Strategies for Improving Aptamer Screening Efficiency: Library Design, Awareness Innovation, and Instrument Assistance.

Aptamers, as short single-stranded nucleic acids, can bind to targets in a similar way to antibodies. Relying on the advantages of low cost, high stability, and flexibility, they are widely applied in biosensors, disease therapy, and synthetic biology. As an aptamer screening method, the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) offers almost unlimited possibilities for functional aptamer generation. However, at present, the SELEX procedure has not reached a satisfactory level, and it still faces some challenges in practical application, such as the relatively blind initial library, laborious and time-consuming selection process, typically requires 9-20 rounds for screening, and the entire process generally extends over 2-3 months, and sub-optimal performance of aptamers obtained. In the past few years, researchers have made great efforts to address these obstacles. Hence, in this review, we first summarize the aptamer screening mechanism and the existing limitations of SELEX. Then analyze the principle and technical key points of the SELEX optimization screening strategy. By incorporating rational library design, novel screening awareness, and advanced screening equipment, the number of aptamer screening cycles is significantly reduced to <8 rounds, with some methods achieving single-round screenings. This has led to a considerable decrease in the overall screening time to <3 weeks, while simultaneously enhancing the performance of the aptamers. Finally, critically discuss the present challenges and future directions of aptamer screening. This review aims to provide a practical reference for designing suitable aptamer screening methods.

Construction of Aptamer-Functionalized DNA Hydrogels for Effective Inhibition of Shiga Toxin II Toxicity.

Bacterial infections have been seriously endangering public health and life, making it imperative to explore novel anti-infection strategies for their control. Herein, we constructed a DNA hydrogel encoded with aptamers (Apt-hydrogel) to inhibit Shiga toxin II (Stx2) toxicity, thereby alleviating Escherichia coli (EHEC) infection. The Apt-hydrogel was formed by two Y-shaped DNA scaffolds through rational design, where one end of Y was encoded with an aptamer sequence targeting the B subunit of Shiga toxin II (Stx2B). The Apt-hydrogel not only retained the high affinity of the aptamer but also provided protection for the aptamer, endowing it with better stability and biocompatibility. The results from in vitro and in vivo demonstrated good mediation effects of the Apt-hydrogel on Stx2 toxicity and confirmed its excellent inhibition activity. We hypothesized that the mechanism could be attributed to the high affinity of Apt-hydrogel for Stx2B, which effectively occupies the active site of Stx2B and its receptor Gb3. This interaction enhanced steric hindrance, thereby mediating their interaction and preventing Stx2 from entering the cell to exert toxicity. We anticipate that the novel Apt-hydrogel will expand the usage of aptamers and provide a new dimension for the Apt-hydrogel as a promising blocking assistant to inhibit Shiga toxin infections via a strong steric hindrance effect.

Highly sensitive colorimetric and paper-based detection for sildenafil in functional food based on monodispersed spherical magnetic graphene composite nanozyme.

BACKGROUND: Sildenafil (SIL) is regarded as an illegal adulterant in functional foods. Some functional foods doped with SIL have posed significant concern about their safety risks. However, the facile colorimetric detection of SIL is rarely investigated. RESULTS: Herein, we prepared a monodispersed spherical composite nanozyme (Fe3O4-NH2/GONRs), possessing excellent peroxidase-like (POD-like) and catalase-like (CAT-like) activities and strong superparamagnetic property. The enzyme-like activities of Fe3O4-NH2/GONRs can be selectively inhibited by SIL due to the synergistic effect of hydrogen bonds and π-π stacking between Fe3O4-NH2/GONRs and SIL. Leveraging this mechanism, a highly sensitive and selective colorimetric detection for SIL with a detection limit (LOD) of 0.26 ng/mL was developed. In addition, we prepared a three-dimensional paper-based analytical device (3D-PAD) for SIL colorimetric detection with naked-eyes and the semi-quantitative analysis with a LOD of 88 ng/mL. SIGNIFICANCE: The proposed colorimetric and PAD detections demonstrated the advantages of low-cost, highly sensitive and selective, thus have promise application potential in the rapid detection of adulterated functional foods.

