Functional versatility of Zur in metal homeostasis, motility, biofilm formation, and stress resistance in Yersinia pseudotuberculosis.

Zur (zinc uptake regulator) is a significant member of the Fur (ferric uptake regulator) superfamily, which is widely distributed in bacteria. Zur plays crucial roles in zinc homeostasis and influences cell development and environmental adaptation in various species. Yersinia pseudotuberculosis is a Gram-negative enteric that pathogen usually serves as a model organism in pathogenicity studies. The regulatory effects of Zur on the zinc transporter ZnuABC and the protein secretion system T6SS have been documented in Y. pseudotuberculosis. In this study, a comparative transcriptomics analysis between a ∆zur mutant and the wild-type (WT) strain of Y. pseudotuberculosis was conducted using RNA-seq. This analysis revealed global regulation by Zur across multiple functional categories, including membrane transport, cell motility, and molecular and energy metabolism. Additionally, Zur mediates the homeostasis not only of zinc but also ferric and magnesium in vivo. There was a notable decrease in 35 flagellar biosynthesis and assembly-related genes, leading to reduced swimming motility in the ∆zur mutant strain. Furthermore, Zur upregulated multiple simple sugar and oligopeptide transport system genes by directly binding to their promoters. The absence of Zur inhibited biofilm formation as well as reduced resistance to chloramphenicol and acidic stress. This study illustrates the comprehensive regulatory functions of Zur, emphasizing its importance in stress resistance and pathogenicity in Y. pseudotuberculosis. IMPORTANCE: Bacteria encounter diverse stresses in the environment and possess essential regulators to modulate the expression of genes in responding to the stresses for better fitness and survival. Zur (zinc uptake regulator) plays a vital role in zinc homeostasis. Studies of Zur from multiple species reviewed that it influences cell development, stress resistance, and virulence of bacteria. Y. pseudotuberculosis is an enteric pathogen that serves a model organism in the study of pathogenicity, virulence factors, and mechanism of environmental adaptation. In this study, transcriptomics analysis of Zur's regulons was conducted in Y. pseudotuberculosis. The functions of Zur as a global regulator in metal homeostasis, motility, nutrient acquisition, glycan metabolism, and nucleotide metabolism, in turn, increasing the biofilm formation, stress resistance, and virulence were reviewed. The importance of Zur in environmental adaptation and pathogenicity of Y. pseudotuberculosis was emphasized.

Comparison of the inflammatory states of serum and gingival crevicular fluid in periodontitis patients with or without type 2 diabetes mellitus.

Background/purpose:There is a two-way relationship between periodontitis and type 2 diabetes mellitus. This study aimed to compare the inflammatory states in serum and gingival crevicular fluid (GCF) in periodontitis patients with or without type 2 diabetes mellitus (T2DM) and healthy subjects. Materials and methods: 20 subjects were systematic and periodontal healthy (H group), 40 subjects were with periodontitis (CP group), and other 40 were with periodontitis and type 2 diabetes mellitus (DC group). Fasting blood glucose (FBG) and HbA1c was tested. GCF and serum level of interleukin (IL) -17, visfatin, receptor activator of nuclear factor-kappa B (NF-κB) ligand (RANKL)/osteoprotegerin (OPG) ratio were measured. Results: The GCF volume, total amount of IL-17, vastatin, RANKL/OPG ratio in GCF and their concentrations in serum were higher (P < 0.05) in CP and DC groups than in H group, which were also higher (P < 0.05) in DC group than in CP group except for visfatin in GCF and IL-17 in serum. At sample sites of PD ≤ 3 mm, GCF volume, IL-17, visfatin and RANKL/OPG ratio in DC and CP groups were higher (P < 0.05) than that in H group, which were also higher in DC group than in CP group either with PD ≤ 3 mm or PD > 3 mm. Inflammatory state in GCF was positively correlated to systemic inflammation, and both of them were positively correlated to FBG. Conclusion: Moderate and severe periodontitis aggravated systemic inflammation. T2DM together with periodontitis resulted in more severe systemic inflammation. The positive correlation between the periodontal and systemic inflammation and their association with FBG indicated an inflammatory link between periodontitis and T2DM.

Glucose and lipid metabolism indexes and blood inflammatory biomarkers of patients with severe periodontitis: A cross-sectional study.

