SCI-59- and IA-2-specific Th2-like immune responses could be induced, which was more beneficial for the correction of Th1/Th2 imbalance. In addition, more CD4+CD25+Foxp3+ regulatory T cells (Tregs) were induced by treatment with the bivalent BLPs vaccines than did the monovalent BLPs vaccines. Therefore, multiple autoantigens delivered by BLPs maybe a promising strategy to prevent T1DM by efficiently inducing antigen-specific immune tolerance.

Notch is an alternative splicing gene in brown planthopper, Nilaparvata lugens.

Much research has assumed that Notch codes one protein. Then the protein will be cleaved into two parts and regenerates a heterodimers receptor to construct Notch signal pathways to regulate development in the past three decades. Here, we show that Notch in brown planthopper is a complex alternatively spliced gene has at least three transcriptional start sites, four exon skips, and 21 transcriptional endpoints that uses these to form variants and codes a series of proteins. When used dsRNAs to suppression different regions of the full-length variant NlNF resulted in a similar phenotype. Insects were molting after treatment, sensation circles on antennas near to root decayed, bristles on wings shortened, thickened or disappeared, accompanied by thickening veins and blades of fore-wing apex regions thickened. These results suggested that Notch influenced developmental of sensation circles, bristles, veins, and blades in nymph late periods. This study has deepened our understanding of Notch.

Oral delivery of the intracellular domain of the insulinoma-associated protein 2 (IA-2ic) by bacterium-like particles (BLPs) prevents type 1 diabetes mellitus in NOD mice.

Antigen-specific immune tolerance, which possesses great potential in preventing or curing type 1 diabetes mellitus (T1DM), can be induced by oral vaccination with T1DM-related autoantigens. However, direct administration of autoantigens via oral route exhibits a low tolerance-inducing effect as a result of the digestion of protein antigens in the gastrointestinal tract (GIT) and therefore, a large dosage of autoantigens may be needed. In this study, bacterium-like particles (BLPs) made from food-grade lactic acid bacteria were used to deliver the intracellular domain of the insulinoma-associated protein 2 (IA-2ic). For this purpose, BLPs-IA-2ic vaccine in which IA-2ic bound to the surface of BLPs was constructed. BLPs enhanced the stability of the delivered IA-2ic based on the stability analysis in vitro. Oral administration of BLPs-IA-2ic significantly reduced T1DM incidence in NOD mice. The mice fed BLPs-IA-2ic exhibited a significant reduction in insulitis and preserved the ability to secrete insulin. Immunologic analysis showed that oral vaccination with BLPs-IA-2ic induced antigen-specific T cell tolerance. The results revealed that the successful induction of immune tolerance was dependent on the immune deviation (in favor of T helper 2 responses) and CD4+CD25+FoxP3+ regulatory T cells. Hence, oral vaccination with BLPs-IA-2ic shows potential for application in preventing T1DM.

MiR-126-5p Promotes Tumor Cell Proliferation, Metastasis and Invasion by Targeting TDO2 in Hepatocellular Carcinoma.

TDO2 is a key enzyme in the kynurenine metabolic pathway, which is the most important pathway of tryptophan metabolism. It has been shown that miRNAs are involved in cell metastasis through interaction with target mRNAs. In this study, we found 645 miRNAs that could be immunoprecipitated with TDO2 through the RNA-immunoprecipitation experiment. miR-126-5p was selected as the research target, which was also confirmed by dual-luciferase reporter assay. Through qRT-PCR analysis, it was verified that the overexpression of miR-126-5p promoted the expression of TDO2, PI3K/AKT and WNT1. Meanwhile, it was verified that overexpression of miR-126-5p can promote intracellular tryptophan metabolism by HPLC. We also verified the effects of miR-126-5p on cell proliferation, migration, and invasion by cck-8, cell colony formation and trans-well assay in both HCCLM3 cells and HepG2 cells. In vivo experiments were also conducted to verify that miR-126-5p promoted tumor formation and growth via immunohistochemical detection of cell infiltration and proliferation to generate markers Ki-67, BAX, and VEGF. In conclusion, our results suggest that miR-126-5p is a biomarker and a potential new treatment target in the progression of HCC via promoting the expression of TDO2.