Design and application of microfluidics in aptamer SELEX and Aptasensors.

Aptamers are excellent recognition molecules obtained from systematic evolution of ligands by exponential enrichment (SELEX) that have been extensively researched for constructing aptasensors. However, in the process from SELEX to the construction of aptasensors, there are many disadvantages, such as tedious and repetitive operations, interference from external factors, and low efficiency, which seriously limits their application scope and development. Introducing the microfluidic technology can realize the integration and intelligence of SELEX and aptasensing, improve the efficiency of SELEX, and enhance the detection performance and convenience of aptasensing. Hence, in this review, the characteristics of various chips based on different driving forces are described firstly. And then summarizing the design of microfluidic devices based on different SELEX methods and showing the strategies of microfluidic aptasensors based on different detection modes. Finally, discussing the difficulties and challenges encountered when microfluidic is integrated with the SELEX and the aptasensors.

New application of a dye-decolorizing peroxidase immobilized on magnetic nanoparticles for efficient simultaneous degradation of two mycotoxins.

Nowadays the enzymatic approaches are the most promising strategies for mycotoxins detoxification in food stuffs. Herein, the dye-decolorizing peroxidase RhDypB from Rhodococcus jostii was studied for its ability to degrade two mycotoxins in both free and the immobilized enzyme forms. This enzyme was recombinantly expressed and purified, while Fe3O4 nanoparticles were prepared and modified with chitosan as the immobilization carrier. The immobilized enzyme Fe3O4@CS@RhDypB demonstrated degradation rate of 85.61 % toward aflatoxin B1, while it was firstly found to be able to degrade zearalenone with the rate of 86.52 %, at pH 4.0 on 30 °C. The degradation products were identified as aflatoxin Q1 and 15-OH-ZEN respectively. After 5 cycles of reuse, Fe3O4@CS@RhDypB still exhibited degradation rates of 38.50 % and 49.76 % toward the mycotoxins, indicating its high reusability. Moreover, Fe3O4@CS@RhDypB exhibited excellent stability after 10 days of storage. This work identified potential applications of nanoparticle-immobilized enzyme for biodegradation of mycotoxins in food industry.

Assembly of a multivalent aptamer for efficient inhibition of thermostable direct hemolysin toxicity induced by Vibrio parahaemolyticus.

Thermostable direct hemolysin (TDH) is a key virulence factor of Vibrio parahaemolyticus, capable of causing seafood-mediated outbreaks of gastroenteritis, posing a threat to the aquatic environment and global public health. In the present study, we explored a multivalent aptamer-mediated inhibition strategy to mitigate TDH toxicity. Based on the characteristic structure of TDH, a stable multivalent aptamer, Ap3-5, was rationally designed by truncation, key fragment evolution, and end fixation. Ap3-5 exhibited strong affinity (Kd=39.24 nM), and thermal (Tm=57.6 °C) and enzymatic stability. In silico studies also revealed that Ap3-5 occupied more active sites of TDH and covered its central pore, indicating its potential as a blocking agent for inhibiting TDH toxicity. In the hemolysis assay, Ap3-5 significantly suppressed the hemolytic effect of TDH. A cellular study revealed a substantial (∼80 %) reduction in TDH cytotoxicity. Supporting these findings, in vivo trials confirmed the inhibitory action of Ap3-5 on both the acute and intestinal toxicity of TDH. Overall, benefiting from the strong binding affinity, high stability, and multisite occupation of the multivalent aptamer with TDH, Ap3-5 displayed robust potential against TDH toxicity by inhibiting membrane pore formation, providing a new approach for alleviating bacterial infections.

Discovery and design of an aptamer that inhibits Shiga toxin type 2 activity by blocking Stx2 B subunit-Gb3 interaction.

