Beet Soil-Borne Virus Is a Helper Virus for the Novel Beta vulgaris Satellite Virus 1A.

Sugar beet (Beta vulgaris) is grown in temperate regions around the world as a source of sucrose used for natural sweetening. Sugar beet is susceptible to a number of viral diseases, but identification of the causal agent(s) under field conditions is often difficult due to mixtures of viruses that may be responsible for disease symptoms. In this study, the application of RNAseq to RNA extracted from diseased sugar beet roots obtained from the field and from greenhouse-reared plants grown in soil infested with the virus disease rhizomania (causal agent beet necrotic yellow vein virus; BNYVV) yielded genome-length sequences from BNYVV, as well as beet soil-borne virus (BSBV). The nucleotide identities of the derived consensus sequence of BSBV RNAs ranged from 99.4 to 96.7% (RNA1), 99.3 to 95.3% (RNA2), and 98.3 to 95.9% (RNA3) compared with published BSBV sequences. Based on the BSBV genome consensus sequence, clones of the genomic RNAs 1, 2, and 3 were obtained to produce RNA copies of the genome through in vitro transcription. Capped RNA produced from the clones was infectious when inoculated into leaves of Chenopodium quinoa and B. vulgaris, and extracts from transcript-infected C. quinoa leaves could infect sugar beet seedling roots through a vortex inoculation method. Subsequent exposure of these infected sugar beet seedling roots to aviruliferous Polymyxa betae, the protist vector of both BNYVV and BSBV, confirmed that BSBV derived from the infectious clones could be transmitted by the vector. Co-inoculation of BSBV synthetic transcripts with transcripts of a cloned putative satellite virus designated Beta vulgaris satellite virus 1A (BvSat1A) resulted in the production of lesions on leaves of C. quinoa similar to those produced by inoculation with BSBV alone. Nevertheless, accumulation of genomic RNA and the encoded protein of the satellite virus in co-inoculated leaves was readily detected on Northern and Western blots, respectively, whereas no accumulation of satellite virus products occurred when satellite virus RNA was inoculated alone. The predicted sequence of the detected protein encoded by BvSat1A bears hallmarks of coat proteins of other satellite viruses, and virions of a size consistent with a satellite virus were observed in samples testing positive for the virus. The results demonstrate that BSBV is a helper virus for the novel satellite virus BvSat1A.

First report of cucurbit yellow stunting disorder virus infecting cucurbit crops in Jamaica.

