The first discovery of Polypedatesteraiensis (Dubois, 1987) (Rhacophoridae, Anura) in China.

Background: The genus of Polypedates Tschudi, 1838 currently comprises 25 recognised species with four of these species reported in Yunnan, China. Dubois (1987) speculated the distribution of P.teraiensis in China; however, there was no study carried out to confirm its distribution in the region. New information: We herein describe P.teraiensis as a new national record, based on a specimen collected from Yunnan border region. Phylogenetically, our sequence clustered with the sequences of recognised P.teraiensis specimens from Bangladesh, Myanmar and India. The uncorrected pairwise distances between the specimens from China and other P.teraiensis localities was small, ranging from 0.0-0.7%, based on 16S rRNA gene. Therefore, we report P.teraiensis as a new species record for China.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

[Apoptosis mechanism of taxol combined with resveratrol on human laryngeal carcinoma Hep-2 cells].

Laryngeal cancer is one of the most common malignant tumors in the respiratory tumors, and its incidence ranks second highest in the respiratory tumors. Resveratrol (Res) is a kind of polyphenols, which can inhibit nucleotides can inhibit the growth of liver cancer cells, gastric cancer cells, pancreatic cells and other tumor cells by inhibiting ribonucleotide reductase in the cells. Taxol (Tax) is a kind of secondary metabolites of Taxus chinensis, which has anti-tumor activity for breast cancer, cervical cancer, ovarian cancer and other tumors by inhibiting cellular microtubule depolymerization. But at present the effects of resveratrol combined with taxol on human laryngeal carcinoma cell strain Hep-2 and their underlying molecular mechanisms are rarely reported. After human laryngeal cancer cell Hep-2 cells were processed with resveratrol (Res) and taxol (Tax), CCK-8 assay was used to evaluate the effect of these two herbs on the proliferation of cancer cells; AO/PI staining and JC-1 were used to detect Hep-1 cells apoptosis; the expression of Bax, Bcl-2, PARP, TRIB3, and XIAP genes was detected by real time quantitative PCR; the activity of caspase-3 and caspase-8 was determined with quantitative fluorescence method. The experimental results showed that compared with Tax, Res medication alone, joint group significantly enhanced inhibition of Hep-2 cells activity, decreased the dosage of Tax, increased the expression of Bax and PARP, TRIB3, reduced the expression of the Bcl-2 and XIAP, and promoted the activity of caspase-3 and caspase-8. The test results showed that compared with the single medication, combined group could significantly increase the inhibitory effect on Hep-2 cells, significantly reduce Tax dosage, increase expressions of Bax, PARP, TRIB3, reduce expressions of Bcl-2, XIAP, and promote activity of caspase-3, caspase-8. This indicated apoptosis of human laryngeal carcinoma cell strain Hep-2 may be induced with Res, Tax, and the combination of these two herbs by mitochondria pathway. It provides valuable clue for further research on combination of Res and Tax for the treatment of laryngeal cancer, and expanding the combined application of Res and Tax.

[Effect of celastrol in inhibiting metastasis of lung cancer cells by influencing Akt signaling pathway and expressing integrins].

Celastrol is a type of quinone methyl triterpene isolated from traditional Chinese medicine Tripterygium wilfordii, with pharmacological activities, like anti-inflammatory, immunosuppression and anti-tumor. This study focused on the effects of celastrol on adhesion, migration and invasion of lung cancer cells. The migration inhibition of lung cancer cells induced by celastrol was detected by the scratch test. The invasion inhibition of lung cancer cells induced by celastrol was measured by the transwell experiment. RT-PCR and Western blot were used to determine the effect of different concentrations of celastrol in integrin family and Akt signaling pathway in lung cancer cells. The results showed that celastrol inhibited adhesion, migration and invasion of lung cancer cells and expressions of integrins ß3, ß4, αv and phosphorylated Akt, GSK-3ß, c-Raf, PDK1 in Akt signal pathway in a dose-dependent manner. Therefore, the study implies that Celastrol could inhibit the metastasis of lung cancer cells by suppressing Akt signaling pathway and expression of integrins.

[Anti-metastasis of celastrol on esophageal cancer cells and its mechanism].

Celastrol is a quinone methyl terpene extracted from the traditional Chinese medicine Tripterygium wilfordii, which has anti-inflammatory, immune suppression and pharmacological activities, as well as anti-tumor activity. The effects of celastrol on adhesion, migration and invasion of esophageal cancer cells were investigated in this experiment. Human esophageal cancer cell line ECA-109 was used. The inhibition of ECA-109 cells' adhesion induced by celastrol was measured by MTT test. The inhibition of ECA-109 cells' migration induced by celastrol was measured by scratch test. The invasion inhibition of ECA-109 cells induced by celastrol was measured by Transwell experiment. Quantitative real-time PCR and Western blot were used to determine the effects of different concentrations of celastrol on integrin family and Wnt signaling pathway in ECA-109 cells. The results showed that celastrol inhibited adhesion, migration and invasion of ECA-109 cells and expressions of integrins ß1, ß4, αv and ß-Catenin, LRP6 in Wnt signal pathway in a dose-dependent manner. Therefore the study suggests that celastrol could inhibit the cell metastasis of esophageal cancer by inhibiting the Wnt signaling pathway and the expressions of integrins.