Changes in the hepatic differentiation potential of human mesenchymal stem cells aged in vitro.

BACKGROUND: Due to their multipotency and ability for self-renewal, human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) hold great promise for generating hepatocytes. Previous research has successfully generated hepatocytes from early-passage [i.e., passage (P)3] hUC-MSCs; however, the populations of early-passage cells are limited, and these cells cannot produce sufficient functional hepatocytes for large-scale application in clinical therapy. Thus, a thorough investigation of the hepatic differentiation potential of in vitro-aged hUC-MSCs is needed. METHODS: hUC-MSCs were passaged in vitro and subcultured every 3 days up to P8, and their morphology, proliferative capacity, liver-specific marker expression, and liver function at the end of each passage were analyzed. The efficiency of the hepatogenic differentiation of hUC-MSCs driven by a functional hit 1 (FH1)-based strategy at different passages was also evaluated. RESULTS: The in vitro-aged hUC-MSCs gradually displayed morphological inhomogeneity, had reduced proliferative capability, and exhibited senescent properties while maintaining adipogenic and osteogenic differentiation potential. Additionally, senescence also decreased the expression of messenger RNA (mRNA) levels in albumin (ALB) and alpha 1-antitrpsin (A1AT) in these cells and their relative protein expression, which is the marker of a mature hepatocyte. The liver function of the in vitro-aged hUC-MSCs also deteriorated gradually. Finally, the percentage of hepatocyte-like cells (HLCs) generated from in vitro-aged hUC-MSCs reduced significantly, and the mature hepatocyte functions, such as ALB secretion, glycogen synthesis, low-density lipoprotein (LDL) intake, and indocyanine green (ICG) uptake, also changed. CONCLUSIONS: hUC-MSCs possess mature hepatocytes' specific markers and functions, which change gradually as they undergo cell senescence. Due to the loss of these properties within in vitro subcultures, the hepatic differentiation efficiency of in vitro-aged hUC-MSCs decreased dramatically in the late passage (P8). The current study provides valuable information can inform future research on liver disease.

Solitary Nitric Oxide Signaling Mediates Mild Stress-Induced Anxiety and Norepinephrine Release in the Bed Nucleus of the Stria Terminalis during Protracted Ethanol Withdrawal.

Ethanol withdrawal (EtOHW) alters the pattern of neurohormonal and behavioral response toward internal and external stimuli, which mediates relapse to alcohol use even after a long period of abstinence. Increased noradrenergic signaling from the nucleus tractus solitarius (NTS) to the bed nucleus of the stria terminalis (BNST) during EtOHW underlies withdrawal-induced anxiety, while nitric oxide synthase (NOS) inhibitors injected into the periaqueductal area attenuate EtOHW-induced anxiety. Therefore, this study investigated the involvement of NOS within the NTS in anxiety and increased norepinephrine (NE) release in the BNST during protracted EtOHW in rats exposed to a mild stress. Rats were intraperitoneally administered 3 g/kg/day EtOH for 21 days followed by 28 days of withdrawal, and on the 28th day of withdrawal, the rats were subjected to restraint stress for 7 minutes. The elevated plus maze test was employed to evaluate anxiety-like behavior in rats, and in vivo microdialysis was used to measure the extracellular NE level in the BNST. In elevated plus maze tests, EtOHW rats but not EtOH-naive rats exhibited anxiety-like behavior when challenged with 7-minute mild restraint stress, which was, respectively, mitigated by prior intra-NTS infusion of the nitric oxide scavenger 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (carboxy-PTIO), nonselective NOS inhibitor NG-nitro-L-arginine methyl ester (L-NAME), or selective neuronal NOS (nNOS) inhibitor 7-nitroindazole (7-NI). Each of these agents also decreased the plasma corticosterone levels in EtOHW rats. In in vivo microdialysis, prior intra-NTS infusion of carboxy-PTIO, L-NAME, or 7-NI attenuated the mild stress-induced NE release in the BNST of EtOHW rats. Additionally, EtOHW rats showed increased solitary nNOS gene and protein expression. Moreover, the anxiolytic effect of intra-NTS administration of 7-NI was abolished by subsequent intra-NTS administration of sodium nitroprusside. These results suggest that elevation of solitary nitric oxide signaling derived from nNOS mediates stress-precipitated anxiety and norepinephrine release in the BNST during protracted EtOHW.