The increasing prevalence of whitefly-transmitted viruses affecting cucurbit crops has emerged as a significant concern for global cucurbit production. Two of the most widely prevalent threats in the Americas are cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV) (Crinivirus, Closteroviridae). These viruses induce similar foliar symptoms on cucurbit crops (Mondal et al., 2023) leading to loss of photosynthetic capability and decreased yields. Cantaloupe (Cucumis melo), watermelon (Citrullus lanatus), and cucumber (Cucumis sativus) are major cucurbit crops in St. Elizabeth, Jamaica, which is the principal fruit and vegetable producing region of the country. In August 2018, foliar symptoms were observed on cantaloupe, watermelon, and cucumber plants in several commercial farms in St. Elizabeth. These symptoms, mainly on the older leaves, consisted of severe yellowing or interveinal mottle and they appeared more pronounced on cantaloupe and cucumber plants compared to watermelon. Growers noticed the production of smaller than normal fruit. Disease incidence ranged from 10 to 100% and whiteflies (Bemisia tabaci Gennadius) were observed in the fields. To identify virus(es) associated with the disease, six plants (cantaloupe [n = 3], cucumber [n = 1] and watermelon [n = 2) exhibiting symptoms were sampled from four fields for preliminary screening. Total RNA was extracted from leaf tissues as described in Tamang et al. (2021) and samples tested by a multiplex reverse transcription RT-PCR method that targeted the RNA-dependent RNA polymerase (RdRp) of the whitefly transmitted viruses, CYSDV, CCYV, squash vein yellowing virus (SqVYV), and the aphid- transmitted cucurbit aphid-borne yellows virus (CABYV) (Mondal et al. 2023). RT-PCR amplified the expected 494-bp fragment of the CYSDV RdRp gene (Mondal et al., 2023) from two symptomatic plants; one cantaloupe, one cucumber, as well as from CYSDV-infected control plants but not from healthy controls. Further testing was conducted during the June-August 2020 growing season after similar symptoms were observed on additional farms in St. Elizabeth and two regions, Manchester and Clarendon, located to the east of St. Elizabeth. Twenty-one cucurbit leaf samples (11 cantaloupe, seven watermelon and two cucumber from St. Elizabeth and one cantaloupe from Clarendon) exhibiting foliar yellowing progressing from the crown outward, and mottling were collected. Whiteflies (5) from these fields in St. Elizabeth and 20 asymptomatic weed samples were also collected and sent to the USDA-ARS laboratory at Salinas, CA. Total RNA from leaf samples was extracted as described above and tested for CYSDV, CCYV, and CABYV. Total leaf DNA was also extracted (Mondal et al. 2016) and assayed with PCR (Gilbertson 2001) to detect the presence of the whitefly-transmitted cucurbit leaf crumple virus (CuLCrV), a begomovirus, commonly found in the southeastern United States (Gadhave et al., 2018; Keinath et al., 2018). Nineteen of the 21 cucurbit samples tested positive for the presence of CYSDV by RT-PCR (Mondal et al. 2023). Of the 19 CYSDV-positive samples, 13 cantaloupe, one cucumber, and five watermelon samples were singly infected with CYSDV, and one cantaloupe sample was infected with both CYSDV and CABYV. Amplicons of the Jamaica isolate from cantaloupe were sequenced (OR399555) and a 494 nt section of the RdRp gene was found to share 100% sequence identity to the Arizona 1 isolate (EF547827.1). The presence of CYSDV, was further confirmed using a second set of primers that amplified a 394-nt portion of the CYSDV coat protein gene (Polston et al., 2008). Among the weed samples, CABYV was detected in one sample from a Leonotis nepetifolia plant (Lamiaceae) and two Cleome sp. (Capparaceae) collected from St. Elizabeth. None of the crop and weed samples tested positive for CCYV or CuLCrV. DNA from whiteflies was extracted and assayed with PCR using species specific primers (Chen et al. 2016). All whiteflies were identified as B. tabaci cryptic species MEAM1, which is widely known an efficient vector of CYSDV (Berdiales, et al. 1999). This is the first report of CYSDV in Jamaica and its first known occurrence in these hosts within the country. Further monitoring of cucurbit crops and the whitefly vector is warranted to better understand the epidemiology.

Alfalfa vein mottling virus, a novel potyvirid infecting Medicago sativa L.

BACKGROUND: We have recently identified a novel virus detected in alfalfa seed material. The virus was tentatively named alfalfa-associated potyvirus 1, as its genomic fragments bore similarities with potyvirids. In this study, we continued investigating this novel species, expanding information on its genomic features and biological characteristics. METHODS: This research used a wide range of methodology to achieve end results: high throughput sequencing, bioinformatics tools, reverse transcription-polymerase chain reactions, differential diagnostics using indicator plants, virus purification, transmission electron microscopy, and others. RESULTS: In this study, we obtained a complete genome sequence of the virus and classified it as a tentative species in the new genus, most closely related to the members of the genus Ipomovirus in the family Potyviridae. This assumption is based on the genome sequence and structure, phylogenetic relationships, and transmission electron microscopy investigations. We also demonstrated its mechanical transmission to the indicator plant Nicotiana benthamiana and to the natural host Medicago sativa, both of which developed characteristic symptoms therefore suggesting a pathogenic nature of the disease. CONCLUSIONS: Consistent with symptomatology, the virus was renamed to alfalfa vein mottling virus. A name Alvemovirus was proposed for the new genus in the family Potyviridae, of which alfalfa vein mottling virus is a tentative member.

Epidemiology and Management of Plant Viruses Under a Changing Climate.

