Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 111
Filtrar
1.
J Neuroinflammation ; 21(1): 125, 2024 May 10.
Artigo em Inglês | MEDLINE | ID: mdl-38730470

RESUMO

BACKGROUND: Understanding the molecular mechanisms of Alzheimer's disease (AD) has important clinical implications for guiding therapy. Impaired amyloid beta (Aß) clearance is critical in the pathogenesis of sporadic AD, and blood monocytes play an important role in Aß clearance in the periphery. However, the mechanism underlying the defective phagocytosis of Aß by monocytes in AD remains unclear. METHODS: Initially, we collected whole blood samples from sporadic AD patients and isolated the monocytes for RNA sequencing analysis. By establishing APP/PS1 transgenic model mice with monocyte-specific cystatin F overexpression, we assessed the influence of monocyte-derived cystatin F on AD development. We further used a nondenaturing gel to identify the structure of the secreted cystatin F in plasma. Flow cytometry, enzyme-linked immunosorbent assays and laser scanning confocal microscopy were used to analyse the internalization of Aß by monocytes. Pull down assays, bimolecular fluorescence complementation assays and total internal reflection fluorescence microscopy were used to determine the interactions and potential interactional amino acids between the cystatin F protein and Aß. Finally, the cystatin F protein was purified and injected via the tail vein into 5XFAD mice to assess AD pathology. RESULTS: Our results demonstrated that the expression of the cystatin F protein was specifically increased in the monocytes of AD patients. Monocyte-derived cystatin F increased Aß deposition and exacerbated cognitive deficits in APP/PS1 mice. Furthermore, secreted cystatin F in the plasma of AD patients has a dimeric structure that is closely related to clinical signs of AD. Moreover, we noted that the cystatin F dimer blocks the phagocytosis of Aß by monocytes. Mechanistically, the cystatin F dimer physically interacts with Aß to inhibit its recognition and internalization by monocytes through certain amino acid interactions between the cystatin F dimer and Aß. We found that high levels of the cystatin F dimer protein in blood contributed to amyloid pathology and cognitive deficits as a risk factor in 5XFAD mice. CONCLUSIONS: Our findings highlight that the cystatin F dimer plays a crucial role in regulating Aß metabolism via its peripheral clearance pathway, providing us with a potential biomarker for diagnosis and potential target for therapeutic intervention.


Assuntos
Doença de Alzheimer , Peptídeos beta-Amiloides , Camundongos Transgênicos , Monócitos , Doença de Alzheimer/metabolismo , Doença de Alzheimer/patologia , Animais , Monócitos/metabolismo , Camundongos , Humanos , Peptídeos beta-Amiloides/metabolismo , Masculino , Feminino , Disfunção Cognitiva/metabolismo , Disfunção Cognitiva/patologia , Idoso , Cistatinas/metabolismo , Cistatinas/genética , Precursor de Proteína beta-Amiloide/genética , Precursor de Proteína beta-Amiloide/metabolismo , Idoso de 80 Anos ou mais , Camundongos Endogâmicos C57BL
2.
Neurobiol Dis ; 195: 106497, 2024 Jun 01.
Artigo em Inglês | MEDLINE | ID: mdl-38583641

RESUMO

OBJECTIVES: To elucidate and compare the genetic, clinical, ancillary diagnostic, and pathological characteristics across different Gerstmann-Sträussler-Scheinker disease (GSS) phenotypes and explore the underlying causes of the phenotypic heterogeneities. METHODS: The genetic, clinical, ancillary diagnostic, and pathological profiles of GSS patients reported in the literature were obtained and analyzed. Additionally, 3 patients with genetically confirmed GSS from our unit were included. Based on clinical presentation, patients were classified into typical GSS, Creutzfeldt-Jakob disease (CJD)-like GSS, GSS with dementia, and other categories. RESULTS: A total of 329 GSS cases were included with a 1.13:1 female-to-male ratio, median onset age 44, and median duration 4 years. Of the 294 categorized patients, 50.7% had typical GSS, 24.8% showed CJD-like GSS, and 16.3% presented with GSS with dementia. Clinical classification varied significantly based on genotype, with P102L more common in typical GSS and A117V prevalent in CJD-like GSS. Polymorphism at codon 129 has no effect on GSS phenotype, but the 129 M allele acts as a protective factor in GSS patients in Asia and North America. Moderate to severe spongiform degeneration and the presence of PK-resistant small fragments migrating at <11 kDa on electrophoretic gels along with PrP27-30 fragments were more prevalent in CJD-like GSS phenotype, while hyperphosphorylated tau protein co-deposition tends to be characteristic of typical GSS and GSS with dementia. CONCLUSION: This study reveals GSS's intricate nature, showing significant variations in clinical presentations, diagnostic findings, and pathological features. Mutation sites and pathological changes play crucial roles in determining the GSS clinical heterogeneity.