Shiga toxin (Stx) is the definitive virulence factor of Stx-producing Escherichia coli. This bacterial pathogen can contaminate food and threaten human health. Binding of the B subunit of Stx to the specific receptor globotriaosylceramide (Gb3) on the cell membrane is a key step for Stx to enter cells and exert its toxicity. In this work, we aimed to screen for aptamers targeting the Stx 2 B subunit, to interfere with the interaction of Stx2 B subunit and Gb3, thereby blocking Stx2 from entering cells. The results of molecular simulation docking, competitive ELISA, flow cytometry, and laser confocal microscopy confirmed that aptamers S4, S5, and S6 can mediate the interaction between Stx2 B subunit and Gb3. To further improve the inhibition effect, multiple aptamer sequences were tailored and were fused. The bivalent modification aptamer B2 inhibited Stx2 toxicity to Vero cells with inhibition rate of 53 %. Furthermore, the aptamer B2 reduced Stx2 damage to the mice, indicating that it has great potential to interfere with Stx2 binding to Gb3 receptors in vivo and in vitro. This work provides a theoretical and experimental basis for the application of aptamers in the inhibition of Stx2 toxicity and control of food hazards.

An ultrasensitive dual-mode aptasensor for patulin based on the upconversion particles and G-Quadruplex-hemin DNAzyme.

Patulin (PAT) is a mycotoxin-produced secondary metabolite that can contaminate foods, causing toxic effects on animal and human health. Therefore, for the first time, we have constructed a "turn-on" dual-mode aptamer sensor for PAT using oleic acid-coated upconversion nanomaterials (OA-UCNPs) and G-Quadruplex-hemin DNAzyme (G4-DNAzyme) as fluorescent and colorimetry probes. The sensor employs aptamers binding to PAT as recognition elements for specific molecule detection. Mxene-Au can be used as a biological inducer to assist OA-UCNPs in controlling fluorescence intensity. In addition, colorimetric signal amplification was performed using the trivalent G4-DNAzyme to increase detection sensitivity and reduce false positives. Under optimal conditions, the dual-mode aptasensor has a detection limit of 5.3 pg mL-1 in fluorescence and 2.4 pg mL-1 in colorimetric methods, respectively, with the wider linear range and limit of detection (LOD) of the colorimetric assay. The combination aptasensor can detect PAT with high sensitivity and high specificity and has broad application prospects in the field of food safety detection.

Detection and simultaneous imaging of acrylamide, miR-21 and miR-221 based on multicolor aggregation-induced emission nanoparticles and DNAzyme walker.

Acrylamide (AA) in heat-processed foods has emerged as a global health problem, mainly carcinogenic, neurotoxic, and reproductive toxicity, and an increasing number of researchers have delved into elucidating its toxicological mechanisms. Studies have demonstrated that exposure of HepG2 by AA in a range of concentrations can induce the upregulation of miR-21 and miR-221. Monitoring the response of intracellular miRNAs can play an important role in unraveling the mechanisms of AA toxicity. Here, multicolor aggregation induced emission nano particle (AIENP) probes were constructed from three AIE dyes for simultaneous imaging of intracellular AA and AA-induced miR-21/miR-221 by combining the recognition function of AA aptamers and the signal amplification of a DNAzyme walker. The surface of these nanoparticles contains carboxyl groups, facilitating their linkage to a substrate chain modified with a fluorescent quencher group via an amide reaction. Optimization experiments were conducted to determine the optimal substrate-to-DNAzyme ratio, confirming its efficacy as a walker for signal amplification. Sensitive detection of AA, miR-21 and miR-221 was achieved in extracellular medium, with detection limits of 0.112 nM for AA, 0.007 pM and 0.003 pM for miR-21 and miR-221, respectively, demonstrating excellent selectivity. Intracellularly, ZIF-8 structure collapsed, releasing Zn2+, activating DNAzyme cleavage activity, and the fluorescence of multicolor AIENPs within HepG2 cells gradually recovered with increasing stimulation time (0-12 h) and concentrations of AA (0-500 µM). This dynamic response unveiled the relationship between AA exposure and miR-21/miR-221 expression, further validating the carcinogenicity of AA.

Recent advances in the construction strategy, functional properties, and biosensing application of self-assembled triangular unit-based DNA nanostructures.