Plant viruses are an ever-present threat to agricultural production and provide a wide array of symptoms resulting in economic losses throughout the world. Diseases can be transmitted by insect vectors, as well as through pollen, seed, and other means. With the increased globalization of agriculture, the introduction of new viruses from exotic locations and their establishment in new production regions and even new crops is a growing concern. Advancing knowledge of the epidemiology of plant viruses including development of new diagnostic methods, virus surveillance, and modeling, virus ecology and evolution, virus interactions with insect vectors, and other factors are important toward reducing the spread of plant viruses and managing virus diseases.

Differential Seasonal Prevalence of Yellowing Viruses Infecting Melon Crops in Southern California and Arizona Determined by Multiplex RT-PCR and RT-qPCR.

Viruses transmitted by the whitefly (Bemisia tabaci) are an increasing threat to cucurbit production in the southwestern United States and many other cucurbit production regions of the world. The crinivirus cucurbit yellow stunting disorder virus (CYSDV) has severely impacted melon production in California and Arizona since its 2006 introduction to the region. Within the past few years, another crinivirus, cucurbit chlorotic yellows virus (CCYV), and the whitefly-transmitted ipomovirus squash vein yellowing virus (SqVYV) were found infecting melon plants in California's Imperial Valley. CYSDV, CCYV, and an aphid-transmitted polerovirus, cucurbit aphid-borne yellows virus (CABYV), occur together in the region and produce identical yellowing symptoms on cucurbit plants. Mixed infections of these four viruses in the Sonoran Desert and other regions pose challenges for disease management and efforts to develop resistant varieties. A multiplex single-step RT-PCR method was developed that differentiates among these viruses, and this was used to determine the prevalence and distribution of the viruses in melon samples from fields in the Sonoran Desert melon production region of California and Arizona during the spring and fall melon seasons from 2019 through 2021. TaqMan probes were developed, optimized, and applied in a single-step multiplex RT-qPCR to quantify titers of these four viruses in plant samples, which frequently carry mixed infections. Results of the multiplex RT-PCR analysis demonstrated that CYSDV is the predominant virus during the fall, whereas CCYV was by far the most prevalent virus during the spring each year. Multiplex RT-qPCR was used to evaluate differential accumulation and spatiotemporal distribution of viruses within plants and suggested differences in competitive accumulation of CCYV and CYSDV within melon. This study provides the first official report of SqVYV in Arizona and offers an efficient method for virus detection and quantification for breeding and disease management in areas impacted by cucurbit yellowing viruses.

Infection Dynamics of Potato Virus Y Isolate Combinations in Three Potato Cultivars.

The United States potato industry has recently experienced a strain shift; recombinant potato virus Y (PVY) strains (e.g., PVYNTN) have emerged as the predominant strains over the long dominant ordinary strain (PVYO), yet both are often found as single infections within the same field and as mixed infections within individual plants. To understand mixed infection dynamics in potato plants and in daughter tubers, three potato varieties varying for PVY resistance, 'Red Maria', 'CalWhite', and 'Pike', were mechanically inoculated either at the pre- or postflowering stage with all possible heterologous isolate combinations of two PVYO and two PVYNTN isolates. Virus titer was determined from leaves collected at different positions on the plant at different times, and tuber-borne infection was determined for two successive generations. PVYNTN accumulated to higher levels than PVYO at nearly all sampling time points in 'Pike' potato. However, both virus strains accumulated to similar amounts in 'Red Maria' and 'CalWhite' potato early in the infection when inoculated preflowering; however, PVYNTN dominated at later stages and in plants inoculated postflowering. Regardless of inoculation time, both virus strains were transmitted to daughter plants raised from the tubers for most isolate combinations. The relative titer of PVYNTN and PVYO isolates at the later stages of mother plant development was indicative of what was found in the daughter plants. Although virus titer differed among cultivars depending on their genetics and virus isolates, it did not change the strain outcome in tuber-borne infection in subsequent generations. Differential virus accumulation in these cultivars suggests isolate-specific resistance to PVY accumulation.

