RESUMO
OBJECTIVES: To assess the feasibility and efficacy of a 6-week pilot active break program (ACTI-BREAK) on academic achievement, classroom behaviour and physical activity. DESIGN: Pilot cluster randomised controlled trial. METHODS: 374 children in Year 3 and 4 (74% response) were recruited from six schools across Melbourne, Australia. Schools were randomised to the ACTI-BREAK intervention or usual teaching practice. The intervention involved teachers incorporating 3×5min active breaks into their classroom routine daily. Academic achievement was assessed using 1-min tests in reading and mathematics; classroom behaviour at the individual and whole class level was observed by teachers; and physical activity levels were assessed using accelerometers. Multilevel mixed effects linear regression models were conducted using intention to treat (ITT) and per protocol (PP) analyses. RESULTS: Significant intervention effects were found for classroom behaviour at the individual level (ITT B=16.17; 95% CI: 6.58, 25.76); effects were stronger for boys (B=21.42; 95% CI: 10.34, 32.49) than girls (B=12.23; 95% CI: 1.52, 22.92). No effect was found for classroom behaviour at the whole class level, reading, math or physical activity. PP findings were similar. CONCLUSIONS: Implementing active breaks during class time may improve classroom behaviour, particularly for boys. There was no evidence to suggest that implementing active breaks had any adverse effect on academic achievement or classroom behaviour, which may encourage classroom teachers to incorporate active breaks into their routine.
Assuntos
Sucesso Acadêmico , Exercício Físico , Acelerometria , Austrália , Criança , Feminino , Humanos , Modelos Lineares , Masculino , Projetos Piloto , Instituições Acadêmicas , Estudantes , Ensino , Fatores de TempoRESUMO
We present IncucyteDRC, an R package for the analysis of data from live cell imaging cell proliferation experiments carried out on the Essen Biosciences IncuCyte ZOOM instrument. The package provides a simple workflow for summarising data into a form that can be used to calculate dose response curves and EC50 values for small molecule inhibitors. Data from different cell lines, or cell lines grown under different conditions, can be normalised as to their doubling time. A simple graphical web interface, implemented using shiny, is provided for the benefit of non-R users. The software is potentially useful to any research group studying the impact of small molecule inhibitors on cell proliferation using the IncuCyte ZOOM.
RESUMO
RET (REarranged during Transfection) is a receptor tyrosine kinase, which plays pivotal roles in regulating cell survival, differentiation, proliferation, migration and chemotaxis. Activation of RET is a mechanism of oncogenesis in medullary thyroid carcinomas where both germline and sporadic activating somatic mutations are prevalent. At present, there are no known specific RET inhibitors in clinical development, although many potent inhibitors of RET have been opportunistically identified through selectivity profiling of compounds initially designed to target other tyrosine kinases. Vandetanib and cabozantinib, both multi-kinase inhibitors with RET activity, are approved for use in medullary thyroid carcinoma, but additional pharmacological activities, most notably inhibition of vascular endothelial growth factor - VEGFR2 (KDR), lead to dose-limiting toxicity. The recent identification of RET fusions present in ~1% of lung adenocarcinoma patients has renewed interest in the identification and development of more selective RET inhibitors lacking the toxicities associated with the current treatments. In an earlier publication [Newton et al, 2016; 1] we reported the discovery of a series of 2-substituted phenol quinazolines as potent and selective RET kinase inhibitors. Here we describe the development of the robust screening cascade which allowed the identification and advancement of this chemical series. Furthermore we have profiled a panel of RET-active clinical compounds both to validate the cascade and to confirm that none display a RET-selective target profile.
RESUMO
We have previously reported a series of anilinoquinazoline derivatives as potent and selective biochemical inhibitors of the RET kinase domain. However, these derivatives displayed diminished cellular potency. Herein we describe further optimisation of the series through modification of their physicochemical properties, delivering improvements in cell potency. However, whilst cellular selectivity against key targets could be maintained, combining cell potency and acceptable pharmacokinetics proved challenging.