Tryptophan Side-Chain Oxidase Enzyme Suppresses Hepatocellular Carcinoma Growth through Degradation of Tryptophan.

Tryptophan metabolism plays a role in the occurrence and development of hepatocellular carcinoma cells. By degrading certain amino acids, tumor growth can be limited while maintaining the body's normal nutritional requirements. Tryptophan side-chain oxidase (TSO) enzyme can degrade tryptophan, and its inhibitory effect on hepatocellular carcinoma cells is worthy of further study. To investigate the degradation effect on tryptophan, TSO was isolated and purified from qq Pseudomonas. The reaction products were identified with high performance liquid chromatography (HPLC) and high-performance liquid chromatography tandem mass spectrometry (HPLC-MS). De novo sequencing provided the complete amino acid sequence of TSO. The results of CCK-8, colony formation, transwell, and qPCR confirmed that TSO had inhibitory effects on the proliferation and migration of HCCLM3 (human hepatocarcinoma cell line) and HepG2 cells. The results of flow cytometry confirmed its apoptotic activity. In animal experiments, we found that the tumor-suppressive effect was better in the oncotherapy group than the intraperitoneal injection group. The results of immunohistochemistry also suggested that TSO could inhibit proliferation and promote apoptosis. In conclusion, a specific enzyme that can degrade tryptophan and inhibit the growth of hepatoma cells was authenticated, and its basic information was obtained by extraction/purification and amino acid sequencing.

Functional hit 1 (FH1)-based rapid and efficient generation of functional hepatocytes from human mesenchymal stem cells: a novel strategy for hepatic differentiation.

BACKGROUND: Because the liver is central to the physiology of the body, primary hepatocytes are widely used in liver pathology and physiological research, such as liver drug screening, bioartificial liver support system, and cell therapy for liver diseases. However, the source of primary hepatocytes is limited. We describe a novel non-transgenic protocol that facilitates the rapid generation of hepatocyte-like cells from human umbilical cord-derived mesenchymal stem cells (hUC-MSCs), providing a new source of functional hepatocytes. METHODS: In this study, we used hUC-MSCs and human induced pluripotent cells (iPSCs) derived mesenchymal stem cells (iMSCs) to investigate the new induction strategy. Passage 3 MSCs were induced into hepatocyte-like cells using small-molecule compounds combined with cell factors in vitro. Functional hit 1 (FH1), a promising small molecule compound was achieved to replace HGF in the hepatocyte maturation stage to induce the hepatocyte-like cells differentiation. RESULTS: We rapidly induced hUC-MSCs and human iMSCs into hepatocyte-like cells within 10 days in vitro, and the cells were morphologically similarly to both hepatocytes derived from the hepatocyte growth factor (HGF)-based method and the primary hepatocytes. They expressed mature hepatocyte special genes and achieved functions such as glycogen storage, albumin expression, urea secretion, cytochrome P450 activity, Low-density lipoprotein (LDL) uptake, and indocyanine green (ICG) uptake. CONCLUSIONS: We successfully established a small-molecule protocol without using HGF to differentiate MSCs into hepatocyte-like cells, which provides a rapid and cost-effective platform for in vitro studies of liver disease.

Safety assessment of subtilisin QK in rats.