Modeling and validation of oviposition by a polyphagous insect pest as a function of temperature and host plant species.

Modeling oviposition as a function of female insect age, temperature, and host plant suitability may provide valuable insight into insect population growth of polyphagous insect pests at a landscape level. In this study, we quantified oviposition by beet leafhoppers, Circulifer (= Neoaliturus) tenellus (Baker) (Hemiptera: Cicadellidae), on four common non-agricultural host plant species [Erodium cicutarium (L.) L'Hér. (Geraniaceae), Kochia scoparia (L.) Schrader (Amaranthaceae), Plantago ovata Forsskál (Plantaginaceae), and Salsola tragus L. (Amaranthaceae)] at two constant temperature conditions. Additionally, temperature-based oviposition models for each host plant species were validated, under semi-field and greenhouse conditions. We found that K. scoparia was the most suitable host plant, and optimal temperature for oviposition was estimated to be 30.6°C. Accordingly, beet leafhoppers appear to be well-adapted to high-temperature conditions, so increasing temperatures due to climate change may favor population growth in non-agricultural areas. Maximum total fecundity (Rm) was used as an indicator of relative suitability of host plants. S. tragus has been considered an important non-agricultural host plant, however, we found that S. tragus and E. cicutarium have lower Rm compared to K. scoparia and P. ovata. The combination of detailed experimental oviposition bioassays, modeling, and model validation is considered widely relevant and applicable to host plant assessments and modeling of population dynamics of other polyphagous insect pests.

Insect vector manipulation by a plant virus and simulation modeling of its potential impact on crop infection.

There is widespread evidence of plant viruses manipulating behavior of their insect vectors as a strategy to maximize infection of plants. Often, plant viruses and their insect vectors have multiple potential host plant species, and these may not overlap entirely. Moreover, insect vectors may not prefer plant species to which plant viruses are well-adapted. In such cases, can plant viruses manipulate their insect vectors to preferentially feed and oviposit on plant species, which are suitable for viral propagation but less suitable for themselves? To address this question, we conducted dual- and no-choice feeding studies (number and duration of probing events) and oviposition studies with non-viruliferous and viruliferous [carrying beet curly top virus (BCTV)] beet leafhoppers [Circulifer tenellus (Baker)] on three plant species: barley (Hordeum vulgare L.), ribwort plantain (Plantago lanceolata L.), and tomato (Solanum lycopersicum L.). Barley is not a host of BCTV, whereas ribwort plantain and tomato are susceptible to BCTV infection and develop a symptomless infection and severe curly top symptoms, respectively. Ribwort plantain plants can be used to maintain beet leafhopper colonies for multiple generations (suitable), whereas tomato plants cannot be used to maintain beet leafhopper colonies (unsuitable). Based on dual- and no-choice experiments, we demonstrated that BCTV appears to manipulate probing preference and behavior by beet leafhoppers, whereas there was no significant difference in oviposition preference. Simulation modeling predicted that BCTV infection rates would to be higher in tomato fields with barley compared with ribwort plantain as a trap crop. Simulation model results supported the hypothesis that manipulation of probing preference and behavior may increase BCTV infection in tomato fields. Results presented were based on the BCTV-beet leafhopper pathosystem, but the approach taken (combination of experimental studies with complementary simulation modeling) is widely applicable and relevant to other insect-vectored plant pathogen systems involving multiple plant species.

First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Arizona and Southern Desert Regions of California.

Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.

Optimizing Efficient RNAi-Mediated Control of Hemipteran Pests (Psyllids, Leafhoppers, Whitefly): Modified Pyrimidines in dsRNA Triggers.

