Metatranscriptome and small RNA sequencing revealed a mixed infection of newly identified bymovirus and bean yellow mosaic virus on peas.

Peas (Pisum sativum L.) are widely cultivated in temperate regions and are susceptible hosts for various viruses across different families. The discovery and identification of new viruses in peas has significant implications for field disease management. Here, we identified a mixed infection of two viruses from field-collected peas exhibiting virus-like symptoms using metatranscriptome and small RNA sequencing techniques. Upon identification, one of the viruses was determined to be a newly isolated and discovered bymovirus from peas, named "pea bymovirus 1 (PBV1)". The other was identified as a novel variant of bean yellow mosaic virus (BYMV-HZ1). Subsequently, mechanical inoculation and RT-PCR assays confirmed that both viruses could be inoculated back onto peas and tobaccos, showing mixed infection by PBV1 and BYMV-HZ1. To our knowledge, this is the first isolation of a bymovirus from pea and the first documented case of mixed infection of peas by PBV1 and BYMV-HZ1 in China.

Salivary proteins potentially derived from horizontal gene transfer are critical for salivary sheath formation and other feeding processes.

Herbivorous insects employ an array of salivary proteins to aid feeding. However, the mechanisms behind the recruitment and evolution of these genes to mediate plant-insect interactions remain poorly understood. Here, we report a potential horizontal gene transfer (HGT) event from bacteria to an ancestral bug of Eutrichophora. The acquired genes subsequently underwent duplications and evolved through co-option. We annotated them as horizontal-transferred, Eutrichophora-specific salivary protein (HESPs) according to their origin and function. In Riptortus pedestris (Coreoidea), all nine HESPs are secreted into plants during feeding. The RpHESP4 to RpHESP8 are recently duplicated and found to be indispensable for salivary sheath formation. Silencing of RpHESP4-8 increases the difficulty of R. pedestris in probing the soybean, and the treated insects display a decreased survivability. Although silencing the other RpHESPs does not affect the salivary sheath formation, negative effects are also observed. In Pyrrhocoris apterus (Pyrrhocoroidea), five out of six PaHESPs are secretory salivary proteins, with PaHESP3 being critical for insect survival. The PaHESP5, while important for insects, no longer functions as a salivary protein. Our results provide insight into the potential origin of insect saliva and shed light on the evolution of salivary proteins.

Two different viral proteins suppress NUCLEAR FACTOR-YC-mediated antiviral immunity during infection in rice.

Plant viruses have multiple strategies to counter and evade the host's antiviral immune response. However, limited research has been conducted on the antiviral defense mechanisms commonly targeted by distinct types of plant viruses. In this study, we discovered that NUCLEAR FACTOR-YC (NF-YC) and NUCLEAR FACTOR-YA (NF-YA), 2 essential components of the NF-Y complex, were commonly targeted by viral proteins encoded by 2 different rice (Oryza sativa L.) viruses, rice stripe virus (RSV, Tenuivirus) and southern rice black streaked dwarf virus (SRBSDV, Fijivirus). In vitro and in vivo experiments showed that OsNF-YCs associate with OsNF-YAs and inhibit their transcriptional activation activity, resulting in the suppression of OsNF-YA-mediated plant susceptibility to rice viruses. Different viral proteins RSV P2 and SRBSDV SP8 directly disrupted the association of OsNF-YCs with OsNF-YAs, thereby suppressing the antiviral defense mediated by OsNF-YCs. These findings suggest an approach for conferring broad-spectrum disease resistance in rice and reveal a common mechanism employed by viral proteins to evade the host's antiviral defense by hindering the antiviral capabilities of OsNF-YCs.

Histone deacetylase OsHDA706 orchestrates rice broad-spectrum antiviral immunity and is impeded by a viral effector.