BACKGROUND: Subtilisin QK is a serine protease in the subtilisin family, and is fermented by Bacillus subtilis QK02. The fibrinolytic activity of subtilisin QK was measured by detecting low molecular weight degradation products using a spectrophotometric method developed by Japan Bio Science Laboratory Co., Ltd. Subtilisin QK powder can maintain its fibrinolytic activity for more than 24 months when it is stored at room temperature and protected from light. Our previous results showed that subtlisin QK directly degraded cross-linked fibrins in the fibrin plate assay and effectively inhibited thrombosis in the mouse thrombus model. The aim of this study was to determine the acute toxicity, potential subchronic toxicity, and safety pharmacology of subtilisin QK in Sprague-Dawley (SD) rats. METHODS: In the acute toxicity study, a single oral dose of 100,000 FU/kg was administered to 10 female and 10 male SD rats. In the 28-day subchronic toxicity, 60 female and 60 male SD rats were randomly assigned to four experimental groups (daily oral dose of 0, 2500, 7500 and 25,000 FU/kg). In the safety pharmacology study, 20 female and 20 male SD rats were randomly assigned to four experimental groups (single oral dose of 0, 500, 1500 and 5000 FU/kg). RESULTS: No death occurred and no adverse effects were observed in the acute toxicity study at a dose of 100,000 FU/kg. In the 28-day subchronic toxicity study, several hematological and blood biochemical parameters showed increases or decreases; however, due to the lack of a dose-response relationship, these differences were considered unrelated to treatment. In the safety pharmacology study, no adverse effects were observed on the central nervous of SD rats post-administration up to a dose of 5000 FU/kg subtilisin QK. CONCLUSION: The results showed that oral consumption of subtilisin QK is of low toxicological concern. No adverse effects were observed at doses of 2500, 7500, and 25,000 FU/kg in the 28-day subchronic toxicity, and the no-observed-adverse-effect level (NOAEL) of subtilisin QK was 25,000 FU/kg.

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

An Addition of U0126 Protecting Heart Grafts From Prolonged Cold Ischemia-Reperfusion Injury in Heart Transplantation: A New Preservation Strategy.

BACKGROUND: Ischemia-reperfusion injury (IRI) is the major cause of primary graft dysfunction in organ transplantation. The mitogen-activated protein kinase/extracellular signal-regulated kinase (ERK) signaling pathway plays a crucial role in cell physiological and pathological processes including IRI. This study aims to investigate whether inhibition of ERK signaling with U0126 can prevent prolonged cold IRI in heart transplantation. METHODS: Rat cardiac cell line H9c2 cells were treated with U0126 before exposure to hypothermic hypoxia/reoxygenation (H/R) conditions. The effect of U0126 on H9c2 cells in response to H/R stress was determined by measuring cell death, reactive oxygen species production, mitochondrial membrane potential, and ERK signaling activation. Mouse syngeneic heterotopic heart transplantation was conducted, where a donor heart was preserved in the University of Wisconsin (UW) solution supplemented with U0126 for 24 hours at 4°C before transplantation. Heart graft function, histopathologic changes, apoptosis, and fibrosis were measured to assess IRI. RESULTS: Phosphorylated ERK was increased in both in vitro H/R-injured H9c2 cells and in vivo heart grafts with IRI. Pretreatment with U0126 inhibited ERK phosphorylation and prevented H9c2 cells from cell death, reactive oxygen species generation, and mitochondrial membrane potential loss in response to H/R. Preservation of donor hearts with U0126-supplemented solution improved graft function and reduced IRI by reductions in cell apoptosis/death, neutrophil infiltration, and fibrosis of the graft. CONCLUSIONS: Addition of U0126 to UW solution reduces ERK signal activation and attenuates prolonged cold IRI in a heart transplantation model. ERK inhibition with U0126 may be a useful strategy to minimize IRI in organ transplantation.

TSPAN1 promotes autophagy flux and mediates cooperation between WNT-CTNNB1 signaling and autophagy via the MIR454-FAM83A-TSPAN1 axis in pancreatic cancer.