Research on self-assembled deoxyribonucleic acid (DNA) nanostructures with different shapes, sizes, and functions has recently made rapid progress owing to its biocompatibility, programmability, and stability. Among these, triangular unit-based DNA nanostructures, which are typically multi-arm DNA tiles, have been widely applied because of their unique structural rigidity, spatial flexibility, and cell permeability. Triangular unit-based DNA nanostructures are folded from multiple single-stranded DNA using the principle of complementary base pairing. Its shape and size can be determined using pre-set scaffold strands, segmented base complementary regions, and sequence lengths. The resulting DNA nanostructures retain the desired sequence length to serve as binding sites for other molecules and obtain satisfactory results in molecular recognition, spatial orientation, and target acquisition. Therefore, extensive research on triangular unit-based DNA nanostructures has shown that they can be used as powerful tools in the biosensing field to improve specificity, sensitivity, and accuracy. Over the past few decades, various design strategies and assembly techniques have been established to improve the stability, complexity, functionality, and practical applications of triangular unit-based DNA nanostructures in biosensing. In this review, we introduce the structural design strategies and principles of typical triangular unit-based DNA nanostructures, including triangular, tetrahedral, star, and net-shaped DNA. We then summarize the functional properties of triangular unit-based DNA nanostructures and their applications in biosensing. Finally, we critically discuss the existing challenges and future trends.

Lateral flow assay for simultaneous detection of multiple mycotoxins using nanozyme to amplify signals.

Co-contamination of multiple mycotoxins produces synergistic toxic effects, leading to more serious hazards. Therefore, the simple, rapid and accurate simultaneous detection of multiple mycotoxins is crucial. Herein, a three-channel aptamer-based lateral flow assay (Apt-LFA) was established for the detection of aflatoxin M1 (AFM1), aflatoxin B1 (AFB1) and ochratoxin A (OTA). The multi-channel Apt-LFA utilized gold­iridium nanozyme to catalyze the chromogenic substrate, which effectively achieved signal amplification. Moreover, the positions and lengths of the complementary sequences were screened by changes in fluorescence intensity. After grayscale analysis, the semi-quantitative results showed that the detection limits of AFM1, AFB1 and OTA were 0.39 ng/mL, 0.36 ng/mL and 0.82 ng/mL. The recoveries of the multiplexed competitive sensors in complex matrices of real samples were 93.33%-97.01%, 95.72%-102.67%, and 106.88%-109.33%, respectively. In conclusion, the assembly principle of the three-channel Apt-LFA is simple, which can provide a new idea for the simultaneous detection of small molecule targets.

Dual pH- and ATP-Responsive Antibacterial Nanospray: On-Demand Release of Antibacterial Factors, Imaging Monitoring, and Accelerated Healing of Bacteria-Infected Wounds under NIR Activation.

The prevalence of pathogenic bacterial infections with high morbidity and mortality poses a widespread challenge to the healthcare system. Therefore, it is imperative to develop nanoformulations capable of adaptively releasing antimicrobial factors and demonstrating multimodal synergistic antimicrobial activity. Herein, an NIR-activated multifunctional synergistic antimicrobial nanospray MXene/ZIF-90@ICG was prepared by incorporating ZIF-90@ICG nanoparticles onto MXene-NH2 nanosheets. MXene/ZIF-90@ICG can on-demand release the antimicrobial factors MXenes, ICG, and Zn2+ in response to variations in pH and ATP levels within the bacterial infection microenvironment. Under NIR radiation, the combination of MXenes, Zn2+, and ICG generated a significant amount of ROS and elevated heat, thereby enhancing the antimicrobial efficacy of PDT and PTT. Meanwhile, NIR excitation could accelerate the further release of ICG and Zn2+, realizing the multimodal synergistic antibacterial effect of PDT/PTT/Zn2+. Notably, introducing MXenes improved the dispersion of the synthesized antimicrobial nanoparticles in aqueous solution, rendering MXene/ZIF-90@ICG a candidate for application as a nanospray. Importantly, MXene/ZIF-90@ICG demonstrated antimicrobial activity and accelerated wound healing in the constructed in vivo subcutaneous Staphylococcus aureus infection model with NIR activation, maintaining a favorable biosafety level. Therefore, MXene/ZIF-90@ICG holds promise as an innovative nanospray for adaptive multimodal synergistic and efficient antibacterial applications with NIR activation.