BACKGROUND: To investigate the relation of established glucose and lipid metabolism indexes and blood inflammatory biomarkers with severe periodontitis in systemically healthy patients. METHODS: Systemically healthy Stage III/IV periodontitis patients (case group) (n = 397), Stage II periodontitis patients (n = 36), and periodontally healthy subjects (control group) (n = 285) were recruited. A periodontal examination, complete blood cell examination, and blood biochemical examination were conducted for all participants. Full-mouth apical films were taken for the case group. Both the case and control groups were divided by age into younger (≤ 35 years) and elder subjects. Multiple logistic regression analysis and Pearson correlation analysis were conducted. A logistic least absolute shrinkage and selection operator (LASSO) model was constructed for the younger subgroups. RESULTS: Various glucose and lipid metabolism indexes and blood inflammatory biomarkers significantly differed between severe periodontitis patients and healthy controls, and the younger subgroups presented a greater degree of statistical differences than the elder ones. More pairs of periodontal parameters and blood indexes with significantly fair linear correlations were found in the younger patient subgroup. A logistic LASSO regression model containing eight blood indexes to assess a severe periodontitis outcome in younger subgroups showed satisfactory predictive ability. CONCLUSION: The present study revealed various glucose and lipid metabolism indexes and blood inflammatory biomarkers significantly differ between severe periodontitis patients and healthy controls, especially in the younger subgroups. A LASSO regression model could be a viable option to assess severe periodontitis risk for younger patients.

GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

Geomechanical log responses and identification of fractures in tight sandstone, West Sichuan Xinchang Gas Field.

Natural fractures provide important reservoir space and migration channels for oil and gas in tight reservoirs. Moreover, they are key factors controlling the high yield of tight oil and gas. Accordingly, methods to identify and characterize fractures are essential; however, conventional well-logging data are not ideal for such purposes. To this end, our study proposed an efficient method for identifying and characterizing fractures. First, core observations, core sample test analysis, numerical simulations, core calibration of borehole image logs, and borehole image log calibration of conventional logs were performed to identify sensitive log curves and log response characteristics of fractures. Second, we analyzed the response characteristics and differences in the log and properties of tight sandstone with and without fractures. Third, logging eigenvalue (EvF) and rock physical eigenvalue (MvF) models were constructed to determine different causes of fractures in tight sandstone. Finally, the two models were applied to identify and characterize fractures in the tight sandstone reservoirs in the West Sichuan Xinchang gas field, China. It was found that the effect of using the logging eigenvalue and rock physical eigenvalue models to identify fractures was similar to that observed using an image log. Overall, different fractures were accurately identified and characterized, indicating that the proposed method efficiently identifies and characterizes fractures in tight sandstone, ultimately advancing the research of fine reservoir evaluation and fracture theory.

Calprotectin levels in gingival crevicular fluid and serum of patients with chronic periodontitis and type 2 diabetes mellitus before and after initial periodontal therapy.

BACKGROUND: This study is aimed to compare the total amount of calprotectin in gingival crevicular fluid (GCF) and the concentration of calprotectin in serum among the patients with type 2 diabetes mellitus and chronic periodontitis (DM-P), the patients with chronic periodontitis (CP) and the healthy controls, as well as the variation of these indicators before and three months after the initial periodontal therapy for the DM-P patients. METHODS: 35 patients with DM-P patients, 32 patients with CP patients, and 43 healthy controls were recruited. Calprotectin levels in serum and GCF, periodontal parameters, fasting blood glucose (FBG), and HbA1c were measured at baseline for all the groups and three months after the initial periodontal therapy for the DM-P patients. RESULTS: At baseline, the calprotectin levels in GCF and serum were the highest in DM-P, followed by CP, and the lowest in healthy controls. GCF calprotectin was significantly and positively correlated with serum calprotectin and probing depth (PD), while serum calprotectin had a significant positive correlation with GCF calprotectin and HbA1c. Periodontal parameters, HbA1c, and serum and GCF calprotectin became significantly reduced after the initial periodontal treatment. The reduction of serum calprotectin was consistent with that of HbA1c, while the decrease of GCF calprotectin was in agreement with that of PD, attachment loss (AL), and bleeding on probing (BOP). CONCLUSIONS: The levels of calprotectin in serum and GCF in the DM-P patients are significantly higher than those in CP patients and healthy controls, which significantly reduced 3 months after the initial periodontal therapy. Furthermore, it suggests diabetic patients might exhibit more pronounced inflammation periodontally and systemically.

Well-maintained patients with a history of periodontitis still harbor a more dysbiotic microbiome than health.