The advantages from exogenously applied RNAi biopesticides have yet to be realized in through commercialization due to inconsistent activity of the dsRNA trigger, and the activity level of RNAi suppression. This has prompted research on improving delivery methods for applying exogenous dsRNA into plants and insects for the management of pests and pathogens. Another aspect to improve RNAi activity is the incorporation of modified 2'-F pyrimidine nucleotides into the dsRNA trigger. Modified dsRNA incorporating 32-55% of the 2'-F- nucleotides produced improved RNAi activity that increased insect mortality by 12-35% greater than non-modified dsRNA triggers of the same sequence. These results were repeatable across multiple Hemiptera: the Asian citrus psyllid (Diaphorina citri, Liviidae); whitefly (Bemisia tabaci, Aleyroididae); and the glassy-winged sharpshooter (Homalodisca vitripennis, Cicadellidae). Studies using siRNA with modified 2'-F- pyrimidines in mammalian cells show they improved resistance to degradation from nucleases, plus result in greater RNAi activity, due to increase concentrations and improved binding affinity to the mRNA target. Successful RNAi biopesticides of the future will be able to increase RNAi repeatability in the field, by incorporating modifications of the dsRNA, such as 2'-F- pyrimidines, that will improve delivery after applied to fruit trees or crop plants, with increased activity after ingestion by insects. Costs of RNA modification have decreased significantly over the past few years such that biopesticides can now compete on pricing with commercial chemical products.

Virus and helper component interactions favour the transmission of recombinant potato virus Y strains.

In recent years, several recombinant strains of potato virus Y, notably PVYNTN and PVYN:O have displaced the ordinary strain, PVYO, and emerged as the predominant strains affecting the USA potato crop. Previously we reported that recombinant strains were transmitted more efficiently than PVYO when they were acquired sequentially, regardless of acquisition order. In another recent study, we showed that PVYNTN binds preferentially to the aphid stylet over PVYO when aphids feed on a mixture of PVYO and PVYNTN. To understand the mechanism of this transmission bias as well as preferential virus binding, we separated virus and active helper component proteins (HC), mixed them in homologous and heterologous combinations, and then fed them to aphids using Parafilm sachets. Mixtures of PVYO HC with either PVYN:O or PVYNTN resulted in efficient transmission. PVYN:O HC also facilitated the transmission of PVYO and PVYNTN, albeit with reduced efficiency. PVYNTN HC failed to facilitate transmission of either PVYO or PVYN:O. When PVYO HC or PVYN:O HC was mixed with equal amounts of the two viruses, both viruses in all combinations were transmitted at high efficiencies. In contrast, no transmission occurred when combinations of viruses were mixed with PVYNTN HC. Further study evaluated transmission using serial dilutions of purified virus mixed with HCs. While PVYNTN HC only facilitated the transmission of the homologous virus, the HCs of PVYO and PVYN:O facilitated the transmission of all strains tested. This phenomenon has likely contributed to the increase in the recombinant strains affecting the USA potato crop.

High Throughput Sequencing-Aided Survey Reveals Widespread Mixed Infections of Whitefly-Transmitted Viruses in Cucurbits in Georgia, USA.

Viruses transmitted by the sweet potato whitefly (Bemisia tabaci) have been detrimental to the sustainable production of cucurbits in the southeastern USA. Surveys were conducted in the fall of 2019 and 2020 in Georgia, a major cucurbit-producing state of the USA, to identify the viruses infecting cucurbits and their distribution. Symptomatic samples were collected and small RNA libraries were prepared and sequenced from three cantaloupes, four cucumbers, and two yellow squash samples. An analysis of the sequences revealed the presence of the criniviruses cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and the begomovirus cucurbit leaf crumple virus (CuLCrV). CuLCrV was detected in 76%, CCYV in 60%, and CYSDV in 43% of the total samples (n = 820) tested. The level of mixed infections was high in all the cucurbits, with most plants tested being infected with at least two of these viruses. Near-complete genome sequences of two criniviruses, CCYV and CYSDV, were assembled from the small RNA sequences. An analysis of the coding regions showed low genetic variability among isolates from different hosts. In phylogenetic analysis, the CCYV isolates from Georgia clustered with Asian isolates, while CYSDV isolates clustered with European and USA isolates. This work enhances our understanding of the distribution of viruses on cucurbits in South Georgia and will be useful to develop strategies for managing the complex of whitefly-transmitted viruses in the region.

First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in melon in the Central Valley of California.