Assuntos
Doença de Gerstmann-Straussler-Scheinker , Fenótipo , Humanos , Doença de Gerstmann-Straussler-Scheinker/genética , Doença de Gerstmann-Straussler-Scheinker/patologia , Masculino , Feminino , Pessoa de Meia-Idade , Adulto , Idoso
3.
Alzheimers Res Ther ; 16(1): 72, 2024 Apr 05.
Artigo em Inglês | MEDLINE | ID: mdl-38581060

RESUMO

BACKGROUND: Vascular dysfunction was recently reported to be involved in the pathophysiological process of neurodegenerative diseases, but its role in sporadic behavioral variant frontotemporal dementia (bvFTD) remains unclear. The aim of this study was to systematically explore vascular dysfunction, including changes in white matter hyperintensities (WMHs) and peripheral vascular markers in bvFTD. METHODS: Thirty-two patients with bvFTD who with no vascular risk factors were enrolled in this cross-sectional study and assessed using positron emission tomography/magnetic resonance (PET/MRI) imaging, peripheral plasma vascular/inflammation markers, and neuropsychological examinations. Group differences were tested using Student's t-tests and Mann-Whitney U tests. A partial correlation analysis was implemented to explore the association between peripheral vascular markers, neuroimaging, and clinical measures. RESULTS: WMH was mainly distributed in anterior brain regions. All peripheral vascular factors including matrix metalloproteinases-1 (MMP-1), MMP-3, osteopontin, and pentraxin-3 were increased in the bvFTD group. WMH was associated with the peripheral vascular factor pentraxin-3. The plasma level of MMP-1 was negatively correlated with the gray matter metabolism of the frontal, temporal, insula, and basal ganglia brain regions. The WMHs in the frontal and limbic lobes were associated with plasma inflammation markers, disease severity, executive function, and behavior abnormality. Peripheral vascular markers were associated with the plasma inflammation markers. CONCLUSIONS: WMHs and abnormalities in peripheral vascular markers were found in patients with bvFTD. These were found to be associated with the disease-specific pattern of neurodegeneration, indicating that vascular dysfunction may be involved in the pathogenesis of bvFTD. This warrants further confirmation by postmortem autopsy. Targeting the vascular pathway might be a promising approach for potential therapy.


Assuntos
Demência Frontotemporal , Substância Branca , Humanos , Demência Frontotemporal/metabolismo , Substância Branca/diagnóstico por imagem , Substância Branca/patologia , Estudos Transversais , Metaloproteinase 1 da Matriz/metabolismo , Encéfalo/metabolismo , Imageamento por Ressonância Magnética/métodos , Substância Cinzenta/patologia , Testes Neuropsicológicos , Biomarcadores/metabolismo , Inflamação/patologia
4.
Mol Genet Genomic Med ; 12(3): e2398, 2024 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-38444259

RESUMO

BACKGROUND: Okur-Chung neurodevelopmental syndrome (OCNDS) is a rare autosomal dominant disorder caused by pathogenic variants in CSNK2A1. It is characterized by intellectual disability, developmental delay, and multisystemic abnormalities. METHODS: We performed the whole-exome sequencing for a patient in a Chinese family. The co-segregation study using the Sanger sequencing method was performed among family members. Reverse transcription and quantitative real-time polymerase chain reaction were carried out using total RNA from blood samples of the proband and wild-type control subjects. A review of patients with OCNDS harboring CSNK2A1 pathogenic variants was conducted through a comprehensive search of the PubMed database. RESULTS: We identified a novel CSNK2A1 frameshift variant p.Tyr323Leufs*16 in a Chinese family. The proband, a 31-year-old female, presented with abnormal eating habits, recurrent seizures, language impairment, and intellectual disability. Her mother exhibited postnatal hernias, splenomegaly, and a predisposition to infections, but showed no significant developmental impairments or intellectual disability. Genetic studies revealed the presence of this variant in CSNK2A1 in both the proband and her mother. Transcription analysis revealed this variant may lead to nonsense-mediated mRNA decay, suggesting haploinsufficiency as a potential disease mechanism. We reviewed 47 previously reported OCNDS cases and discovered that individuals carrying CSNK2A1 null variants may exhibit a diminished frequency of symptoms linked to language deficits, dysmorphic facial features, or intellectual disability, consequently presenting an overall milder phenotype when compared to those with missense variants. CONCLUSION: We report a novel frameshift variant, p.Tyr323Leufs*16, in an OCNDS family with a generally mild phenotype. This study may broaden the spectrum of clinical presentations associated with OCNDS and contribute novel insights into the genotype-phenotype correlation of this condition.