An Ochratoxin a DNA Aptamer-Mediated Transcriptional Regulatory Riboswitch Biosensor.

This study developed a transcriptional regulation riboswitch biosensing analytical method based on the Ochratoxin A (OTA) DNA aptamer programming design. OTA DNA aptamer was used to develop artificial riboswitch, a strategy that relies on a simple combination of single-stranded DNA (ssDNA) template with oligonucleotides that base pair only in the -17 to +1 region to define promoter elements. The OTA DNA aptamer sequence GATCGGGTTGGGTGGCGTAAAGGGAGCATCGG (1.12.8) has a typical antiparallel G-quadruplex structure, and the presence of OTA will further stabilize this structure. Based on this property, OTA DNA aptamer can be used to construct riboswitch and potentially transcriptionally regulate gene expression. To further increase the impact of OTA-binding aptamer on the structure, an ssDNA template was prepared based on the rolling circle replication mechanism of the helper phage M13K07. This ssDNA was used in the cell-free expression system to inhibit the expression of the downstream reporter gene colorimetric enzyme catechol (2,3)-dioxygenase (C23DO) in the presence of OTA. C23DO was used to catalyze the substrate catechol to produce a colorimetric output. This study broadens the potential of artificial riboswitch as practical biosensing module tools and contributes to the development of simple, rapid, field-deployable analytical methods with broad application prospects for field placement testing.

Aptamer-modified paper-based analytical devices for the detection of food hazards: Emerging applications and future perspective.

Food analysis plays a critical role in assessing human health risks and monitoring food quality and safety. Currently, there is a pressing need for a reliable, portable, and quick recognition element for point-of-care testing (POCT) to better serve the demands of on-site food analysis. Aptamer-modified paper-based analytical devices (Apt-PADs) have excellent characteristics of high portability, high sensitivity, high specificity, and on-site detection, which have been widely used and concerned in the field of food safety. The article reviews the basic components and working principles of Apt-PADs, and introduces their representative applications detecting food hazards. Finally, the advantages, challenges, and future directions of Apt-PADs-based sensing performance are discussed, to provide new directions and insights for researchers to select appropriate Apt-PADs according to specific applications.

Ratiometric Fluorescence Aptasensor of Allergen Protein Based on Multivalent Aptamer-Encoded DNA Flowers as Fluorescence Resonance Energy Transfer Platform.

Life-threatening allergic reactions to food allergens, particularly peanut protein Ara h1, are a growing public health concern affecting millions of people worldwide. Thus, accurate and rapid detection is necessary for allergen labeling and dietary guidance and ultimately preventing allergic incidents. Herein, we present a novel ratiometric fluorescence aptasensor based on multivalent aptamer-encoded DNA flowers (Mul-DNFs) for the high-stability and sensitive detection of allergen Ara h1. The flower-shaped Mul-DNFs were spontaneously packaged using ultralong polymeric DNA amplicons driven by a rolling circle amplification reaction, which contains a large number of Ara h1 specific recognition units and has excellent binding properties. Furthermore, dual-color fluorescence-labeled Mul-DNFs probes were developed by hybridizing them with Cy3- and Cy5-labeled complementary DNA (cDNA) to serve as a ratiometric fluorescence aptasensor platform based on fluorescence resonance energy transfer. Benefiting from the combined merits of the extraordinary synergistic multivalent binding ability of Mul-DNFs, the excellent specificity of the aptamer, and the sensitivity of the ratiometric sensor to avoid exogenous interference. The developed ratiometric aptasensor showed excellent linearity (0.05-2000 ng mL-1) with a limit of detection of 0.02 ng mL-1. Additionally, the developed ratiometric fluorescence aptasensor was utilized for quantifying the presence of Ara h1 in milk, infant milk powder, cookies, bread, and chocolate with recoveries of 95.7-106.3%. The proposed ratiometric aptasensor is expected to be a prospective universal aptasensor platform for the rapid, sensitive, and accurate determination of food and environmental hazards.

Highly Efficient Fabrication of Fluorescent "Turn-On" Lateral Flow Strips for Highly Sensitive Detection of Small Molecules Based on Self-Assembly of AuAg Nanoclusters.