Pancreatic cancer is one of the most aggressive tumors associated with a poor clinical prognosis, weakly effective therapeutic options. Therefore, there is a strong impetus to discover new therapeutic targets in pancreatic cancer. In the present study, we first demonstrated that TSPAN1 is upregulated in pancreatic cancer and that TSPAN1 depletion decreases pancreatic cancer cell proliferation in vitro and in vivo. TSPAN1 expression was correlated with poor overall survival of pancreatic cancer patients. Moreover, we demonstrated that TSPAN1 is a novel positive regulator of macroautophagy/autophagy characterized by decreased LC3-II and SQSTM1/p62 expressions, inhibited puncta formation of GFP-LC3 and autophagic vacuoles. We also demonstrated that tspan1 mutation impaired autophagy in the zebrafish model. Furthermore, we showed that TSPAN1 promoted autophagy maturation via direct binding to LC3 by two conserved LIR motifs. Mutations in the LIR motifs of TSPAN1 resulted in a loss of the ability to induce autophagy and promote pancreatic cancer proliferation. Second, we discovered two conservative TCF/LEF binding elements present in the promoter region of the TSPAN1 gene, which was further verified through luciferase activity and ChIP assays. Furthermore, TSPAN1 was upregulated by FAM83A through the canonical WNT-CTNNB1 signaling pathway. We further demonstrated that both TSPAN1 and FAM83A are both direct targets of MIR454 (microRNA 454). Additionally, we revealed the role of MIR454-FAM83A-TSPAN1 in the proliferation of pancreatic cancer cells in vitro and in vivo. Our findings suggest that components of the MIR454-FAM83A-TSPAN1 axis may be valuable prognosis markers or therapeutic targets for pancreatic cancer.Abbreviations: AMPK: adenosine 5'-monophosphate (AMP)-activated protein kinase; APC: APC regulator of WNT signaling pathway; ATG: autophagy related; AXIN2: axin 2; BECN1: beclin 1; CCND1: cyclin D1; CSNK1A1/CK1α: casein kinase 1 alpha 1; CTNNB1/ß-catenin: catenin beta 1; DAPI: 4'6-diamino-2-phenylindole; EBSS: Earle's balanced salt solution; EdU: 5-ethynyl-20-deoxyuridine; FAM83A: family with sequence similarity 83 member A; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; GFP: green fluorescent protein; GSEA: gene set enrichment analysis; GSK3B: glycogen synthase kinase 3 beta; IHC: immunohistochemical; LAMP1: lysosomal associated membrane protein 1; LIR: LC3-interacting region; MAP1LC3/LC3, microtubule associated protein 1 light chain 3; MIR454: microRNA 454; miRNA: microRNA; MKI67: antigen identified by monoclonal antibody Ki 67; MTOR: mechanistic target of rapamycin kinase; MTT: 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide; MYC: MYC proto-oncogene, bHLH transcription factor; OS: overall survival; PDAC: pancreatic ductal adenocarcinoma; RAB7A: RAB7A, member RAS oncogene family; shRNA: short hairpin RNA; SQSTM1: sequestosome 1; TBE: TCF/LEF binding element; TCGA: The Cancer Genome Atlas; TCF/LEF: transcription factor/lymphoid enhancer binding factor; TCF4: transcription factor 4; TSPAN1: tetraspanin 1; TUNEL: terminal deoxynucleotidyl transferase mediated dUTP nick end labeling; UTR: untranslated region; WT: wild type.

Acute and Subchronic Toxicities and Safety Pharmacology Studies of a Bacillus Subtilisin in Dogs.

Subtilisin NAT, a Bacillus subtilisin, is widely applied as a functional food and considered to be one of the most exploitable potential oral thrombolytic agents. Subtilisin QK, another Bacillus subtilisin, is a serine protease fermented by Bacillus subtilis 02 and has a better thrombolytic effect. Therefore, subtilisin QK is typically used for evaluating the safety of Bacillus subtilisins. Here, we conduct several good laboratory practice (GLP)-compliant studies in non-rodent animal, i.e., in Beagle dogs, including acute toxicity, subchronic toxicity, and safety pharmacology studies. No adverse effects were evident in the acute and 28-d subchronic toxicity studies at doses up to 40000 FU/kg and 16000 FU/kg/d, respectively. In evaluating the pharmacological safety of up to 2000FU/kg subtilisin QK, we found no significant differences between the electrocardiograms, blood pressures, and respiration of beagle dogs. These findings suggest the safety of Bacillus subtilisin, providing reliable pharmacological and toxicological data for its development and popularization as a functional food and drug.

Type 1 diabetes mellitus and its oral tolerance therapy.