Assuntos
Deficiência Intelectual , Adulto , Feminino , Humanos , Povo Asiático , Bases de Dados Factuais , Genótipo , Deficiência Intelectual/genética , Fenótipo
5.
Brain ; 2024 Mar 01.
Artigo em Inglês | MEDLINE | ID: mdl-38426222

RESUMO

Frontotemporal Dementia (FTD) is a disease of high heterogeneity, apathy and disinhibition present in all subtypes of FTD and imposes a significant burden on families/society. Traditional neuroimaging analysis has limitations in elucidating the network localization due to individual clinical and neuroanatomical variability. The study aims to identify the atrophy network map associated with different FTD clinical subtypes and determine the specific localization of the network for apathy and disinhibition. Eighty FTD patients [45 behavioral variant FTD (bvFTD) and 35 semantic variant progressive primary aphasia (svPPA)] and 58 healthy controls (HCs) at Xuanwu Hospital were enrolled as Dataset 1; 112 FTD patients including 50 bvFTD, 32 svPPA, and 30 non-fluent variant PPA (nfvPPA) cases, and 110 HCs from Frontotemporal Lobar Degeneration Neuroimaging Initiative (FTLDNI) dataset were included as Dataset 2. Initially, single-subject atrophy maps were defined by comparing cortical thickness in each FTD patient versus HCs. Next, the network of brain regions functionally connected to each FTD patient's location of atrophy was determined using seed-based functional connectivity in a large (n = 1000) normative connectome. Finally, we used atrophy network mapping to define clinical subtype-specific network (45 bvFTD, 35 svPPA and 58 HCs in Dataset 1; 50 bvFTD, 32 svPPA, 30 nfvPPA and 110 HCs in Dataset 2) and symptom-specific networks [combined dataset 1 and 2, apathy without depression Vs non-apathy without depression (80:26), disinhibition Vs non-disinhibition (88:68)]. We compare the result with matched symptom networks derived from patients with focal brain lesions or conjunction analysis. Through the analysis of two datasets, we identified heterogeneity in atrophy patterns among FTD patients. However, these atrophy patterns are connected to a common brain network. The primary regions affected by atrophy in FTD included the frontal and temporal lobes, particularly the anterior temporal lobe. bvFTD connects to frontal and temporal cortical areas, svPPA mainly impacts the anterior temporal region, and nfvPPA targets the inferior frontal gyrus and precentral cortex regions. The apathy-specific network was localized in the orbital frontal cortex and ventral striatum, while the disinhibition-specific network was localized in the bilateral orbital frontal gyrus and right temporal lobe. Apathy and disinhibition atrophy networks resemble known motivational and criminal lesion networks respectively. A significant correlation was found between the apathy/disinhibition scores and functional connectivity between atrophy maps and the peak of the networks. This study localizes the common network of clinical subtypes and main symptoms in FTD, guiding future FTD neuromodulation interventions.

6.
JAMA Neurol ; 81(3): 291-292, 2024 Mar 01.
Artigo em Inglês | MEDLINE | ID: mdl-38165700

RESUMO

This case report describes 2 patients with genetic Creutzfeldt-Jakob disease with atypical changes on diffusion-weighted imaging.


Assuntos
Síndrome de Creutzfeldt-Jakob , Humanos , Síndrome de Creutzfeldt-Jakob/diagnóstico por imagem , Encéfalo , Córtex Cerebral/diagnóstico por imagem
7.
Neurol Sci ; 45(2): 557-564, 2024 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-37668827

RESUMO

BACKGROUND: The mild behavioral impairment checklist (MBI-C) designed to capture neuropsychiatric symptoms in the whole spectrum of elder with or without dementia, have been verified in mild behavioral impairment, mild cognitive impairment and Alzheimer's Disease, but never used in the behavioral variant of frontotemporal dementia (bvFTD). METHODS: Fifty-two patients with bvFTD (mild, n = 30; moderate-severe, n = 22) and 82 community-dwelling elderly individuals (HCs) were enrolled. All subjects were assessed with a full neuropsychological scale including the MBI-C, Neuropsychiatric Inventory Questionnaire (NPI-Q), and Frontal Behavioral Inventory (FBI). Receiver operating characteristic curves were drawn to analyze the sensitivity and specificity of the MBI-C, NPI-Q, and FBI, and cutoff points were determined using the Youden index. RESULTS: The MBI-C and domain scores in all patients with bvFTD were significantly higher than those in HCs. The most common symptoms of bvFTD were apathy (82.7%) and impulse dyscontrol (80.8%). The MBI-C score was positively correlated with the NPI-Q, FBI, and Activities of Daily Living. For differentiating patients with both bvFTD and mild bvFTD from HCs, the optimal MBI-C cutoff point was 5.5 with a sensitivity of 100% and specificity of 82%, and its sensitivity was higher than that of the NPI-Q and FBI. CONCLUSION: The MBI-C is a sensitive tool for screening behavioral and psychological symptoms in patients with bvFTD, even in the early stages of the disease.