In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus, fam. Closteroviridae, have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, fam. Luteoviridae) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies (B. tabaci) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F - 5' AAGAGCGGCAGCTACAATAC 3', CABYV RdRp-R - 5' TGCCACATTCCGGTTCATAG 3'), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.

First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in squash (Cucurbita pepo) in Georgia.

Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.

First report of cucurbit chlorotic yellows virus infecting cucumber in South Korea.

In October 2018, cucumber plants showing yellowing and chlorotic mottle symptoms were observed in a greenhouse in Chungbuk, South Korea. The observed symptoms were similar to those caused by cucurbit aphid-borne yellows virus (CABYV), which has been detected on cucumber plants in the region since it was reported on melon in Korea in 2015 (Lee et al 2015). To identify the potential agents causing these symptoms, 28 samples from symptomatic leaves and fruit of cucumber plants were subjected to total RNA extraction using the Plant RNA Prep Kit (Biocubesystem, Korea). Reverse transcription polymerase chain (RT-PCR) was performed on total RNA using CABYV specific primers and protocols (Kwak et al. 2018). CABYV was detected in 17 of the 28 samples, while 11 symptomatic samples tested negative. In order to identify the cause of the symptoms, RT-PCR was performed using cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) specific primers (Wintermantel et al. 2019). Eight of the 28 samples were positive using the CCYV specific primers while seven samples were infected with only CCYV and one contained a mixed infection of CABYV with CCYV. None of the samples tested positive for CYSDV. The expected 373 nt amplicons of CCYV were bi-directionally sequenced, and BLASTn analysis showed that the nucleotide sequences shared 98 to 100% identity with CCYV isolates from East Asia, including NC0180174 from Japan. Two pairs of primers for amplification of the complete coat protein and RNA-dependent RNA polymerase (RdRp) genes (Wintermantel et al., 2019) were used to amplify the 753bp coat protein and 1517bp RdRp genes, respectively. Amplicons of the expected sizes were obtained from a CCYV single infection and ligated into the pGEM T- Easy vector (Promega, WI, USA). Three clones from each amplicon were sequenced and aligned using Geneious Prime and found to have identical sequences (Genbank accession nos. MW033300, MW033301). The CP and RdRp sequences demonstrated 99% nucleotide and 100% amino acid identity with the respective genes and proteins of the CCYV isolates from Japan. This study documents the first report of CCYV in Korea. Since CCYV was first detected on melon in Japan, it has been reported in many other countries including those in East Asia, the Middle East, Southern Europe, North Africa, and recently in North America. CCYV has the potential to become a serious threat to production of cucurbit crops in Korea, particularly due to the increasing prevalence of the whitefly, Bemisia tabaci, in greenhouse production systems. It will be important to continue monitoring for CCYV and determine potential alternate hosts in the region to manage and prevent further spread of CCYV in Korea.

Natural Infection Rate of Known Tomato chlorosis virus-Susceptible Hosts and the Influence of the Host Plant on the Virus Relationship With Bemisia tabaci MEAM1.