Lysine acetylation is a dynamic post-translational modification of proteins. Extensive studies have revealed that the acetylation modulated by histone acetyltransferases and histone deacetylases (HDACs) plays a crucial role in regulating protein function. However, there has been limited focus on how HDACs regulate jasmonic acid (JA) biosynthesis in plants. Here, we uncover that the protein stability of OsLOX14, a critical enzyme involved in JA biosynthesis, is regulated by a histone deacetylase, OsHDA706, and is hindered by a viral protein. Our results show that OsHDA706 deacetylates OsLOX14 and enhances the stability of OsLOX14, leading to JA accumulation and an improved broad-spectrum rice antiviral defense. Furthermore, we found that the viral protein P2, encoded by the destructive rice stripe virus, disrupts the association of OsHDA706-OsLOX14, promoting viral infection. Overall, our findings reveal how HDAC manipulates the interplay of deacetylation and protein stability of a JA biosynthetic enzyme to enhance plant antiviral responses.

Occurrence of Watermelon silver mottle virus in Peanut in China.

Watermelon silver mottle virus (WSMoV), a member of the genus Orthotospovirus of the family Bunyaviridae, was first identified in watermelon in Okinawa prefecture, in Japan (Iwaki et al. 1984). Subsequently, it was reported in a variety of solanaceae and cucurbitaceae crops such as tomato, pepper, and watermelon (Jones et al. 2005). WSMoV is naturally transmitted by vector thrips, and cause chlorotic, ring spots, and crinkling in the hosts (Yeh et al. 1992; Jones et al. 2005). So far, no confirmed reports exist regarding the WSMoV infecting peanut (Arachis hypogaea L.). In a field survey conducted in Yunnan Province, China during July 2022, young peanut plants were observed that were severely stunted (Fig. S1A). The leaves of five symptomatic peanut plants were randomly collected and used to identify potential pathogens via high throughput sequencing (HTS) analysis. Total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Approximately 10 µg of total RNA was purified using magnetic beads (Thermo Fischer Scientific, U.S.A.). A TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA) was utilized for constructing the RNA sequencing library and transcriptome sequencing was performed on an Illumina HiSeq4000 platform (LC Sciences, USA) with a paired-end 150 bp manner. After RNA-seq, 35962944 raw reads were generated as paired-end data. Following quality control, a total of 34026806 clean reads were retained and subsequently assembled into contigs using Trinity software (version 2.8.5). The BLASTn analysis showed that three contigs mapped to the L, M, and S RNA segments of the WSMoV isolates, respectively (accession no. AY863200.1; no. AB042650.1; no. U75379.1). The lengths of three contigs were 8913 bp, 4921 bp, and 3558 bp, and the breadth coverage were 99.97%, 100%, and 100%, respectively. The sequences for L, M and S RNA segments of the WSMoV isolate from Yunnan were submitted to NCBI with the accession number OR123869-OR123871. Specific primers were designed for the nucleocapsid protein (NP) on WSMoV S RNA (5'-ATGTCTAACGTTAAGCAGCT-3'; 5'-TTACACTTCTAAGGAGGTGCT-3'; 828 bp) and the RNA-dependent RNA polymerase (RdRP) on WSMoV L RNA (5'-CTATATGTGCAGGGGGCTGG-3'; 5'- ACCCCTCAATTATGCTCGGC -3'; 948 bp) to verify the presence of WSMoV in peanut plants by RT-PCR. The expected PCR products were successfully amplified from each of the symptomatic tested plants, while not in negative controls (Fig. S1, B and C). Furthermore, the extracted total RNA was subjected to small RNA sequencing, and the results showed the detected small RNAs present a major peak at 21 nt and 22 nt (Fig. S1D). This further confirmed the natural infection of WSMoV in stunted peanut plants. RDRP, an important conserved protein in RNA viruses, which is in the L RNA segment of WSMoV, was selected to construct the phylogenetic tree. The results showed that the WSMoV isolate from Yunnan (OR123869) clustered separately from previously reported isolates (Fig. S2). Numerous economically important crops infected with WSMoV in China have experienced severe economic losses (Rao et al. 2011; Tang et al. 2015). Our data has provided the first confirmation of WSMoV naturally infecting peanuts in China, increasing our knowledge of the virus's host range. Further research is needed to determine this virus's specific vectors, the scope of its spread, and its impact on China's peanut production.

Development of Recombinase Polymerase Amplification Combined with Lateral Flow Strips for Rapid Detection of Cowpea Mild Mottle Virus.

Cowpea mild mottle virus (CPMMV) is a global plant virus that poses a threat to the production and quality of legume crops. Early and accurate diagnosis is essential for effective managing CPMMV outbreaks. With the advancement in isothermal recombinase polymerase amplification and lateral flow strips technologies, more rapid and sensitive methods have become available for detecting this pathogen. In this study, we have developed a reverse transcription recombinase polymerase amplification combined with lateral flow strips (RT-RPA-LFS) method for the detection of CPMMV, specifically targeting the CPMMV coat protein (CP) gene. The RT-RPA-LFS assay only requires 20 min at 40°C and demonstrates high specificity. Its detection limit was 10 copies/µl, which is approximately up to 100 times more sensitive than RT-PCR on agarose gel electrophoresis. The developed RT-RPA-LFS method offers a rapid, convenient, and sensitive approach for field detection of CPMMV, which contribute to controlling the spread of the virus.

Alternative splicing impacts the rice stripe virus response transcriptome.

Alternative splicing (AS) is an important form of post transcriptional modification present in both animals and plants. However, little information was obtained about AS events in response to plant virus infection. In this study, we conducted a genome-wide transcriptome analysis on AS change in rice infected by a devastating virus, Rice stripe virus (RSV). KEGG analysis was performed on the differentially expressed (DE) genes and differentially alternative spliced (DAS) genes. The results showed that DE genes were significantly enriched in the pathway of interaction with plant pathogens. The DAS genes were mainly enriched in basal metabolism and RNA splicing pathways. The heat map clustering showed that DEGs clusters were mainly enriched in regulation of transcription and defense response while differential transcript usage (DTU) clusters were strongly enriched in mRNA splicing and calcium binding. Overall, our results provide a fundamental basis for gene-wide AS changes in rice after RSV infection.

Different viral effectors suppress hormone-mediated antiviral immunity of rice coordinated by OsNPR1.

Salicylic acid (SA) and jasmonic acid (JA) are plant hormones that typically act antagonistically in dicotyledonous plants and SA and JA signaling is often manipulated by pathogens. However, in monocotyledonous plants, the detailed SA-JA interplay in response to pathogen invasion remains elusive. Here, we show that different types of viral pathogen can disrupt synergistic antiviral immunity mediated by SA and JA via OsNPR1 in the monocot rice. The P2 protein of rice stripe virus, a negative-stranded RNA virus in the genus Tenuivirus, promotes OsNPR1 degradation by enhancing the association of OsNPR1 and OsCUL3a. OsNPR1 activates JA signaling by disrupting the OsJAZ-OsMYC complex and boosting the transcriptional activation activity of OsMYC2 to cooperatively modulate rice antiviral immunity. Unrelated viral proteins from different rice viruses also interfere with the OsNPR1-mediated SA-JA interplay to facilitate viral pathogenicity, suggesting that this may be a more general strategy in monocot plants. Overall, our findings highlight that distinct viral proteins convergently obstruct JA-SA crosstalk to facilitate viral infection in monocot rice.

A secreted salivary effector from Riptortus pedestris impairs soybean defense through modulating phytohormone signaling pathways.

Riptortus pedestris (Fabricius), one of the major piercing-sucking insects in soybeans, causes delayed plant senescence and abnormal pods, known as staygreen syndrome. Recent research has shown that direct feeding of this insect is the major cause of soybean staygreen syndrome. However, it remains unclear whether R. pedestris salivary proteins play vital roles in insect infestation. Here, we found that 4 secretory salivary proteins can induce cell death in Nicotiana benthamiana by transient heterologous expression. The cell death induced by Rp2155 relies on the nucleotide-binding leucine-rich repeat helper, HSP90. Tissue-specificity assays indicated that Rp2155 is specifically expressed in the salivary gland of R. pedestris and is significantly induced during insect feeding. The expression of salicylic acid (SA)-, jasmonic acid (JA)-related genes was increased in soybean when fed by Rp2155-silenced R. pedestris. More importantly, soybean staygreen symptoms caused by R. pedestris were significantly alleviated when Rp2155 was silenced. Together, these results suggest that the salivary effector Rp2155 is involved in promoting insect infestation by suppressing the JA and SA pathways, and it can be considered as a potential RNA interference target for insect control.

A Rice Receptor-like Protein Negatively Regulates Rice Resistance to Southern Rice Black-Streaked Dwarf Virus Infection.

Plants rely on various receptor-like proteins and receptor-like kinases to recognize and defend against invading pathogens. However, research on the role of receptor-like proteins in plant antiviral defense, particularly in rice-virus interactions, is limited. In this study, we identified a receptor-like gene, OsBAP1, which was significantly induced upon infection with southern rice black-streaked dwarf virus (SRBSDV) infection. A viral inoculation assay showed that the OsBAP1 knockout mutant exhibited enhanced resistance to SRBSDV infection, indicating that OsBAP1 plays a negatively regulated role in rice resistance to viral infection. Transcriptome analysis revealed that the genes involved in plant-pathogen interactions, plant hormone signal transduction, oxidation-reduction reactions, and protein phosphorylation pathways were significantly enriched in OsBAP1 mutant plants (osbap1-cas). Quantitative real-time PCR (RT-qPCR) analysis further demonstrated that some defense-related genes were significantly induced during SRBSDV infection in osbap1-cas mutants. Our findings provide new insights into the role of receptor-like proteins in plant immune signaling pathways, and demonstrate that OsBAP1 negatively regulates rice resistance to SRBSDV infection.

Transcriptome analysis of auxin transcription factor OsARF17-mediated rice stripe mosaic virus response in rice.

Introduction: Plant auxin response factors (ARFs) play an irreplaceable role in regulating the expression of auxin response genes. Our previous studies have indicated that auxin response factor OsARF17 plays a crucial role in plant defense against diverse rice viruses. Methods: Utilizing a comparative transcriptome analysis of Rice stripe mosaic virus (RSMV)-inoculated OsARF17 mutant rice plants, to further elucidate the molecular mechanism of OsARF17 in antiviral defense pathway. Results: KEGG enrichment analyses showed that the down-regulated differentially expressed genes (DEGs) belonged to plant-pathogen interaction and plant hormone signal transduction pathways were markedly enriched in OsARF17 mutants under RSMV inoculation. Furthermore, Gene ontology (GO) analyses revealed that these genes were enriched in a variety of hormone biosynthetic process, including jasmonic acid (JA), auxin, and abscisic acid (ABA). RT-qPCR assays showed that the induction of plant defense-related genes, such as WRKY transcription factors, OsAHT2 and OsDR8, and JA-related genes, were significantly suppressed in OsARF17 mutants in response to RSMV. Discussion: Our study reveals that OsARF17-mediated antiviral immunity may be achieved through affecting the interaction between different phytohormones and regulating defense gene expression in rice. This study provides new insights into the molecular mechanisms of auxin signaling in the rice-virus interaction.

A salivary secretory protein from Riptortus pedestris facilitates pest infestation and soybean staygreen syndrome.

The bean bug (Riptortus pedestris), one of the most important pests of soybean, causes staygreen syndrome, delaying plant maturation and affecting pod development, resulting in severe crop yield loss. However, little is known about the underlying mechanism of this pest. In this study, we found that a salivary secretory protein, Rp614, induced cell death in nonhost Nicotiana benthamiana leaves. NbSGT1 and NbNDR1 are involved in Rp614-induced cell death. Tissue specificity analysis showed that Rp614 is mainly present in salivary glands and is highly induced during pest feeding. RNA interference experiments showed that staygreen syndrome caused by R. pedestris was significantly attenuated when Rp614 was silenced. Together, our results indicate that Rp614 plays an essential role in R. pedestris infestation and provide a promising RNA interference target for pest control.

Transcriptional profiling reveals a critical role of GmFT2a in soybean staygreen syndrome caused by the pest Riptortus pedestris.

Soybean staygreen syndrome, characterized by delayed leaf and stem senescence, abnormal pods, and aborted seeds, has recently become a serious and prominent problem in soybean production. Although the pest Riptortus pedestris has received increasing attention as the possible cause of staygreen syndrome, the mechanism remains unknown. Here, we clarify that direct feeding by R. pedestris, not transmission of a pathogen by this pest, is the primary cause of typical soybean staygreen syndrome and that critical feeding damage occurs at the early pod stage. Transcriptome profiling of soybean indicated that many signal transduction pathways, including photoperiod, hormone, defense response, and photosynthesis, respond to R. pedestris infestation. Importantly, we discovered that members of the FLOWERING LOCUS T (FT) gene family were suppressed by R. pedestris infestation, and overexpression of floral inducer GmFT2a attenuates staygreen symptoms by mediating soybean defense response and photosynthesis. Together, our findings systematically illustrate the association between pest infestation and soybean staygreen syndrome and provide the basis for establishing a targeted soybean pest prevention and control system.

The Characterization of Three Novel Insect-Specific Viruses Discovered in the Bean Bug, Riptortus pedestris.

Insect-specific virus (ISV) is one of the most promising agents for the biological control of insects, which is abundantly distributed in hematophagous insects. However, few ISVs have been reported in Riptortus pedestris (Fabricius), one of the major pests threatening soybeans and causing great losses in yield and quality. In this work, field Riptortus pedestris was collected from six soybean-producing regions in China, and their virome was analyzed with the metatranscriptomic approach. Altogether, seven new insect RNA viruses were identified, three of which had complete RNA-dependent RNA polymerase (RdRp) and nearly full-length genome sequences, which were named Riptortus pedestris alphadrosrha-like virus 1 (RpALv1), Riptortus pedestris alphadrosrha-like virus 2 (RpALv2) and Riptortus pedestris almendra-like virus (RiALv). The three identified novel ISVs belonged to the family Rhabdoviridae, and phylogenetic tree analysis indicated that they were clustered into new distinct clades. Interestingly, the analysis of virus-derived small-interfering RNAs (vsiRNAs) indicated that only RiALv-derived siRNAs exhibited 22 nt length preference, whereas no clear 21 or 22 nt peaks were observed for RpALv1 and RpALv2, suggesting the complexity of siRNA-based antiviral immunity in R. pedestris. In conclusion, this study contributes to a better understanding of the microenvironment in R. pedestris and provides viral information for the development of potential soybean insect-specific biocontrol agents.

Independently evolved viral effectors convergently suppress DELLA protein SLR1-mediated broad-spectrum antiviral immunity in rice.

Plant viruses adopt diverse virulence strategies to inhibit host antiviral defense. However, general antiviral defense directly targeted by different types of plant viruses have rarely been studied. Here, we show that the single rice DELLA protein, SLENDER RICE 1 (SLR1), a master negative regulator in Gibberellin (GA) signaling pathway, is targeted by several different viral effectors for facilitating viral infection. Viral proteins encoded by different types of rice viruses all directly trigger the rapid degradation of SLR1 by promoting association with the GA receptor OsGID1. SLR1-mediated broad-spectrum resistance was subverted by these independently evolved viral proteins, which all interrupted the functional crosstalk between SLR1 and jasmonic acid (JA) signaling. This decline of JA antiviral further created the advantage of viral infection. Our study reveals a common viral counter-defense strategy in which different types of viruses convergently target SLR1-mediated broad-spectrum resistance to benefit viral infection in the monocotyledonous crop rice.

Soybean genetic resources contributing to sustainable protein production.

KEY MESSAGE: Genetic resources contributes to the sustainable protein production in soybean. Soybean is an important crop for food, oil, and forage and is the main source of edible vegetable oil and vegetable protein. It plays an important role in maintaining balanced dietary nutrients for human health. The soybean protein content is a quantitative trait mainly controlled by gene additive effects and is usually negatively correlated with agronomic traits such as the oil content and yield. The selection of soybean varieties with high protein content and high yield to secure sustainable protein production is one of the difficulties in soybean breeding. The abundant genetic variation of soybean germplasm resources is the basis for overcoming the obstacles in breeding for soybean varieties with high yield and high protein content. Soybean has been cultivated for more than 5000 years and has spread from China to other parts of the world. The rich genetic resources play an important role in promoting the sustainable production of soybean protein worldwide. In this paper, the origin and spread of soybean and the current status of soybean production are reviewed; the genetic characteristics of soybean protein and the distribution of resources are expounded based on phenotypes; the discovery of soybean seed protein-related genes as well as transcriptomic, metabolomic, and proteomic studies in soybean are elaborated; the creation and utilization of high-protein germplasm resources are introduced; and the prospect of high-protein soybean breeding is described.