As a T cell-mediated autoimmune disease, type 1 diabetes mellitus (T1DM) is marked by insulin defect resulting from the destruction of pancreatic ß-cells. The understanding of various aspects of T1DM, such as its epidemiology, pathobiology, pathogenesis, clinical manifestations, and complications, has been greatly promoted by valuable research performed during the past decades. However, these findings have not been translated into an effective treatment. The ideal treatment should safely repair the destroyed immune balance in a long-lasting manner, preventing or stopping the destruction of ß-cells. As a type of immune hypo-responsiveness to the orally administrated antigen, oral tolerance may be induced by enhancement of regulatory T cells (Tregs) or by anergy/deletion of T cells, depending on the dosage of orally administrated antigen. Acting as an antigen-specific immunotherapy, oral tolerance therapy for T1DM has been mainly performed using animal models and some clinical trials have been completed or are still ongoing. Based on the review of the proposed mechanism of the development of T1DM and oral tolerance, we give a current overview of oral tolerance therapy for T1DM conducted in both animal models and clinical trials.

Decreased Resting-State Interhemispheric Functional Connectivity in Medication-Free Obsessive-Compulsive Disorder.

OBJECTIVE: Decreased homotopic connectivity of brain networks such as the cortico-striato-thalamo-cortical (CSTC) circuits may contribute to the pathophysiology of obsessive-compulsive disorder (OCD). However, little is known about interhemispheric functional connectivity (FC) at rest in OCD. In this study, the voxel-mirrored homotopic connectivity (VMHC) method was applied to explore interhemispheric coordination at rest in OCD. METHODS: Forty medication-free patients with OCD and 38 sex-, age-, and education level-matched healthy controls (HCs) underwent a resting-state functional magnetic resonance imaging. The VMHC and support vector machine (SVM) methods were used to analyze the data. RESULTS: Patients with OCD had remarkably decreased VMHC values in the orbitofrontal cortex, thalamus, middle occipital gyrus, and precentral and postcentral gyri compared with HCs. A combination of the VMHC values in the thalamus and postcentral gyrus could optimally distinguish patients with OCD from HCs. CONCLUSIONS: Our findings highlight the contribution of decreased interhemispheric FC within and outside the CSTC circuits in OCD and provide evidence to the pathophysiology of OCD.

Quantitative pharmacokinetic evaluation of Subtilisin QK-2 after a bolus IV injection in a rat model using a novel sandwich enzyme-linked immunosorbent assay.

Intravascular thrombosis is a main cause of multiple cardiovascular diseases. A high thrombolytic activity of the microbial fibrinolytic enzyme Subtilisin QK-2, which is highly homologous to Nattokinase, shows great exploitable potential in thrombolytic therapy. However, the lack of a sensitive detection method limits the further analysis of Subtilisin QK-2 in vivo. We prepared a polyclonal antibody and four monoclonal antibodies (IgG1, titers of 1:500,000) to establish a sensitive sandwich ELISA for Subtilisin QK-2 detection. The limit of detection (LOD) of this ELISA was 1.160 ng/mL. The linear range of the standard curve was 1.96-250 ng/mL (R2 = 0.9912). The cut-off value was 0.236. Subsequently, a pharmacokinetic dose (IV bolus) was administered and analyzed with the established ELISA. The concentration-time profiles were best fitted to a two-compartment model. T1/2α values for doses of 2 mg/kg, 4 mg/kg, and 8 mg/kg were 29.90 ±â€¯10.02 min, 27.17 ±â€¯1.96 min, and 21.83 ±â€¯9.95 min, and T1/2ß values were 144.43 ±â€¯49.73 min, 173.46 ±â€¯52.58 min, and 159.49 ±â€¯48.75 min, respectively. Subtilisin QK-2 was eliminated through a mechanism with first-order kinetics. In conclusion, this study provides useful data for further research and clinical applications of Subtilisin QK-2 in the treatment of cardiovascular diseases.

Increased cerebellar-default-mode network connectivity at rest in obsessive-compulsive disorder.