Tomato chlorosis virus (ToCV; genus Crinivirus, family Closteroviridae) was identified in tomato crops in São Paulo State, Brazil, in 2006. Management strategies to control external sources of inoculum are necessary, because chemical control of the whitefly vector Bemisia tabaci Middle East-Asia Minor 1 (MEAM1) has not efficiently prevented virus infections and no commercial tomato varieties or hybrids are resistant to this crinivirus. We first evaluated the natural infection rate of some known wild and cultivated ToCV-susceptible hosts and their attractiveness for B. tabaci MEAM1 oviposition. Physalis angulata was the most susceptible to natural infection in all six exposures in 2018 and 2019. No plants of Capsicum annuum 'Dahra' or Chenopodium album became infected. Solanum melongena 'Napoli' had only two infected plants of 60 exposed. Capsicum annuum and Chenopodium album were the least preferred, and Nicotiana tabacum and S. melongena were the most preferred for whitefly oviposition. In addition, from 2016 to 2019, we surveyed different tomato crops and the surrounding vegetation to identify ToCV in weeds and cultivated plants in the region of Sumaré, São Paulo State. Only S. americanum, vila vila (S. sisymbriifolium), and Chenopodium album were found naturally infected, with incidences of 18, 20, and 1.4%, respectively. Finally, we estimated the ToCV titer (U.S. and Brazilian isolates ToCV-FL and ToCV-SP, respectively) by quantitative reverse transcription PCR in different ToCV-susceptible host plants and evaluated the relationship between virus acquisition and transmission by B. tabaci MEAM1. The results clearly showed significant differences in ToCV concentrations in the tissues of ToCV-susceptible host plants, which appeared to be influenced by the virus isolate. The concentration of the virus in plant tissues, in turn, directly influenced the ToCV-B. tabaci MEAM1 relationship and subsequent transmission to tomato plants. To minimize or prevent damage from tomato yellowing disease through management of external sources of ToCV, it is necessary to correctly identify potentially important ToCV-susceptible hosts in the vicinity of new plantings.

Differences in gene expression in whitefly associated with CYSDV-infected and virus-free melon, and comparison with expression in whiteflies fed on ToCV- and TYLCV-infected tomato.

BACKGROUND: Cucurbit yellow stunting disorder virus (CYSDV; genus Crinivirus, Closteroviridae) is transmitted in a semipersistent manner by the whitefly, Bemisia tabaci, and is efficiently transmitted by the widely prevalent B. tabaci cryptic species, MEAM1. In this study, we compared transcriptome profiles of B. tabaci MEAM1, after 24 h, 72 h and 7 days of acquisition feeding on melon plants infected with CYSDV (CYSDV-whiteflies) with those fed on virus-free melon, using RNA-Seq technology. We also compared transcriptome profiles with whiteflies fed on tomato plants separately infected with Tomato chlorosis virus (ToCV), a crinivirus closely related to CYSDV, and Tomato yellow leaf curl virus (TYLCV), a member of the genus Begomovirus, which has a distinctly different mode of transmission and their respective virus-free controls, to find common gene expression changes among viruliferous whiteflies feeding on different host plants infected with distinct (TYLCV) and related (CYSDV and ToCV) viruses. RESULTS: A total of 275 differentially expressed genes (DEGs) were identified in CYSDV-whiteflies, with 3 DEGs at 24 h, 221 DEGs at 72 h, and 51 DEGs at 7 days of virus acquisition. Changes in genes encoding orphan genes (54 genes), phosphatidylethanolamine-binding proteins (PEBP) (20 genes), and AAA-ATPase domain containing proteins (10 genes) were associated with the 72 h time point. Several more orphan genes (20 genes) were differentially expressed at 7 days. A total of 59 common DEGs were found between CYSDV-whiteflies and ToCV-whiteflies, which included 20 orphan genes and 6 lysosomal genes. A comparison of DEGs across the three different virus-host systems revealed 14 common DEGs, among which, eight showed similar and significant up-regulation in CYSDV-whiteflies at 72 h and TYLCV-whiteflies at 24 h, while down-regulation of the same genes was observed in ToCV-whiteflies at 72 h. CONCLUSIONS: Dynamic gene expression changes occurred in CYSDV-whiteflies after 72 h feeding, with decreased gene expression changes associated with 7 days of CYSDV acquisition. Similarities in gene expression changes among CYSDV-whiteflies, ToCV-whiteflies and TYLCV-whiteflies suggest the possible involvement of common genes or pathways for virus acquisition and transmission by whiteflies, even for viruses with distinctly different modes of transmission.

Genome of the African cassava whitefly Bemisia tabaci and distribution and genetic diversity of cassava-colonizing whiteflies in Africa.