Assuntos
Disfunção Cognitiva , Demência Frontotemporal , Humanos , Idoso , Demência Frontotemporal/diagnóstico , Lista de Checagem , Atividades Cotidianas , Testes Neuropsicológicos , Disfunção Cognitiva/diagnóstico , Disfunção Cognitiva/psicologia , China
9.
J Investig Med ; 72(1): 3-12, 2024 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-37726952

RESUMO

The monocyte to high-density lipoprotein-cholesterol (HDL-C) ratio (monocyte-to-HDL-C ratio) was proposed as a marker of atherosclerosis. Osteoporosis and atherosclerosis share common risk factors and pathophysiological mechanisms. This study aimed to assess the relationship between monocyte-to-HDL-C ratio and osteoporosis. Participants aged ≥50 years with complete bone mineral density (BMD), monocyte, and HDL-C examination data from the National Health and Nutrition Examination Survey (NHANES) 2013-2014 were included. Descriptive analysis was performed separately according to males and females. Weight linear regression and weight logistic regression analyses were used to analyze the association between the monocyte-to-HDL-C ratio and BMD and osteopenia and osteoporosis and vertebral fracture. A total of 1804 participants were included. Among the participants with osteopenia, 398 (48.31%) were males and 466 (51.91%) were females. Among those with osteoporosis, 38 (2.77%) were males and 95 (9.50%) were females. In females, monocyte-to-HDL-C ratio was negatively associated with femoral neck BMD (regression coefficient (ß) = -0.18; 95% confidence interval (CI): (-0.29, -0.07)) and high monocyte-to-HDL-C ratio was associated with higher odds of osteopenia (odds ratio (OR) = 1.22; 95% CI: (1.01, 1.47)) and osteoporosis (OR = 1.68; 95% CI: (1.13, 2.49)) after adjusting for confounders. In males, only monocyte-to-HDL-C ratio >0.35 was observed to be associated with higher odds of osteoporosis (OR = 1.96; 95% CI: (1.02, 3.79)). Stratified analyses showed that similar results were also found in different populations. This study showed that the monocyte-to-HDL-C ratio was negatively associated with BMD and the risk of osteopenia and osteoporosis in females. The monocyte-to-HDL-C ratio may be a new marker of osteoporosis or osteopenia.


Assuntos
Aterosclerose , Doenças Ósseas Metabólicas , Osteoporose , Masculino , Feminino , Humanos , Inquéritos Nutricionais , HDL-Colesterol , Monócitos , Osteoporose/complicações , Densidade Óssea , Doenças Ósseas Metabólicas/epidemiologia , Doenças Ósseas Metabólicas/complicações , Doenças Ósseas Metabólicas/diagnóstico , Aterosclerose/complicações
10.
Ann Med ; 55(2): 2288307, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-38056001

RESUMO

PURPOSE: To explore the transformational leadership competency of graduates from one medical university in China and its influencing variables. METHOD: From 2020 to 2021, 851 medical graduates from seven hospitals affiliated with the Capital Medical University participated in this survey. The authors conducted a cross-sectional study to assess transformational leadership competency, particularly from three aspects, including values, Emotional Intelligence (EI) abilities, and behaviors using the socially responsible leadership scale (SRLS), emotionally intelligent leadership, and student leadership practices inventory (EILI and SLPI). RESULTS: The SRLS scores were medium except for 'controversy with civility'. The EILI scores were medium. The SLPI scores were high except for 'enable others to act' and 'encourage the heart'. The influencing variables of SRLS, EILI, and SLPI were serving as student cadres, serving longer than two semesters (p = 0.01, 0.02 in EILI and SLPI), joining student organizations, participating in social practice, voluntary service (p = 0.001 in SLPI), in training classes for student cadres (p = 0.02, 0.01, 0.02 in SRLS, EILI, and SLPI), and attending lectures on leadership (except for indicated, p < 0.001). Regression analysis showed that attending lectures on leadership was associated with high SRLS, EILI, and SLPI scores (p = 0.04, SRLS; p < 0.001, others), and SRLS and EILI scores could affect SLPI score (F = 2674.44, p < 0.001, R2 = 0.86). CONCLUSIONS: Medical graduates' transformational leadership competency at the Capital Medical University was medium measured from values, EI abilities, and behaviors. Group analysis indicated that knowledge learning, organizational involvement, and social/community involvement were associated with leadership capacity building, meanwhile, leaders' values and EI abilities would affect their behaviors, suggesting medical graduates should undertake leadership training from both knowledge learning and practicing.