BACKGROUND: It remains unclear whether well-maintained subjects, with periodontitis in the past, effectively treated, and maintained for a long time, have the same subgingival microbiome as healthy subjects. Therefore, the objective of this study was to investigate the characteristics of the subgingival microbiome in well-maintained patients with a history of periodontitis compared with healthy subjects. METHODS: We recruited in 17 well-maintained individuals (no evidence of clinical inflammation and progress of periodontitis) and 21 healthy individuals. Periodontal clinical parameters, consisting of missing teeth, plaque index (PLI), periodontal depth (PD), and bleeding index (BI), were recorded and analyzed. The pooled subgingival samples from mesiobuccal sites of two maxillary first molars were collected. The V3-V4 region of 16S rRNA gene from 38 subgingival samples was sequenced and analyzed. Alpha diversity, microbial composition, types of bacteria, functional pathways between well-maintained group and health group were compared using Mann-Whitney U test. Spearman correlation was used in analyzing the symbiotic relationship among taxa. A classification model was constructed to distinguish two ecological types. RESULTS: The maintained individuals demonstrated a different microbiome from healthy subjects, with higher diversity, more disordered structure, more pathogenic microbiota, and more host-destructive metabolism pathways. The genera Actinomyces, Streptococcus, Leptotrichia, Capnocytophaga, Lautropia, and Fusobacterium were predominant components with relative abundance >5% in the subgingival microbiome of well-maintained patients. The classification model by microbiota got a remarkable accuracy of 83.33%. CONCLUSIONS: Individuals with well-maintained periodontitis showed a more dysbiotic microbial community than healthy individuals. Therefore, close monitoring and scheduled maintenance treatment are necessary for them to maintain a healthy periodontal condition.

Impacts of potassium ferrate(VI) on the growth and organic matter accumulation, production, and structural changes in the cyanobacterium Microcystis aeruginosa.

Cyanobacterial blooms generated by nutrient addition into aquatic systems pose serious risks to ecosystems and human health. Though there are established chemical, physical, and biological means of eradication, more efficient and environmentally friendly measures are desired. This study investigates the effect of potassium ferrate(VI) on the growth and intracellular and extracellular organic matter accumulations of the cyanobacterium Microcystis aeruginosa. Cultures were inoculated with three separate concentrations of potassium ferrate(VI) (3, 15, 30 mg L-1) and monitored by measuring chlorophyll-a (Chl-a) and intracellular/extracellular dissolved organic carbon. Results show that ferrate(VI) addition effectively removed the microalgae from the medium, as indicated by the reduction of Chl-a. Organic matter accumulation of the microalgae was also affected by ferrate(VI) treatment; fluorescence EEM spectra show details of changing intracellular dissolved organic matter (IDOM) and extracellular dissolved organic matter (EDOM). A new peak appeared in the EDOM indicating altered humic and proteinaceous compounds. This study demonstrates that ferrate(VI) is a potential treatment for the water contaminated with the toxic microalgae M. aeruginosa.

[Three years retrospective clinical evaluation of endodontically treated premolars restored by cast ceramic onlays].

OBJECTIVE: This study aimed to evaluate the success and survival rate of endodontically treated premolars restored by ceramic onlays by comparing restored by quartz fiber posts and metal ceramic crowns. METHODS: Ninety-four patients with 126 endodontically treated premolars were enrolled in this study and divided into 4 groups according to the remaining axial walls and restorative methods. The observation time was 36 months. The success and survival rates of the restorations, as well as causes of failures, were analyzed. RESULTS: At the final follow-up, the success and survival rates of the mild defect endodontically treated premolars were restored by quartz fiber posts and the crowns were at 96.3% and 98.1%; the success and survival rates of the severe defect premolars restored by quartz fiber posts and crowns were at 88.5% and 96.2%. The success and survival rates of the mild defect premolars restored by cast ceramic onlays were both at 96.6%, the success and survival rates of the severe defect premolars restored by cast ceramic onlays were at 94.1% and 100%, respectively. The success and survival rates of the different groups were no significant difference (P>0.05). CONCLUSION: Based on the results and within the limits of this study, cast ceramic onlays is a very reliable method to restore endodontically treated premolars.

[Effects of dental health awareness and behaviours on the glycemic metabolic characteristics and periodontal disease of patients with type 2 diabetic].