Currently, fluorescent "turn-on" lateral flow assay (FONLFA) has shown enhanced "naked eye" detection sensitivity for small molecules, while it is urgent to adopt biocompatible fluorescent nanomaterials and needs new strategies to simplify the preparation process. In this study, a highly effective method was proposed to produce FONLFA strips for the detection of small molecules. The gold-silver nanoclusters (AuAgNCs) were immobilized onto the nitrocellulose membrane of the strips by the self-assembly of poly(sodium 4-styrenesulfonate), antigen, and AuAgNCs. The immobilization process entails a straightforward mixing of the three components, taking merely 1 min, thereby bypassing the necessity for chemical modification of fluorescent nanomaterials. The strategy offers a significantly simplified process, which substantially enhances the efficiency of the strip fabrication. Utilizing this method, a FONLFA was developed for carbendazim with a visual limit of detection (vLOD) reduced by 40-fold compared with the conventional colorimetric lateral flow assay (LFA). Furthermore, the approach demonstrates versatility by enabling the immobilization of AuAgNCs and streptavidin, which facilitates the development of aptamer-based FONLFAs. The designed aptamer-based FONLFA for kanamycin exhibited a 50-fold reduction in the vLOD compared with conventional colorimetric LFAs. Therefore, FONLFA holds promising potential for widespread applications in the analysis of small molecules.

Food-Grade Expression of Two Laccases in Pichia pastoris and Study on Their Enzymatic Degradation Characteristics for Mycotoxins.

Mycotoxin contamination poses substantial health risks to humans and animals. In this study, the two laccases PpLac1 and AoLac2 from Pleurotus pulmonarius and Aspergillus oryzae were selected and heterologously expressed in Pichia pastoris in a food-grade manner to detoxify aflatoxin B1 (AFB1), zearalenone (ZEN), and deoxynivalenol (DON). Both laccases exhibited degradation activity toward these three mycotoxins, while the efficiency of these for DON was relatively low. Therefore, molecular docking between these laccases and DON was conducted to analyze their potential interaction mechanisms. Furthermore, the degradation conditions of AFB1 and ZEN by the two laccases were optimized, and the optimal degradation rates for AFB1 and ZEN by PpLac1 reached 78.51 and 78.90%, while those for AFB1 and ZEN by AoLac2 reached 72.27 and 80.60%, respectively. The laccases PpLac1 and AoLac2 successfully transformed AFB1 and ZEN into the compounds AFQ1 and 15-OH-ZEN, which were 90 and 98% less toxic than the original compounds, respectively. Moreover, the culture supernatants demonstrated effective mycotoxin degradation results for AFB1 and ZEN in contaminated feed samples. The residual levels of AFB1 and ZEN in all samples ranged from 6.61 to 8.72 µg/kg and 3.44 to 98.15 µg/kg, respectively, and these levels were below the limit set by the European Union standards. All of the results in this study indicated that the two laccases have excellent application potential in the feed industry.

Spatiotemporal ATF3 Expression Determines VSMC Fate in Abdominal Aortic Aneurysm.