The whitefy Bemisia tabaci, a species complex consisting of many morphologically indistinguishable species divided into distinct clades, is one of the most globally important agricultural pests and plant virus vectors. Cassava-colonizing B. tabaci transmits viruses that cause cassava mosaic disease (CMD) and cassava brown streak disease (CBSD). Half of all cassava plants in Africa are affected by these viral diseases, resulting in annual production losses of more than US$ 1 billion. Here we report the draft genome of the cassava whitefly B. tabaci Sub-Saharan Africa - East and Central Africa (SSA-ECA), the super-abundant population that has been associated with the rapid spread of viruses causing the pandemics of CMD and CBSD. The SSA-ECA genome assembled from Illumina short reads has a total size of 513.7 Mb and a scaffold N50 length of 497 kb, and contains 15,084 predicted protein-coding genes. Phylogenetic analysis suggests that SSA-ECA diverged from MEAM1 around 5.26 million years ago. A comprehensive genetic analysis of cassava-colonizing B. tabaci in Africa was also conducted, in which a total of 243 whitefly specimens were collected from 18 countries representing all major cassava-growing regions in the continent and genotyped using NextRAD sequencing. Population genomic analyses confirmed the existence of six major populations linked by gene flow and inferred the distribution patterns of these populations across the African continent. The genome of SSA-ECA and the genetic findings provide valuable resources and guidance to facilitate whitefly research and the development of strategies to control cassava viral diseases spread by whiteflies.

Expanding Knowledge of the Host Range of Tomato chlorosis virus and Host Plant Preference of Bemisia tabaci MEAM1.

The crinivirus Tomato chlorosis virus (ToCV) is often found infecting tomato crops in Brazil, with variable incidence, but associated with prevalence of its primary vector, Bemisia tabaci MEAM1. ToCV control is difficult because there are no resistant commercial tomato varieties or hybrids available and chemical spray for control of the whitefly vector has not been effective. The present study evaluated the partial host range of a Brazilian isolate of ToCV and the preference of B. tabaci MEAM1 for oviposition on those species identified as susceptible to the virus. Subsequently, transmission tests were performed using plants of each ToCV host species as sources of inoculum to elucidate the epidemiological importance of nontomato sources of inoculum for infection of tomato. Among 80 species experimentally inoculated, 25 were susceptible, including 6 previously not known to be hosts (Jaltomata procumbens, Physalis pruinosa, Solanum aculeatissimum, S. viarum, Beta vulgaris var. cicla, and Chenopodium quinoa). Preference of whitefly for oviposition and infection by ToCV under free-choice transmission tests varied among the susceptible species. When ToCV-infected tomato, eggplant, and C. quinoa were used separately as sources of inoculum for virus transmission to tomato plants, mean percentages of infected plants were 76.6, 3, and 0%, respectively. Average oviposition of Bemisia tabaci on these three hosts were 2.7, 10.6, and 0.0 eggs/cm2, respectively. Additional studies will be necessary to evaluate the importance of ToCV host plants under field conditions and their efficiency as sources of inoculum for virus acquisition and transmission to tomato crops.

Integration of Omics Approaches toward Understanding Whitefly Transmission of Viruses.

Viruses transmitted by whiteflies are predominantly classified as having either persistent circulative or semipersistent transmission, and the majority of studies have addressed transmission of viruses in the genera Begomovirus (family Geminiviridae) and Crinivirus (family Closteroviridae), respectively. Early studies on vector transmission primarily addressed individual aspects of transmission; however, with the breadth of new technology now available, an increasingly greater number of studies involve coordinated research that is beginning to assemble a more complete picture of how whiteflies and viruses have coevolved to facilitate transmission. In particular the integration of gene expression and metabolomic studies into broader research topics is providing knowledge of changes within the whitefly vector in response to the presence of viruses that would have been impossible to identify previously. Examples include comparative studies on the response of Bemisia tabaci to begomovirus and crinivirus infection of common host plants, evolution of whitefly endosymbiont relationships, and opportunities to evaluate responses to specific transmission-related events. Integration of metabolomics, as well as the application of electrical penetration graphing, can lead to an ability to monitor the changes that occur in vector insects associated with specific aspects of virus transmission. Through gaining more complete knowledge of the mechanisms behind whitefly transmission of viruses new control strategies will undoubtedly emerge for control of whiteflies and the viruses they transmit.