Assuntos
Liderança , Estudantes , Humanos , Estudos Transversais , Universidades , Inteligência Emocional , Inquéritos e Questionários
12.
Ann Clin Transl Neurol ; 10(7): 1209-1218, 2023 07.
Artigo em Inglês | MEDLINE | ID: mdl-37278248

RESUMO

OBJECTIVE: To assess the proportion of clinically diagnosed MM2-type sporadic Creutzfeldt-Jakob disease (sCJD) in a Chinese cohort, describe the clinical features of MM2-cortical (MM2C) and MM2-thalamic (MM2T) type sCJD to improve the early detection of MM2-type sCJD. METHODS: A total of 209 patients with sCJD admitted to the Xuanwu Hospital between February 2012 and August 2022 were reviewed. The patients were classified into probable MM2C, MM2T-type sCJD, and other types of sCJD according to current clinical diagnostic criteria. Clinical and ancillary data were compared between the groups. RESULTS: Fifty-one (24.4%) patients were clinically diagnosed with MM2-type sCJD, of which 44 were diagnosed with MM2C-type sCJD and 7 with MM2T-type sCJD. In the absence of RT-QuIC, 27 (61.3%) patients of MM2C-type sCJD did not meet the US CDC sCJD criteria for possible sCJD on admission, even though the mean period from onset to admission was 6.0 months. However, all of these patients had cortical hyperintensity on DWI. Compared to the other types of sCJD, MM2C-type sCJD was associated with slower disease progression and the absence of the typical clinical features of sCJD; the MM2T-type sCJD group had a higher proportion of males, earlier age of onset, longer duration of disease, and a higher incidence of bilateral thalamic hypometabolism/hypoperfusion. INTERPRETATION: In the absence of multiple typical sCJD symptoms within 6 months, the presence of cortical hyperintensity on DWI should raise concerns for MM2C-type sCJD after excluding other etiologies. Bilateral thalamic hypometabolism/hypoperfusion may be more helpful in the clinical diagnosis of MM2T-type sCJD.


Assuntos
Síndrome de Creutzfeldt-Jakob , Humanos , Masculino , Povo Asiático , Síndrome de Creutzfeldt-Jakob/diagnóstico , Síndrome de Creutzfeldt-Jakob/diagnóstico por imagem , Diagnóstico Precoce , Tálamo/diagnóstico por imagem , Imagem de Difusão por Ressonância Magnética
13.
Clin Genet ; 104(3): 350-355, 2023 09.
Artigo em Inglês | MEDLINE | ID: mdl-37148197

RESUMO

Studies focusing on octapeptide repeat alteration mutations in PRNP in Alzheimer's disease (AD) and frontotemporal dementia (FTD) cohorts have been rare. We aim to screen sporadic AD and FTD patients with unknown etiology for the octapeptide repeat insertions and deletions in PRNP. Two hundred and six individuals were screened for alterations to the repeat region in the PRNP gene, including 146 sporadic AD and 60 sporadic FTD patients. Our study showed a 1.5% (3/206) occurrence of the octapeptide repeat alteration mutations in PRNP in a Chinese cohort of sporadic dementia. One late-onset FTD patient and one early-onset AD patient each had a two-octapeptide repeat deletion in PRNP, while one early-onset AD patient had a five-octapeptide repeat insertion mutation. PRNP octapeptide repeat alteration mutations are present in sporadic AD and FTD patients. The genetic investigation for PRNP octapeptide repeat alteration mutations in sporadic dementia patients should be carried out in future clinical studies.


Assuntos
Doença de Alzheimer , Demência Frontotemporal , Príons , Humanos , Príons/genética , Príons/metabolismo , Proteínas Priônicas/genética , Demência Frontotemporal/diagnóstico , Demência Frontotemporal/genética , Doença de Alzheimer/diagnóstico , Doença de Alzheimer/genética , Mutação
14.
J Alzheimers Dis ; 93(4): 1369-1380, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-37182866