OBJECTIVE: To analyze the effects of dental health awareness and behaviours on the relationship between glycemic metabolic characteristics and periodontal disease of type 2 diabetic patients. METHODS: In the study, 83 subjects with type 2 diabetes mellitus were recruited. The clinical periodontal indexes, such as pocket probing depth (PPD), attachment loss (AL), modified bleeding index (mBI), plaque index (PLI) were obtained with a Williams type periodontal probe; Laboratory examinations including glycosylated haemoglobin A1(HbA1C) were made, glucose assay tested, and the structured questionnaire interview conducted evaluationg the knowledge, attitude and practice (KAP) about periodontal health. RESULTS: The prevalence of moderate and severe periodontitis was 67.5%, compared with mild periodontitis, whose severities were affected by the higher level of HbA1C (≥8.0%) (OR 54.1-143.1), followed by using glycemic drug (OR=12.9-44.6), stress (OR=16.9-29.6), and the dissatisfaction with diabetic therapy (OR=16.9-18.0) et al. Meanwhile the attachment loss conditions were also correlated with the poor periodontal knowledge level(OR=3.4),older age(OR=1.1),and misjudgement of gingival inflammation (OR=13.3) et al. On the other hand, individuals with moderate and severe periodontitis, having bad teeth brushing effects and knowing about dental plaque inadequately, had a significantly higher risk for the poorly controlled glycemic results (HbA1C≥8.0%), and the OR was 8.61, 8.07, and 7.49 respectively. CONCLUSION: In patients with type 2 diabetes the severity of periodontal disease and the glycemic metabolic level (HbA1C) have a definite bidirectional adverse interrelationship, which is affected by the dental health awareness and behaviours.

[Effect of periodontal therapy on metabolic control and serum biochemical markers in subjects with type 2 diabetes and chronic periodontitis].

OBJECTIVE: To investigate the effect of periodontal therapy on periodontal clinical index, metabolic control and serum biochemical markers in subjects with type 2 diabetes and chronic periodontitis comprehensively. METHODS: Forty patients with type 2 diabetes and chronic periodontitis were enrolled, and periodontal clinical parameters, HbA1c, fasting blood glucose (FBG) and serum biochemical markers were tested at baseline and 3 months after initial periodontal therapy. RESULTS: The periodontal clinical parameters (PLI, BI,PD,CAL and BOP) improved significantly 3 months after initial periodontal therapy (P<0.001). The HbA1c also decreased statistically (P=0.014), while there was no change in venous fasting blood glucose. Other serum biochemical markers changed significantly including serum phosphor increased, calcium-phosphorus ratio decreased, triglyceride decreased, Apo A1 increased, lipoprotein a decreased, and serum total bilirubin increased. CONCLUSION: The initial periodontal therapy can significantly improve periodontal clinical parameters and HbA1c control, but the effect on venous fasting blood glucose was not revealed yet. In addition, initial periodontal therapy can also intervene serum phosphorus,calcium-phosphorus ratio, and the metabolism of lipid.

[The clinical study on the use of diode laser irradiation in the treatment of periodontal-endodontic combined lesions].

OBJECTIVE: To evaluate the adjunctive effect of diode laser irradiation for the treatment of periodontal-endodontic combined lesions. METHODS: 30 cases with periodontal-endodontic combined lesions were selected. All cases were randomly divided into experimental group and control group (n=15). In the control group, patients were treated with root canal therapy and conservative periodontal treatment (scaling and root planning), and patients in the experimental group were treated with root canal therapy and conservative periodontal treatment followed by diode laser irradiation. Clinical measurements including pocket probing depth (PPD), clinical attachment level (CAL), modified bleeding index (mBI), periapical index (PAI) were taken before treatment (baseline). Three and six months after the treatment, the adjunctive effects of diode laser in the treatment of periodontal-endodontic combined lesions were evaluated. RESULTS: Three months after the treatment, the average PPD, CAL and mBI levels were reduced significantly in both groups. But the average PPD reduction in the experimental group was significantly greater (P<0.05) than in control group. However the average CAL and mBI reduction were not significantly different between two groups. Six months after the treatment, the average PPD, CAL and mBI levels were further reduced in the experiment group, but not in the control group. The average PAI levels were reduced significantly in both groups, but the PAI reduction was not significantly different between two groups. CONCLUSION: The use of diode laser as an adjunct procedure in the treatment of periodontal-endodontic combined lesions can aid in achieving success.

[Pregnancy by a man with severe oligospermia after vasectomy: a case report].

OBJECTIVE: To analyze the risk of pregnancy in the woman whose husband has severe oligospermia after vasectomy. METHODS: A woman was found pregnant, whose husband, a 35-year-old man, had received vasectomy two years before. Two seminal examinations at the interval of 7 days showed the total number of motile sperm to be 0.047 x 10(6) and 0.044 x 10(6), respectively. DNA analysis after miscarriage exhibited a 99.9996% relative chance paternity (RCP). RESULTS: DNA analysis proved the biological paternity of the man with severe oligospermia after vasectomy. CONCLUSION: A man with severe oligospermia after vasectomy could make his wife pregnant.