BACKGROUND: Abdominal aortic aneurysm (AAA) is a catastrophic disease with little effective therapy, likely due to the limited understanding of the mechanisms underlying AAA development and progression. ATF3 (activating transcription factor 3) has been increasingly recognized as a key regulator of cardiovascular diseases. However, the role of ATF3 in AAA development and progression remains elusive. METHODS: Genome-wide RNA sequencing analysis was performed on the aorta isolated from saline or Ang II (angiotensin II)-induced AAA mice, and ATF3 was identified as the potential key gene for AAA development. To examine the role of ATF3 in AAA development, vascular smooth muscle cell-specific ATF3 knockdown or overexpressed mice by recombinant adeno-associated virus serotype 9 vectors carrying ATF3, or shRNA-ATF3 with SM22α (smooth muscle protein 22-α) promoter were used in Ang II-induced AAA mice. In human and murine vascular smooth muscle cells, gain or loss of function experiments were performed to investigate the role of ATF3 in vascular smooth muscle cell proliferation and apoptosis. RESULTS: In both Ang II-induced AAA mice and patients with AAA, the expression of ATF3 was reduced in aneurysm tissues but increased in aortic lesion tissues. The deficiency of ATF3 in vascular smooth muscle cell promoted AAA formation in Ang II-induced AAA mice. PDGFRB (platelet-derived growth factor receptor ß) was identified as the target of ATF3, which mediated vascular smooth muscle cell proliferation in response to TNF-alpha (tumor necrosis factor-α) at the early stage of AAA. ATF3 suppressed the mitochondria-dependent apoptosis at the advanced stage by upregulating its direct target BCL2. Our chromatin immunoprecipitation results also demonstrated that the recruitment of NFκB1 and P300/BAF/H3K27ac complex to the ATF3 promoter induces ATF3 transcription via enhancer activation. NFKB1 inhibitor (andrographolide) inhibits the expression of ATF3 by blocking the recruiters NFKB1 and ATF3-enhancer to the ATF3-promoter region, ultimately leading to AAA development. CONCLUSIONS: Our results demonstrate a previously unrecognized role of ATF3 in AAA development and progression, and ATF3 may serve as a novel therapeutic and prognostic marker for AAA.

A facile dual-mode SERS/fluorescence aptasensor for AFB1 detection based on gold nanoparticles and magnetic nanoparticles.

Aflatoxin B1 (AFB1) is a virulent metabolite secreted by Aspergillus fungi, impacting crop quality and posing health risks to human. Herein, a dual-mode Raman/fluorescence aptasensor was constructed to detect AFB1. The aptasensor was assembled by gold nanoparticles (AuNPs) and magnetic nanoparticles (MNPs), while the surface-enhanced Raman scattering (SERS) and fluorescence resonance energy transfer (FRET) effects were both realized. AuNPs were modified with the Raman signal molecule 4-MBA and the complementary chain of AFB1 aptamer (cDNA). MNPs were modified with the fluorescence signal molecule Cy5 and the AFB1 aptamer (AFB1 apt). Through base pairing, AuNPs aggregated on the surface of MNPs, forming a satellite-like nanocomposite, boosting SERS signal via increased "hot spots" but reducing fluorescence signal due to the proximity of AuNPs to Cy5. Upon exposure to AFB1, AFB1 apt specifically bound to AFB1, causing AuNPs detachment from MNPs, weakening the SERS signal while restoring the fluorescence signal. AFB1 concentration displayed a good linear relationship with SERS/fluorescence signal in the range of 0.01 ng/mL-100 ng/mL, with a detection limit as low as 5.81 pg/mL. The use of aptamer assured the high selectivity toward AFB1. Furthermore, the spiked recovery in peanut samples ranged from 91.4 % to 95.6 %, indicating the applicability of real sample detection. Compared to single-signal sensor, this dual-signal sensor exhibited enhanced accuracy, robust anti-interference capability, and increased flexibility, promising for toxin detection in food safety applications.

Dual-mode aptasensor based on P-CeO2NR@Mxene and exonuclease I-assisted target recycling for malachite green detection.

Malachite green (MG) has been illicitly employed in aquaculture as a parasiticide, however, its teratogenic and carcinogenic effects pose a significant human health threat. Herein, a dual-mode colorimetric and electrochemical aptasensor was fabricated for MG detection, capitalizing on the robust catalytic and peroxidase-like activity of P-CeO2NR@Mxene and good capture efficiency of a tetrahedral DNA nanostructure (TDN) designed with multiple aptamers (m-TDN). P-CeO2NR@Mxene-modified complementary DNA (cDNA) served as both colorimetric and electrochemical probe. m-TDN was attached to AuE to capture MG and P-CeO2NR@Mxene/cDNA. The superior aptamer and MG binding to cDNA regulated signals and enabled precise MG quantification. The further introduced Exo I enabled aptamer hydrolysis, releasing MG for further binding rounds, allowing target recycling amplification. Under the optimal conditions, the aptasensor reached an impressively low detection limit 95.4 pM in colorimetric mode and 83.6 fM in electrochemical mode. We believe this dual-mode approach holds promise for veterinary drug residue detection.