RESUMO

BACKGROUND: The insula is the predominant brain region impaired in behavioral variant frontotemporal dementia (bvFTD). However, structural and functional changes in the sub-insula in the asymptomatic stage of bvFTD are unknown. OBJECTIVE: To describe structural and functional changes in insula subregions in asymptomatic carriers of the P301L mutation of the microtubule-associated protein tau (MAPT) gene and patients with bvFTD. METHODS: Six asymptomatic MAPT P301L mutation carriers and 12 MAPT negative control subjects of the same pedigree were enrolled, along with 30 patients with a clinical diagnosis of bvFTD and 30 matched controls. All subjects underwent hybrid positron emission tomography/magnetic resonance imaging. Atlas-based parcellation using a fine-grained Brainnetome Atlas was conducted to assess gray matter (GM) volume, metabolism, and metabolic connectivity in the sub-insula (region of interest). RESULTS: There was no significant GM atrophy or hypometabolism in insula subregions in asymptomatic MAPT P301L carriers, although decreased metabolic connectivity between vIa-middle temporal gyrus, vIa-temporal poles, dIa-middle temporal gyrus and dIa-temporal poles; and increased connectivity between vIa-orbitofrontal, vIa-dorsal lateral superior frontal gyrus, and dIa-orbitofrontal and dIa-dorsal lateral superior frontal gyrus were observed. Patients with bvFTD had significant atrophy and hypometabolism in all insula subregions and decreased metabolic connectivity in the whole brain, including vIa/dIa-middle temporal and vIa/dIa-temporal poles. The standardized uptake value ratios of vIa and dIa were negatively associated with Frontal behavior inventory disinhibition scale scores. CONCLUSION: Metabolic connectivity is altered in vIa and dIa subregions of the sub-insula in MAPT P301L mutation carriers before the occurrence of atrophy, hypometabolism, and clinical symptoms.


Assuntos
Encéfalo , Demência Frontotemporal , Humanos , Encéfalo/patologia , Demência Frontotemporal/diagnóstico por imagem , Demência Frontotemporal/genética , Demência Frontotemporal/metabolismo , Proteínas tau/genética , Proteínas tau/metabolismo , Córtex Cerebral/patologia , Lobo Temporal/patologia , Imageamento por Ressonância Magnética , Atrofia/patologia
15.
Viruses ; 15(5)2023 04 29.
Artigo em Inglês | MEDLINE | ID: mdl-37243178

RESUMO

BACKGROUND: The Heidenhain variant of Creutzfeldt-Jakob disease (HvCJD), as a rare phenotype of CJD, has been under-recognized. We aim to elucidate the clinical and genetic features of HvCJD and investigate the differences of clinical features between genetic and sporadic HvCJD to improve our understanding of this rare subtype. METHOD: HvCJD patients admitted to the Xuanwu Hospital from February 2012 to September 2022 were identified, and published reports on genetic HvCJD cases were also reviewed. The clinical and genetic features of HvCJD were summarized, and the clinical features between genetic and sporadic HvCJD were compared. RESULTS: A total of 18 (7.9%) HvCJD patients were identified from 229 CJD cases. Blurred vision was the most common visual disturbance at the disease's onset, and the median duration of isolated visual symptoms was 30.0 (14.8-40.0) days. DWI hyperintensities could appear in the early stage, which might help with early diagnosis. Combined with previous studies, nine genetic HvCJD cases were identified. The most common mutation was V210I (4/9), and all patients (9/9) had methionine homozygosity (MM) at codon 129. Only 25% of cases had a family history of the disease. Compared to sporadic HvCJD, genetic HvCJD cases were more likely to present with non-blurred vision visual symptoms at onset and develop cortical blindness during the progression of the disease. CONCLUSIONS: HvCJD not only could be sporadic, but also, it could be caused by different PRNP mutations. Sporadic HvCJD was more likely to present with blurred vision visual symptoms at onset, and genetic HvCJD was more likely to develop cortical blindness with the disease's progression.


Assuntos
Cegueira Cortical , Síndrome de Creutzfeldt-Jakob , Humanos , Síndrome de Creutzfeldt-Jakob/diagnóstico , Síndrome de Creutzfeldt-Jakob/genética , Cegueira Cortical/complicações , Transtornos da Visão/etiologia , Fenótipo
16.
Ann Neurol ; 94(3): 442-456, 2023 09.
Artigo em Inglês | MEDLINE | ID: mdl-37243334

RESUMO

OBJECTIVES: Glymphatic function has not yet been explored in behavioral variant frontotemporal dementia (bvFTD). The spatial correlation between regional glymphatic function and bvFTD remains unknown. METHOD: A total of 74 patients with bvFTD and 67 age- and sex-matched healthy controls (HCs) were selected from discovery dataset and replication dataset. All participants underwent neuropsychological assessment. Glymphatic measures including choroid plexus (CP) volume, diffusion tensor imaging along the perivascular (DTI-ALPS) index, and coupling between blood-oxygen-level-dependent signals and cerebrospinal fluid signals (BOLD-CSF coupling), were compared between the two groups. Regional glymphatic function was evaluated by dividing DTI-ALPS and BOLD-CSF coupling into anterior, middle, and posterior regions. The bvFTD-related metabolic pattern was identified using spatial covariance analysis based on l8 F-FDG-PET. RESULTS: Patients with bvFTD showed higher CP volume (p < 0.001); anterior and middle DTI-ALPS (p < 0.001); and weaker anterior BOLD-CSF coupling (p < 0.05) than HCs after controlling for cortical gray matter volume in both datasets. In bvFTD from the discovery dataset, the anterior DTI-ALPS was negatively associated with the expression of the bvFTD-related metabolic pattern (r = -0.52, p = 0.034) and positively related with regional standardized uptake value ratios of l8 F-FDG-PET in bvFTD-related brain regions (r range: 0.49 to 0.62, p range: 0.017 to 0.047). Anterior and middle glymphatic functions were related to global cognition and disease severity. INTERPRETATION: Our findings reveal abnormal glymphatic function, especially in the anterior and middle regions of brain in bvFTD. Regional glymphatic dysfunction may contribute to the pathogenesis of bvFTD. ANN NEUROL 2023;94:442-456.