Abnormalities of the cerebellum and default-mode network (DMN) in patients with obsessive-compulsive disorder (OCD) have been widely reported. However, alterations of reciprocal functional connections between the cerebellum and DMN at rest in OCD remain unclear. Forty patients with OCD and 38 gender-, age-, and education-matched healthy controls (HCs) underwent resting-state functional magnetic resonance imaging scan. Seed-based functional connectivity (FC) and support vector machine (SVM) were applied to analyze the imaging data. Compared with HCs, patients with OCD exhibited increased FCs between the left Crus I-left superior medial prefrontal cortex (MPFC) and between the right Crus I-left superior MPFC, left middle MPFC, and left middle temporal gyrus (MTG). A significantly negative correlation was observed between the right Crus I-left MTG connectivity and the Yale-Brown Obsessive-Compulsive Scale compulsion subscale scores in the OCD group (r = - 0.476, p = 0.002, Bonferroni corrected). SVM classification analysis indicated that a combination of the left Crus I-left superior MPFC connectivity and the right Crus I-left middle MPFC connectivity can be used to discriminate patients with OCD from HCs with a sensitivity of 85.00%, specificity of 68.42%, and accuracy of 76.92%. Our study highlights the contribution of the cerebellar-DMN connectivity in OCD pathophysiology and provides new findings to OCD research.

STYK1 promotes autophagy through enhancing the assembly of autophagy-specific class III phosphatidylinositol 3-kinase complex I.

Macroautophagy/autophagy plays key roles in development, oncogenesis, and cardiovascular and metabolic diseases. Autophagy-specific class III phosphatidylinositol 3-kinase complex I (PtdIns3K-C1) is essential for autophagosome formation. However, the regulation of this complex formation requires further investigation. Here, we discovered that STYK1 (serine/threonine/tyrosine kinase 1), a member of the receptor tyrosine kinases (RTKs) family, is a new upstream regulator of autophagy. We discovered that STYK1 facilitated autophagosome formation in human cells and zebrafish, which was characterized by elevated LC3-II and lowered SQSTM1/p62 levels and increased puncta formation by several marker proteins, such as ATG14, WIPI1, and ZFYVE1. Moreover, we observed that STYK1 directly binds to the PtdIns3K-C1 complex as a homodimer. The binding with this complex was promoted by Tyr191 phosphorylation, by means of which the kinase activity of STYK1 was elevated. We also demonstrated that STYK1 elevated the serine phosphorylation of BECN1, thereby decreasing the interaction between BECN1 and BCL2. Furthermore, we found that STYK1 preferentially facilitated the assembly of the PtdIns3K-C1 complex and was required for PtdIns3K-C1 complex kinase activity. Taken together, our findings provide new insights into autophagy induction and reveal evidence of novel crosstalk between the components of RTK signaling and autophagy. Abbreviations: AICAR: 5-aminoimidazole-4-carboxamide ribonucleotide; AMPK: adenosine 5'-monophosphate (AMP)-activated protein kinase; ATG: autophagy related; ATP: adenosine triphosphate; BCL2: BCL2 apoptosis regulator; BECN1: beclin 1; Bre A: brefeldin A; Co-IP: co-immunoprecipitation; CRISPR: clustered regularly interspaced short palindromic repeats; DAPI: 4',6-diamidino-2-phenylindole; EBSS: Earle's balanced salt solution; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; GFP: green fluorescent protein; GSEA: gene set enrichment analysis; MAP1LC3/LC3, microtubule associated protein 1 light chain 3; MAPK8/JNK1: mitogen-activated protein kinase 8; mRFP: monomeric red fluorescent protein; MTOR: mechanistic target of rapamycin kinase; MTT: 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide; PIK3C3: phosphatidylinositol 3-kinase catalytic subunit type 3; PIK3R4: phosphoinositide-3-kinase regulatory subunit 4; qRT-PCR: quantitative reverse transcription PCR; RACK1: receptor for activated C kinase 1; RUBCN: rubicon autophagy regulator; siRNA: small interfering RNA; SQSTM1: sequestosome 1; STYK1/NOK: serine/threonine/tyrosine kinase 1; TCGA: The Cancer Genome Atlas; Ub: ubiquitin; ULK1: unc-51 like autophagy activating kinase 1; UVRAG: UV radiation resistance associated; WIPI1: WD repeat domain, phosphoinositide interacting 1; ZFYVE1: zinc finger FYVE-type containing 1.