GmIAA27 Encodes an AUX/IAA Protein Involved in Dwarfing and Multi-Branching in Soybean.

Soybean plant height and branching affect plant architecture and yield potential in soybean. In this study, the mutant dmbn was obtained by treating the cultivar Zhongpin 661 with ethylmethane sulfonate. The dmbn mutant plants were shorter and more branched than the wild type. The genetic analysis showed that the mutant trait was controlled by a semi-dominant gene. The candidate gene was fine-mapped to a 91 kb interval on Chromosome 9 by combining BSA-seq and linkage analysis. Sequence analysis revealed that Glyma.09g193000 encoding an Aux/IAA protein (GmIAA27) was mutated from C to T in the second exon of the coding region, resulting to amino acid substitution of proline to leucine. Overexpression of the mutant type of this gene in Arabidopsis thaliana inhibited apical dominance and promoted lateral branch development. Expression analysis of GmIAA27 and auxin response genes revealed that some GH3 genes were induced. GmIAA27 relies on auxin to interact with TIR1, whereas Gmiaa27 cannot interact with TIR1 owing to the mutation in the degron motif. Identification of this unique gene that controls soybean plant height and branch development provides a basis for investigating the mechanisms regulating soybean plant architecture development.

Insights Into the Effect of Rice Stripe Virus P2 on Rice Defense by Comparative Proteomic Analysis.

Rice stripe virus (RSV) has a serious effect on rice production. Our previous research had shown that RSV P2 plays important roles in RSV infection, so in order to further understand the effect of P2 on rice, we used Tandem Mass Tag (TMT) quantitative proteomics experimental system to analyze the changes of protein in transgenic rice expressing P2 for the first time. The results of proteomics showed that a total of 4,767 proteins were identified, including 198 up-regulated proteins and 120 down-regulated proteins. Functional classification results showed that differentially expressed proteins (DEPs) were mainly localized in chloroplasts and mainly involved in the metabolic pathways. Functional enrichment results showed that DEPs are mainly involved in RNA processing and splicing. We also verified the expression of several DEPs at the mRNA level and the interaction of a transcription factor (B7EPB8) with RSV P2. This research is the first time to use proteomics technology to explore the mechanism of RSV infection in rice with the RSV P2 as breakthrough point. Our findings provide valuable information for the study of RSV P2 and RSV infection mechanism.

NF-YA transcription factors suppress jasmonic acid-mediated antiviral defense and facilitate viral infection in rice.

NF-Y transcription factors are known to play many diverse roles in the development and physiological responses of plants but little is known about their role in plant defense. Here, we demonstrate the negative roles of rice NF-YA family genes in antiviral defense against two different plant viruses, Rice stripe virus (RSV, Tenuivirus) and Southern rice black-streaked dwarf virus (SRBSDV, Fijivirus). RSV and SRBSDV both induced the expression of OsNF-YA family genes. Overexpression of OsNF-YAs enhanced rice susceptibility to virus infection, while OsNF-YAs RNAi mutants were more resistant. Transcriptome sequencing showed that the expression of jasmonic acid (JA)-related genes was significantly decreased in plants overexpressing OsNF-YA when they were infected by viruses. qRT-PCR and JA sensitivity assays confirmed that OsNF-YAs play negative roles in regulating the JA pathway. Further experiments showed that OsNF-YAs physically interact with JA signaling transcription factors OsMYC2/3 and interfere with JA signaling by dissociating the OsMYC2/3-OsMED25 complex, which inhibits the transcriptional activation activity of OsMYC2/3. Together, our results reveal that OsNF-YAs broadly inhibit plant antiviral defense by repressing JA signaling pathways, and provide new insight into how OsNF-YAs are directly associated with the JA pathway.