Assuntos
Demência Frontotemporal , Humanos , Demência Frontotemporal/patologia , Imagem de Tensor de Difusão/métodos , Fluordesoxiglucose F18 , Encéfalo/patologia , Substância Cinzenta/patologia
17.
J Psychiatry Neurosci ; 48(2): E126-E134, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-37045477

RESUMO

BACKGROUND: There is growing evidence that the striatum plays a central role in cognitive dysfunction. However, it remains unclear whether and how the striatum contributes specifically to executive deficits in Alzheimer disease (AD). We sought to elucidate aberrations in the striatal subregion associated with executive function and its metabolic connectivity with the cortical regions to investigate its role in the pathogenesis of executive deficits in patients with AD. METHODS: Patients with AD and healthy controls underwent a neuropsychological assessment battery, including assessment of executive function, and a hybrid positron emission tomography/magnetic resonance imaging (PET/MRI) scan. We performed voxel-wise analyses of cerebral metabolism between patients and controls, focusing on the executive subregion of the striatum according to the Oxford-GSK-Imanova Striatal Connectivity Atlas. We assessed the correlation between the [18F]-fluorodeoxyglucose standardized uptake value ratio of the striatal executive subregion and clinical variables, and we analyzed seed-based metabolic connectivity of the striatal executive subregion with the dorsolateral prefrontal cortex (DLPFC) using [18F]-fluorodeoxyglucose PET. RESULTS: We included 50 patients with AD and 33 controls in our analyses. The patterns of striatal hypometabolism in patients with AD were specific to executive and caudal motor subregions. Metabolic activity in the executive subregion of the striatum correlated negatively with the severity of executive dysfunction, as measured with the Trial-Making Test (TMT) part B and the difference score TMT B-A, and correlated positively with Digit Span (backward) and Verbal Fluency Test scales, particularly on the left side. Compared with controls, patients with AD showed reduced metabolic connectivity between striatal executive subregions and the dorsolateral prefrontal cortex (DLPFC). LIMITATIONS: Our study was limited by small sample sizes and cross-sectional findings. CONCLUSION: Our findings show that patients with AD have impairments in the executive subregion of the striatum, and these deficits may be associated with a disconnection between the executive striatum and DLPFC, providing valuable insight into the pathogenesis of this disease.


Assuntos
Doença de Alzheimer , Humanos , Doença de Alzheimer/diagnóstico por imagem , Corpo Estriado/metabolismo , Estudos Transversais , Função Executiva , Imageamento por Ressonância Magnética , Neostriado , Estudos de Casos e Controles
18.
J Neuroinflammation ; 20(1): 65, 2023 Mar 08.
Artigo em Inglês | MEDLINE | ID: mdl-36890594

RESUMO

BACKGROUND: Neuroinflammation plays a significant role in the progression of frontotemporal dementia (FTD). However, the association between peripheral inflammatory factors and brain neurodegeneration is poorly understood. We aimed to examine changes in peripheral inflammatory markers in patients with behavioural variant FTD (bvFTD) and explore the potential association between peripheral inflammation and brain structure, metabolism, and clinical parameters. METHODS: Thirty-nine bvFTD patients and 40 healthy controls were enrolled and underwent assessment of plasma inflammatory factors, positron emission tomography/magnetic resonance imaging, and neuropsychological assessments. Group differences were tested using Student's t test, Mann‒Whitney U test, or ANOVA. Partial correlation analysis and multivariable regression analysis were implemented using age and sex as covariates to explore the association between peripheral inflammatory markers, neuroimaging, and clinical measures. The false discovery rate was used to correct for the multiple correlation test. RESULTS: Plasma levels of six factors, including interleukin (IL)-2, IL-12p70, IL-17A, tumour necrosis superfamily member 13B (TNFSF/BAFF), TNFSF12 (TWEAK), and TNFRSF8 (sCD30), were increased in the bvFTD group. Five factors were significantly associated with central degeneration, including IL-2, IL-12p70, IL-17A, sCD30/TNFRSF8, and tumour necrosis factor (TNF)-α; the association between inflammation and brain atrophy was mainly distributed in frontal-limbic-striatal brain regions, whereas the association with brain metabolism was mainly in the frontal-temporal-limbic-striatal regions. BAFF/TNFSF13B, IL-4, IL-6, IL-17A and TNF-α were found to correlate with clinical measures. CONCLUSION: Peripheral inflammation disturbance in patients with bvFTD participates in disease-specific pathophysiological mechanisms, which could be a promising target for diagnosis, treatment, and monitoring therapeutic efficacy.