Assuntos
Compostos de Anilina/farmacologia , Inibidores de Proteínas Quinases/farmacologia , Proteínas Proto-Oncogênicas c-ret/antagonistas & inibidores , Quinazolinas/farmacologia , Compostos de Anilina/síntese química , Compostos de Anilina/química , Relação Dose-Resposta a Droga , Humanos , Modelos Moleculares , Estrutura Molecular , Inibidores de Proteínas Quinases/síntese química , Inibidores de Proteínas Quinases/química , Proteínas Proto-Oncogênicas c-ret/metabolismo , Quinazolinas/síntese química , Quinazolinas/química , Relação Estrutura-AtividadeRESUMO
Deregulation of the receptor tyrosine kinase RET has been implicated in medullary thyroid cancer, a small percentage of lung adenocarcinomas, endocrine-resistant breast cancer and pancreatic cancer. There are several clinically approved multi-kinase inhibitors that target RET as a secondary pharmacology but additional activities, most notably inhibition of KDR, lead to dose-limiting toxicities. There is, therefore, a clinical need for more specific RET kinase inhibitors. Herein we report our efforts towards identifying a potent and selective RET inhibitor using vandetanib 1 as the starting point for structure-based drug design. Phenolic anilinoquinazolines exemplified by 6 showed improved affinities towards RET but, unsurprisingly, suffered from high metabolic clearance. Efforts to mitigate the metabolic liability of the phenol led to the discovery that a flanking substituent not only improved the hepatocyte stability, but could also impart a significant gain in selectivity. This culminated in the identification of 36; a potent RET inhibitor with much improved selectivity against KDR.
Assuntos
Piperidinas/química , Piperidinas/farmacologia , Inibidores de Proteínas Quinases/química , Inibidores de Proteínas Quinases/farmacologia , Proteínas Proto-Oncogênicas c-ret/antagonistas & inibidores , Quinazolinas/química , Quinazolinas/farmacologia , Animais , Linhagem Celular , Desenho de Fármacos , Humanos , Camundongos , Simulação de Acoplamento Molecular , Piperidinas/farmacocinética , Inibidores de Proteínas Quinases/farmacocinética , Proteínas Proto-Oncogênicas c-ret/metabolismo , Quinazolinas/farmacocinéticaRESUMO
Prior studies implicate type 1 IGF receptor (IGF-1R) in mediating chemo-resistance. Here, we investigated whether IGF-1R influences response to temozolomide (TMZ), which generates DNA adducts that are removed by O6-methylguanine-DNA methyltransferase (MGMT), or persist causing replication-associated double-strand breaks (DSBs). Initial assessment in 10 melanoma cell lines revealed that TMZ resistance correlated with MGMT expression (r = 0.79, p = 0.009), and in MGMT-proficient cell lines, with phospho-IGF-1R (r = 0.81, p = 0.038), suggesting that TMZ resistance associates with IGF-1R activation. Next, effects of IGF-1R inhibitors (IGF-1Ri) AZ3801 and linsitinib (OSI-906) were tested on TMZ-sensitivity, cell cycle progression and DSB induction. IGF-1Ri sensitized BRAF wild-type and mutant melanoma cells to TMZ in vitro, an effect that was independent of MGMT. Cells harboring wild-type p53 were more sensitive to IGF-1Ri, and showed schedule-dependent chemo-sensitization that was most effective when IGF-1Ri followed TMZ. This sequence sensitized to clinically-achievable TMZ concentrations and enhanced TMZ-induced apoptosis. Simultaneous or prior IGF-1Ri caused less effective chemo-sensitization, associated with increased G1 population and reduced accumulation of TMZ-induced DSBs. Clinically relevant sequential (TMZ â IGF-1Ri) treatment was tested in mice bearing A375M (V600E BRAF, wild-type p53) melanoma xenografts, achieving peak plasma/tumor IGF-1Ri levels comparable to clinical Cmax, and inducing extensive intratumoral apoptosis. TMZ or IGF-1Ri caused minor inhibition of tumor growth (gradient reduction 13%, 25% respectively), while combination treatment caused supra-additive growth delay (72%) that was significantly different from control (p < 0.01), TMZ (p < 0.01) and IGF-1Ri (p < 0.05) groups. These data highlight the importance of scheduling when combining IGF-1Ri and other targeted agents with drugs that induce replication-associated DNA damage.
Assuntos
Protocolos de Quimioterapia Combinada Antineoplásica/farmacologia , Melanoma/tratamento farmacológico , Receptor IGF Tipo 1/antagonistas & inibidores , Ensaios Antitumorais Modelo de Xenoenxerto , Animais , Apoptose/efeitos dos fármacos , Western Blotting , Linhagem Celular Tumoral , Sobrevivência Celular/efeitos dos fármacos , Quebras de DNA de Cadeia Dupla/efeitos dos fármacos , Dacarbazina/administração & dosagem , Dacarbazina/análogos & derivados , Dacarbazina/farmacologia , Esquema de Medicação , Resistencia a Medicamentos Antineoplásicos/efeitos dos fármacos , Sinergismo Farmacológico , Pontos de Checagem da Fase G1 do Ciclo Celular/efeitos dos fármacos , Humanos , Imidazóis/administração & dosagem , Imidazóis/farmacologia , Melanoma/genética , Melanoma/metabolismo , Camundongos Endogâmicos BALB C , Camundongos Nus , Mutação , Proteínas Proto-Oncogênicas B-raf/genética , Proteínas Proto-Oncogênicas B-raf/metabolismo , Pirazinas/administração & dosagem , Pirazinas/farmacologia , Receptor IGF Tipo 1/metabolismo , Análise de Sobrevida , Temozolomida , Proteína Supressora de Tumor p53/genética , Proteína Supressora de Tumor p53/metabolismoRESUMO
Executive functions (EFs; e.g. working memory, inhibitory control) are mediated by the prefrontal cortex and associated with optimal cognitive and socio-emotional development. This study provides the first concurrent analysis of the relative contributions of maternal EF and caregiving to child EF. A group of children and their mothers (n = 62) completed age-appropriate interaction (10, 24, 36 months) and EF tasks (child: 24, 36, and 48 months). Regression analyses revealed that by 36 months of age, maternal EF and negative caregiving behaviors accounted for unique variance in child EF, above and beyond maternal education and child verbal ability. These findings were confirmed when using an early child EF composite-our most reliable measure of EF - and a similar pattern was found when controlling for stability in child EF. Furthermore, there was evidence that maternal EF had significant indirect effects on changes in child EF through maternal caregiving. At 24 months, EF was associated with maternal EF, but not negative caregiving behaviors. Taken together, these findings suggest that links between negative caregiving and child EF are increasingly manifested during early childhood. Although maternal EF and negative caregiving are related, they provide unique information about the development of child EF. A video abstract of this article can be viewed at http://www.youtube.com/watch?v=NPKXFbbrkps.
Assuntos
Desenvolvimento Infantil , Função Executiva , Comportamento Materno , Cuidadores , Criança , Pré-Escolar , Feminino , Humanos , Lactente , Masculino , Mães/psicologia , Testes NeuropsicológicosRESUMO
Azoxymethane (AOM) is an alkylating agent that generates mutagenic and carcinogenic O(6)-methylguanine (O(6)meG) adducts in DNA. O(6)meG has been detected in human colonic DNA; hence, understanding the innate cellular events occurring in response to the formation of O(6)meG is important in developing preventive strategies for colorectal cancer. We explored the time-course, dose-response, and kinetics of O(6)meG formation and its removal by the DNA repair protein, O(6)-methylguanine DNA methyltransferase (MGMT), and apoptosis. In rats given AOM (10 mg/kg), the formation of O(6)meG occurs within 2 h of exposure, accompanied by rapid depletion of MGMT activity and followed by the induction of an acute apoptotic response that peaks at 6-8 h. MGMT repair and apoptosis are dependent on AOM dose and O(6)meG load. Apoptosis is initiated only when a high O(6)meG load is present and MGMT activity is fully depleted. AOM, 10 mg/kg, overwhelms MGMT repair for about 96 h and renewed MGMT activity is only observed once O(6)meG is no longer detectable. A threshold for apoptosis is observed at 6 h after 6 mg/kg AOM, when a high O(6)meG persists and MGMT activity is very low. These data suggest that apoptosis is probably triggered by O(6)meG, but only once the capacity of MGMT to repair O(6)meG is exhausted. In the colonic epithelium, apoptosis may be complementary to MGMT, in terms of minimising potentially mutagenic events and maintaining a healthy genome.
Assuntos
Apoptose/efeitos dos fármacos , Azoximetano/toxicidade , Colo/efeitos dos fármacos , Guanina/análogos & derivados , O(6)-Metilguanina-DNA Metiltransferase/metabolismo , Animais , Colo/citologia , Colo/metabolismo , Guanina/metabolismo , RatosRESUMO
The recently discovered enzyme tyrosyl-DNA phosphodiesterase 2 (TDP2) has been implicated in the topoisomerase-mediated repair of DNA damage. In the clinical setting, it has been hypothesized that TDP2 may mediate drug resistance to topoisomerase II (topo II) inhibition by etoposide. Therefore, selective pharmacological inhibition of TDP2 is proposed as a novel approach to overcome intrinsic or acquired resistance to topo II-targeted drug therapy. Following a high-throughput screening (HTS) campaign, toxoflavins and deazaflavins were identified as the first reported sub-micromolar and selective inhibitors of this enzyme. Toxoflavin derivatives appeared to exhibit a clear structure-activity relationship (SAR) for TDP2 enzymatic inhibition. However, we observed a key redox liability of this series, and this, alongside early in vitro drug metabolism and pharmacokinetics (DMPK) issues, precluded further exploration. The deazaflavins were developed from a singleton HTS hit. This series showed distinct SAR and did not display redox activity; however low cell permeability proved to be a challenge.
Assuntos
Diester Fosfórico Hidrolases/efeitos dos fármacos , Pirimidinonas/farmacologia , Inibidores da Topoisomerase II/farmacologia , Triazinas/farmacologia , Relação Estrutura-Atividade , Inibidores da Topoisomerase II/químicaRESUMO
BACKGROUND: Tobacco specific nitrosamines such as 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) are genotoxic alkylating agents found within cigarette smoke that induce lung adenocarcinomas in animal models. In humans, adenocarcinomas originate most frequently in the lung periphery. The aim of this study was to determine whether peripheral lung has increased susceptibility to the genotoxic effects of alkylating agents by comparing DNA alkylation damage (N7-methylguanine: N7-meG) and repair (O(6)-alkylguanine DNA alkyltransferase: MGMT) in peripheral relative to central lung tissue. METHODS: Macroscopically normal lung tissue, resected from patients undergoing surgery for lung cancer, was sampled at equidistant points from central to peripheral lung along a bronchus. N7-meG levels were determined using an immunoslotblot technique and MGMT activity with a [32P]-labelled oligodeoxynucleotide cleavage assay. RESULTS: A total of 20 subjects were recruited, 12 males and 8 females with a mean age of 68.7±5.8years. There were 14 former and 6 current smokers with a mean smoking exposure of 34.0±18.3packyears. N7-meG (mean 0.75±0.57/10(6)dG, n=65 samples from 14 patients) and MGMT repair (geometric mean 9.57±1.62fmol/µg DNA, n=79 samples from 16 patients) were detected in all samples assayed. MGMT activity increased towards the lung periphery (r=0.28, p=0.023; n=16) with a highly significant association in current (r=0.53, p=0.008; n=6) but not former smokers (r=0.13; p=0.41; n=10). No correlation was seen with N7-meG levels and lung position (r=-0.18; p=0.21; n=14). N7-meG levels were higher in current compared to former smokers reaching significance in two lung positions including peripheral lung (p=0.047). CONCLUSIONS: The findings in this study do not support the hypothesis that peripheral tissue is more susceptible to the genotoxic effects of alkylating agents than central lung tissue. In addition exposure to cigarette smoke reduced the level of MGMT in central bronchial tissue possibly through increased alkylating agent exposure.
Assuntos
Guanina/análogos & derivados , Neoplasias Pulmonares/enzimologia , Pulmão/enzimologia , O(6)-Metilguanina-DNA Metiltransferase/metabolismo , Idoso , Adutos de DNA/metabolismo , Feminino , Guanina/metabolismo , Humanos , Immunoblotting , Pulmão/química , Pulmão/cirurgia , Neoplasias Pulmonares/química , Masculino , FumarRESUMO
Tyrosyl-DNA phosphodiesterase 1 (Tdp1) catalyzes the hydrolysis of phosphodiester bonds between the DNA 3'-phosphate and tyrosine residues and plays a major role in the repair of stalled topoisomerase I-DNA covalent complexes. Given this role, Tdp1 is of interest as a potential target for anticancer therapy. Inhibiting Tdp1 in combination with clinically used Top1 inhibitors may potentiate the effects of the latter and help to overcome some of the chemoresistance issues currently observed. In addition, Tdp1 can function during DNA repair to remove a variety of other 3' adducts from DNA such as phosphoglycolates and abasic or apurinic/apyrimidinic (AP) sites. Here we describe a new mix-and-read homogeneous fluorogenic assay for the measurement of the AP-site cleavage activity of Tdp1 that is compatible with high-throughput screening. The application of such an assay will open up further avenues for the discovery of novel Tdp1 inhibitors.
Assuntos
Clivagem do DNA , Reparo do DNA , Ensaios Enzimáticos/métodos , Fluorescência , Ensaios de Triagem em Larga Escala/métodos , Diester Fosfórico Hidrolases/química , Humanos , Purinas/química , Pirimidinas/químicaRESUMO
The consumption of red meat is a risk factor in human colorectal cancer (CRC). One hypothesis is that red meat facilitates the nitrosation of bile acid conjugates and amino acids, which rapidly convert to DNA-damaging carcinogens. Indeed, the toxic and mutagenic DNA adduct O(6)-carboxymethylguanine (O(6)-CMG) is frequently present in human DNA, increases in abundance in people with high levels of dietary red meat and may therefore be a causative factor in CRC. Previous reports suggested that O(6)-CMG is not a substrate for the human version of the DNA damage reversal protein O(6)-methylguanine-DNA methyltransferase (MGMT), which protects against the genotoxic effects of other O(6)-alkylguanine lesions by removing alkyl groups from the O(6)-position. We now show that synthetic oligodeoxyribonucleotides containing the known MGMT substrate O(6)-methylguanine (O(6)-MeG) or O(6)-CMG effectively inactivate MGMT in vitro (IC50 0.93 and 1.8 nM, respectively). Inactivation involves the removal of the O(6)-alkyl group and its transfer to the active-site cysteine residue of MGMT. O(6)-CMG is therefore an MGMT substrate, and hence MGMT is likely to be a protective factor in CRC under conditions where O(6)-CMG is a potential causative agent.
Assuntos
Adutos de DNA/metabolismo , Metilases de Modificação do DNA/química , Enzimas Reparadoras do DNA/química , Guanina/análogos & derivados , Guanina/química , Proteínas Supressoras de Tumor/química , Sequência de Bases , Ácidos e Sais Biliares/metabolismo , Ácidos e Sais Biliares/fisiologia , Domínio Catalítico , Neoplasias Colorretais/enzimologia , Adutos de DNA/genética , Metilases de Modificação do DNA/antagonistas & inibidores , Enzimas Reparadoras do DNA/antagonistas & inibidores , Proteínas de Escherichia coli/antagonistas & inibidores , Proteínas de Escherichia coli/química , Proteínas de Ligação ao GTP , Humanos , Proteínas de Membrana , Metiltransferases/antagonistas & inibidores , Metiltransferases/química , Peso Molecular , Oligodesoxirribonucleotídeos/química , Espectrometria de Massas por Ionização e Dessorção a Laser Assistida por Matriz , Proteínas Supressoras de Tumor/antagonistas & inibidoresRESUMO
Sixty-eight 3-year-old children participated in an investigation of inhibitory control (IC). Child IC was measured using various tasks in order to determine the impact on child performance of manipulating task demands. Performance on a nonverbal IC task, but not performance on more difficult motivational or traditional IC tasks, was explained by medial frontal electroencephalographic activity and by language abilities. Because of the unique relations of nonverbal IC with concurrent developmental measures, and because of its potential to predict later social problems, we conclude that it is important to include nonverbal IC measures in investigative IC batteries in early childhood.
Assuntos
Desenvolvimento Infantil/fisiologia , Função Executiva/fisiologia , Lobo Frontal/fisiologia , Individualidade , Inibição Psicológica , Pré-Escolar , Eletroencefalografia , Feminino , Humanos , Desenvolvimento da Linguagem , Masculino , Motivação , Testes Neuropsicológicos , Desenvolvimento da Personalidade , Socialização , TemperamentoRESUMO
Alkyltransferase-like (ATL) proteins in Schizosaccharomyces pombe (Atl1) and Thermus thermophilus (TTHA1564) protect against the adverse effects of DNA alkylation damage by flagging O(6)-alkylguanine lesions for nucleotide excision repair (NER). We show that both ATL proteins bind with high affinity to oligodeoxyribonucleotides containing O(6)-alkylguanines differing in size, polarity, and charge of the alkyl group. However, Atl1 shows a greater ability than TTHA1564 to distinguish between O(6)-alkylguanine and guanine and in an unprecedented mechanism uses Arg69 to probe the electrostatic potential surface of O(6)-alkylguanine, as determined using molecular mechanics calculations. An unexpected consequence of this feature is the recognition of 2,6-diaminopurine and 2-aminopurine, as confirmed in crystal structures of respective Atl1-DNA complexes. O(6)-Alkylguanine and guanine discrimination is diminished for Atl1 R69A and R69F mutants, and S. pombe R69A and R69F mutants are more sensitive toward alkylating agent toxicity, revealing the key role of Arg69 in identifying O(6)-alkylguanines critical for NER recognition.
Assuntos
Alquil e Aril Transferases/química , Reparo do DNA/fisiologia , Guanina/química , Oligodesoxirribonucleotídeos/química , Proteínas de Schizosaccharomyces pombe/química , Schizosaccharomyces/enzimologia , Alquil e Aril Transferases/genética , Alquil e Aril Transferases/metabolismo , Alquilação , Substituição de Aminoácidos , Proteínas de Bactérias/química , Proteínas de Bactérias/genética , Proteínas de Bactérias/metabolismo , Cristalografia por Raios X , Guanina/metabolismo , Mutação de Sentido Incorreto , Oligodesoxirribonucleotídeos/genética , Oligodesoxirribonucleotídeos/metabolismo , Ligação Proteica , Estrutura Terciária de Proteína , Schizosaccharomyces/genética , Proteínas de Schizosaccharomyces pombe/genética , Proteínas de Schizosaccharomyces pombe/metabolismo , Thermus thermophilus/enzimologiaRESUMO
Nucleotide excision repair (NER) has long been known to remove DNA lesions induced by chemical carcinogens, and the molecular mechanism has been partially elucidated. Here we demonstrate that in Schizosaccharomyces pombe a DNA recognition protein, alkyltransferase-like 1 (Atl1), can play a pivotal role in selecting a specific NER pathway, depending on the nature of the DNA modification. The relative ease of dissociation of Atl1 from DNA containing small O(6)-alkylguanines allows accurate completion of global genome repair (GGR), whereas strong Atl1 binding to bulky O(6)-alkylguanines blocks GGR, stalls the transcription machinery, and diverts the damage to transcription-coupled repair. Our findings redraw the initial stages of the NER process in those organisms that express an alkyltransferase-like gene and raise the question of whether or not O(6)-alkylguanine lesions that are poor substrates for the alkyltransferase proteins in higher eukaryotes might, by analogy, signal such lesions for repair by NER.
Assuntos
Alquil e Aril Transferases/metabolismo , Reparo do DNA , Guanina/análogos & derivados , Proteínas de Schizosaccharomyces pombe/metabolismo , Alquil e Aril Transferases/química , Alquil e Aril Transferases/genética , Western Blotting , Cristalografia por Raios X , Dano ao DNA , DNA Fúngico/química , DNA Fúngico/genética , DNA Fúngico/metabolismo , Citometria de Fluxo , Fase G1/efeitos dos fármacos , Genoma Fúngico/genética , Guanina/química , Guanina/metabolismo , Metilnitronitrosoguanidina/toxicidade , Modelos Moleculares , Mutação , Compostos de Nitrosoureia/toxicidade , Conformação de Ácido Nucleico , Ligação Proteica , Estrutura Terciária de Proteína , Schizosaccharomyces/efeitos dos fármacos , Schizosaccharomyces/genética , Schizosaccharomyces/metabolismo , Proteínas de Schizosaccharomyces pombe/química , Proteínas de Schizosaccharomyces pombe/genética , Transcrição Gênica/genéticaRESUMO
O(6)-(carboxymethyl)guanine (O(6)-CMG) and O(6)-(4-oxo-4-(3-pyridyl)butyl)guanine (O(6)-pobG) are toxic lesions formed in DNA following exposure to alkylating agents. O(6)-CMG results from exposure to nitrosated glycine or nitrosated bile acid conjugates and may be associated with diets rich in red meat. O(6)-pobG lesions are derived from alkylating agents found in tobacco smoke. Efficient syntheses of oligodeoxyribonucleotides (ODNs) containing O(6)-CMG and O(6)-pobG are described that involve nucleophilic displacement by the appropriate alcohol on a common synthetic ODN containing the reactive base 2-amino-6-methylsulfonylpurine. ODNs containing O(6)-pobG and O (6)-CMG were found to be good substrates for the S. pombe alkyltransferase-like protein Atl1.
Assuntos
Guanina/análogos & derivados , Oligodesoxirribonucleotídeos/síntese química , Alquil e Aril Transferases/metabolismo , Sequência de Bases , Guanina/química , Oligodesoxirribonucleotídeos/química , Oligodesoxirribonucleotídeos/metabolismoRESUMO
Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n=51) and cancer free controls (n=88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [(32)P]-based oligonucleotide cleavage assay (MPG substrate 5'-CCGCTÉAGCGGGTACCGAGCTCGAAT; ÉA=ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21±1.67 fmol/µg DNA/h vs 3.47±1.35 fmol/µg DNA/h, p=0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.
Assuntos
Adenocarcinoma/enzimologia , Carcinoma de Células Pequenas/enzimologia , Carcinoma de Células Escamosas/enzimologia , DNA Glicosilases/metabolismo , Neoplasias Pulmonares/enzimologia , Idoso , Estudos de Casos e Controles , Clivagem do DNA , Dano ao DNA , DNA Glicosilases/química , Reparo do DNA , Feminino , Humanos , Masculino , Pessoa de Meia-IdadeRESUMO
Mitochondria play critical roles in oxidative phosphorylation and energy metabolism. Increasing evidence supports that mitochondrial DNA (mtDNA) damage and dysfunction play vital roles in the development of many mitochondria-related diseases, such as obesity, diabetes mellitus, infertility, neurodegenerative disorders, and malignant tumors in humans. Human 8-oxoguanine-DNA glycosylase 1 (hOGG1) transgenic (TG) mice were produced by nuclear microinjection. Transgene integration was analyzed by PCR. Transgene expression was measured by RT-PCR and Western blot analysis. Mitochondrial DNA damage was analyzed by mutational analyses and measurement of mtDNA copy number. Total fat content was measured by a whole-body scan using dual-energy X-ray absorptiometry. The hOGG1 overexpression in mitochondria increased the abundance of intracellular free radicals and major deletions in mtDNA. Obesity in hOGG1 TG mice resulted from increased fat content in tissues, produced by hyperphagia. The molecular mechanisms of obesity involved overexpression of genes in the central orexigenic (appetite-stimulating) pathway, peripheral lipogenesis, down-regulation of genes in the central anorexigenic (appetite-suppressing) pathway, peripheral adaptive thermogenesis, and fatty acid oxidation. Diffuse hepatosteatosis, female infertility, and increased frequency of malignant lymphoma were also seen in these hOGG1 TG mice. High levels of hOGG1 expression in mitochondria, resulting in enhanced oxidative DNA damage processing, may be an important factor in human metabolic syndrome, infertility, and malignancy.
Assuntos
DNA Glicosilases/genética , Fígado Gorduroso/patologia , Fígado/patologia , Mitocôndrias/metabolismo , Obesidade/metabolismo , Oxigênio/metabolismo , Animais , Glicemia/metabolismo , Dano ao DNA , DNA Mitocondrial/genética , Feminino , Deleção de Genes , Camundongos , Camundongos Transgênicos , Obesidade/genética , Oxigênio/química , Reação em Cadeia da Polimerase Via Transcriptase ReversaRESUMO
Folate deficiency is implicated in human colon cancer. The effects of feeding rats a folate-deficient diet for 24 weeks on DNA damage (8-oxo-7,8-dihydroguanine), DNA repair [O(6)-methylguanine-DNA methyltransferase (MGMT) and 8-oxoguanine-DNA glycosylase (OGG-1) activity], and epigenetic parameters (genome-wide cytosine methylation and indices of cellular methylation status) were investigated. Relative to control diet, the folate-deficient diet resulted in significantly reduced levels of serum ( approximately 80%; P < 0.0001), whole blood ( approximately 40%; P < 0.0001), and tissue folate (between 25% and 60% depending on the tissue sampled; P < 0.05); increased plasma total homocysteine ( approximately 35%; P < 0.05); and decreased S-adenosylmethionine to S-adenosylhomocysteine concentrations ( approximately 11%; P < 0.05). There was no significant change in the levels of 5-methyldeoxycytidine in liver or colon DNA, nor in the activity of liver DNA cytosine methyltransferase. However, there were significant increases in 8-oxo-7,8-dihydroguanine (P < 0.001) in lymphocyte DNA and in levels of the DNA repair proteins OGG-1 ( approximately 27%; P < 0.03) and MGMT ( approximately 25%; P < 0.003) in the liver, but not in the colon. This may reflect the ability of the liver, but not the colon, to upregulate DNA repair enzymes in response to either elevated DNA damage or an imbalance in the nucleotide precursor pool. These results show that folate deficiency can significantly modulate DNA damage and DNA repair, providing mechanisms by which it plays a role in the etiology of human cancer. We speculate that the inability of colon tissue to respond to folate deficiency occurs in humans and may increase the potential for malignant transformation.
Assuntos
Colo/metabolismo , DNA Glicosilases/biossíntese , Metilação de DNA/fisiologia , Deficiência de Ácido Fólico/metabolismo , Fígado/metabolismo , O(6)-Metilguanina-DNA Metiltransferase/biossíntese , Animais , Dano ao DNA/fisiologia , Reparo do DNA/fisiologia , Masculino , RatosRESUMO
PURPOSE: A major mechanism of resistance to chlorethylnitrosureas and methylating agents involves the DNA repair protein O(6)-methylguanine-DNA methyltransferase (MGMT). We sought to determine the dose of oral 6-(4-bromo-2-thienyl) methoxy purin-2-amine (lomeguatrib), a pseudosubstrate inactivator of MGMT, required to render active protein undetectable 12 hours after dosing in prostate, primary central nervous system (CNS), and colorectal cancer patients. EXPERIMENTAL DESIGN: Lomeguatrib was administered orally as a single dose (20-160 mg) approximately 12 hours before tumor resection. Dose escalation was projected to continue until grade 2 toxicity or until complete inactivation of tumor MGMT was encountered. Total MGMT protein levels were quantified by ELISA, and active protein levels were quantified by biochemical assay. MGMT promoter methylation was determined in glioblastoma DNA by methylation-specific PCR. RESULTS: Thirty-seven patients were dosed with lomeguatrib, and 32 informative tumor samples were obtained. Mean total MGMT level varied between tumor types: 554 +/- 404 fmol/mg protein (+/-SD) for prostate cancer, 87.4 +/- 40.3 fmol/mg protein for CNS tumors, and 244 +/- 181 fmol/mg protein for colorectal cancer. MGMT promoter hypermethylation did not correlate with total protein expression. Consistent total MGMT inactivation required 120 mg of lomeguatrib in prostate and colorectal cancers. Complete consistent inactivation in CNS tumors was observed only at the highest dose of lomeguatrib (160 mg). CONCLUSIONS: Total MGMT inactivation can be achieved in prostate, primary CNS, and colorectal cancers with a single administration of 120 or 160 mg lomeguatrib. The dose needed did not correlate with mean total MGMT protein concentrations. One hundred twenty to 160 mg/d of lomeguatrib should be administered to achieve total MGMT inactivation in future studies.