Assuntos
Demência Frontotemporal , Doença de Pick , Humanos , Demência Frontotemporal/complicações , Demência Frontotemporal/diagnóstico por imagem , Interleucina-17/metabolismo , Encéfalo/metabolismo , Doença de Pick/patologia , Imageamento por Ressonância Magnética , Testes Neuropsicológicos , Inflamação/patologia
19.
J Alzheimers Dis ; 93(1): 295-305, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-36970906

RESUMO

BACKGROUND: Research on posterior cortical atrophy (PCA) has focused on cognitive decline, especially visual processing deficits. However, few studies have examined the impact of PCA on activities of daily living (ADL) and the neurofunctional and neuroanatomic bases of ADL. OBJECTIVE: To identify brain regions associated with ADL in PCA patients. METHODS: A total of 29 PCA patients, 35 typical Alzheimer's disease (tAD) patients, and 26 healthy volunteers were recruited. Each subject completed an ADL questionnaire that included basic and instrumental subscales (BADL and IADL, respectively), and underwent hybrid magnetic resonance imaging and 18F fluorodeoxyglucose positron emission tomography. Voxel-wise regression multivariable analysis was conducted to identify specific brain regions associated with ADL. RESULTS: General cognitive status was similar between PCA and tAD patients; however, the former had lower total ADL scores and BADL and IADL scores. All three scores were associated with hypometabolism in bilateral parietal lobes (especially bilateral superior parietal gyri) at the whole-brain level, PCA-related hypometabolism level, and PCA-specific hypometabolism level. A cluster that included the right superior parietal gyrus showed an ADL×group interaction effect that was correlated with the total ADL score in the PCA group (r = -0.6908, p = 9.3599e-5) but not in the tAD group (r = 0.1006, p = 0.5904). There was no significant association between gray matter density and ADL scores. CONCLUSION: Hypometabolism in bilateral superior parietal lobes contributes to a decline in ADL in patients with PCA and can potentially be targeted by noninvasive neuromodulatory interventions.


Assuntos
Atividades Cotidianas , Doença de Alzheimer , Humanos , Doença de Alzheimer/patologia , Córtex Cerebral/patologia , Tomografia por Emissão de Pósitrons , Imageamento por Ressonância Magnética/métodos , Atrofia/patologia , Fluordesoxiglucose F18
20.
J Alzheimers Dis ; 93(1): 225-234, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-36970912

RESUMO

BACKGROUND: Progranulin (GRN) mutations in frontotemporal dementia (FTD) have been less frequently reported in China than in Western countries. OBJECTIVE: This study reports a novel GRN mutation and summarizes the genetic and clinical features of patients with GRN mutations in China. METHODS: Comprehensive clinical, genetic, and neuroimaging examinations were conducted on a 58-year-old female patient diagnosed with semantic variant primary progressive aphasia. A literature review was also conducted and clinical and genetic features of patients with GRN mutations in China were summarized. RESULTS: Neuroimaging revealed marked lateral atrophy and hypometabolism in the left frontal, temporal, and parietal lobes. The patient was negative for pathologic amyloid and tau deposition by positron emission tomography. A novel heterozygous 45-bp deletion (c.1414-14_1444delCCCTTCCCCGCCAGGCTGTGTGCTGCGAGGATCGCCAGCACTGCT) was detected by whole-exome sequencing of the patient's genomic DNA. Nonsense-mediated mRNA decay was presumed to be involved in the degradation of the mutant gene transcript. The mutation was deemed pathogenic according to American College of Medical Genetics and Genomics criteria. The patient had a reduced plasma GRN level. In the literature, there were reports of 13 Chinese patients - mostly female - with GRN mutations; the prevalence was 1.2% -2.6% and patients mostly had early disease onset. CONCLUSION: Our findings expand the mutation profile of GRN in China, which can aid the diagnosis and treatment of FTD.


Assuntos
Demência Frontotemporal , Humanos , Feminino , Masculino , Progranulinas/genética , Demência Frontotemporal/diagnóstico por imagem , Demência Frontotemporal/genética , Demência Frontotemporal/patologia , Peptídeos e Proteínas de Sinalização Intercelular/genética , População do Leste Asiático , Mutação/genética
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA