Twenty-four years lucerne (Medicago sativa L.) breeder seed production in India: a retrospective study.

Lucerne (Medicago sativa L.) is the second most significant winter leguminous fodder crop after berseem in India. Breeder seed (BS) is the first stage of the seed production chain, as it is the base material for producing foundation and certified seeds. In India, lucerne BS demand has been reduced by 85.58% during the last 24 years (1998-1999 to 2021-2022), declining from 2150 kg to 310 kg. Out of 14 varieties released and notified so far, only nine varieties entered the seed chain since 1998-1999. It shows narrow varietal diversification and, hence, needs robust breeding programs towards enriching genetic variability and varietal development. The present study also highlights the disparity in BS demand and production over the years and puts forth the possible reasons behind the reduction in BS demand and production in the country. Out of the nine varieties, the BS demand of Anand-2 (53.11%) was highest, followed by Type-9 (19.44%) and RL-88 (13.60%). Varietal replacement rate (VRR) was found to be moderate, i.e., 23.67% for the varieties having <5 years old age in the last 3 years (2019-2020 to 2021-2022). It has also been estimated that BS produced (233 kg) during 2021-2022 can cover the approximate area of 6,300 ha at farmers' fields in 2024-2025 if the seed chain functions 100%, effectively. The present study provides a holistic overview of lucerne BS demand and production, challenges in BS production, and the way forward to develop more varieties and surplus BS production in the country.

Interactome of millet-based food matrices: A review.

Millets are recently being recognized as emerging food ingredients with multifaceted applications. Whole grain flours made from millets, exhibit diverse chemical compositions, starch digestibility and physicochemical properties. A food matrix can be viewed as a section of food microstructure, commonly coinciding with a physical spatial domain that interacts or imparts specific functionalities to a particular food constituent. The complex millet-based food matrices can help individuals to attain nutritional benefits due to the intricate and unique digestive properties of these foods. This review helps to fundamentally understand the binary and ternary interactions of millet-based foods. Nutritional bioavailability and bioaccessibility are also discussed based on additive, synergistic, masking, the antagonistic or neutralizing effect of different food matrix components on each other and the surrounding medium. The molecular basis of these interactions and their effect on important functional attributes like starch retrogradation, gelling, pasting, water, and oil holding capacity is also discussed.

Role of Magnesium Supplementation in Children with West Syndrome: A Randomized Controlled Clinical Trial.

OBJECTIVES: West syndrome is a severe epileptic encephalopathy of young age. It is characterized by a clinico-electrical triad of infantile epileptic spasms, regression or arrest of psychomotor development, and hypsarrhythmia. In the last two decades, the large progress in the development of newer antiepileptic drugs has allowed us to have a vast choice of treatment options to control spasms, although they often fail to do so. Thus, there is a need to explore other treatment options. MATERIALS & METHODS: Subjects in this open-labelled randomized control trial were included newly diagnosed children of age between 3 months and 5 years of both genders. A total of 52 children were recruited and randomized into two groups: an intervention group (n=30) and a non-intervention group (n=22). Magnesium sulphate was provided for the intervention group but not for the non-intervention one. Both groups received the rest of the treatments, including adrenocorticotropic hormone and antiepileptic drugs. The follow-up period was three months, at the end of which a per-protocol analysis was performed. RESULTS: There was no significant difference in seizure control and neurodevelopmental outcome between both groups, but electroencephalogram significantly improved in the intervention group compared to the control. Also, the clinical response was better in patients with normal initial serum magnesium levels in the intervention group (p=0.003) than in other patients. CONCLUSION: Magnesium supplementation may be helpful in children with West syndrome.

Analysis of the ex-vivo transformation of semen, saliva and urine as they dry out using ATR-FTIR spectroscopy and chemometric approach.

The ex-vivo biochemical changes of different body fluids also referred as aging of fluids are potential marker for the estimation of Time since deposition. Infrared spectroscopy has great potential to reveal the biochemical changes in these fluids as previously reported by several researchers. The present study is focused to analyze the spectral changes in the ATR-FTIR spectra of three body fluids, commonly encountered in violent crimes i.e., semen, saliva, and urine as they dry out. The whole analytical timeline is divided into relatively slow phase I due to the major contribution of water and faster Phase II due to significant evaporation of water. Two spectral regions i.e., 3200-3400 cm-1 and 1600-1000 cm-1 are the major contributors to the spectra of these fluids. Several peaks in the spectral region between 1600 and 1000 cm-1 showed highly significant regression equation with a higher coefficient of determination values in Phase II in contrary to the slow passing Phase I. Principal component and Partial Least Square Regression analysis are the two chemometric tool used to estimate the time since deposition of the aforesaid fluids as they dry out. Additionally, this study potentially estimates the time since deposition of an offense from the aging of the body fluids at the early stages after its occurrence as well as works as the precursor for further studies on an extended timeframe.

First report of Sclerotium rolfsii causing collar rot on Berseem (Trifolium alexandrinum) in India.

Berseem (Trifolium alexandrinum) is a winter season legume fodder crop widely cultivated in the central and northern parts of India. It is considered the 'King of fodder' for its high quality green fodder, which is a rich source of protein and low in fibre. Symptoms similar to collar rot were observed in experimental sites at the ICAR-Indian Grassland and Fodder Research institute (IGFRI), Jhansi (N25º 52' 749.20″, E78º 55' 452.70″), Uttar Pradesh, India in March 2019. The incidence of disease was ranged from 18 to 22% during 2019. Symptoms included dark colored water-soaked lesions at the base of stems, stem thinning (resembles wire stem) and eventually wilting of the whole plant. A white mycelial mat was observed on the stem and collar region and light brown to tan colored sclerotial bodies formed as disease progressed. To determine the etiology of the infection, 30 diseased plants with typical symptoms were collected from the 3 different fields and used for the isolation of causal agent. Infected stem portion were cut in to small pieces (5mm), surface sterilized with 2% sodium hypochlorite (NaOCl) for 2 minutes, washed three times with sterile distilled water and air dried. The sterilized infected tissues were cultured on potato dextrose agar amended with streptomycin sulphate @ 50µg/ml and incubated at 28±1º C for 3 days. After four days, hyaline septate mycelia ranging 2-3µm in diameter grow radially over the whole plate (90 mm). Sclerotia formation started 6 days after incubation. Sclerotia were initially white and later turned brownish to tan as they matured. The number of sclerotia per plate ranged from 55 to 120 (n=5) at 12 days after inoculation. The diameter of matured sclerotial bodies ranged from 0.1mm to 1.35mm (n=25). Genomic DNA was extracted from mycelium using the CTAB method (Murray and Thompson, 1980). Three regions of rDNA viz., internal transcribed spacer (ITS), large subunit (LSU), and small subunit (SSU) were used to identify the etiology of the disease. The isolate was amplified with ITS1 (5'CGGATCTCTTGGTTCTGGGA3')/ ITS4 (5'GACGCTCGAACATGCC3') described by White et al. (1990) and sequenced. The ITS sequence (NCBI GenBank Accession No: MT026581) showed 98.21 % similar to Athelia rolfsii (MH514001.1). The isolate also amplified with primers LSU (LROR: ACCCGCTGAACTTAAGC/ LR5: TCCTGAGGGAAACTTCG) and SSU (NS1: GTAGTCATATGCTTGTCTC/ NS4: CTTCCGTCAATTCCTTTAAG). The LSU (MT225781) and SSU (MT225782) sequences showed 99.90 % and 100 % similarity to Athelia rolfsii (AY635773.1) and Athelia rolfsii (AY635773.1) respectively. Based on the morphological and molecular characteristics, the pathogen responsible for collar rot in berseem was identified as Athelia rolfsii (Anamorph: Sclerotium rolfsii) (Mordue, 1974). To confirm pathogenicity, inoculum was prepared by inoculating mycelial plugs of pathogen into autoclaved corn sand meal (5:95) and incubated at 28±1º C for 12 days. The inoculum (30g) was placed at stem portion of 15 day old seedlings (n=30) of berseem (Cv. Wardan) raised in pots filled with sterilized soil. Seedlings (n=25) inoculated with sterilized corn sand meal (30g) served as the control. The pots were placed inside of a plant growth chamber (26±2º C, 65% RH) for 15 days. Water soaked spots with white mycelium were observed on the collar region after 3 days. After 7 days, stems were completely covered by mycelia and death of seedlings was observed 14 days after inoculation. The pathogen was recovered from the artificially inoculated berseem seedlings (n=15). No symptoms were observed in control plants. Based on morphological and molecular characterization, the present isolate was confirmed as Sclerotium rolfsii. To the best of our knowledge, this is the first report of S. rolfsii causing collar rot of berseem in India.

Forensic investigation of arson residue by infrared and Raman spectroscopy: From conventional to non-destructive techniques.

Arson can result in highly challenging and complicated crime scenes. Much physical evidence undergoes chemical degradation because of the destructive nature of fire, while accelerants either completely burn or evaporate, and may be present in traces within any of the decomposed materials. To identify the original material and the accelerant involved, it is necessary to use advanced analytical techniques. Gas chromatography, with different detectors, is one of the most frequently used instruments in fire debris and accelerant analysis. Among other instruments, capillary electrophoresis and laser-induced thermal desorption Fourier transform mass spectrometry are two major contributors. Vibrational spectroscopy, including infrared absorption and Raman scattering, is one of the major non-destructive tools for the analysis of evidence because of its advantages over other spectroscopic techniques. Most studies involving vibrational spectroscopy (i.e. infrared and Raman spectroscopy) have focused on the identification of commonly found household materials, while very few studies have considered the identification of ignitable liquids. This article reviews studies based on an analysis of fire debris and accelerants by vibrational spectroscopic techniques and considers the limitations and future perspectives of arson investigations in forensic science.

Mediation of the Acute Stress Response by the Skeleton.

We hypothesized that bone evolved, in part, to enhance the ability of bony vertebrates to escape danger in the wild. In support of this notion, we show here that a bone-derived signal is necessary to develop an acute stress response (ASR). Indeed, exposure to various types of stressors in mice, rats (rodents), and humans leads to a rapid and selective surge of circulating bioactive osteocalcin because stressors favor the uptake by osteoblasts of glutamate, which prevents inactivation of osteocalcin prior to its secretion. Osteocalcin permits manifestations of the ASR to unfold by signaling in post-synaptic parasympathetic neurons to inhibit their activity, thereby leaving the sympathetic tone unopposed. Like wild-type animals, adrenalectomized rodents and adrenal-insufficient patients can develop an ASR, and genetic studies suggest that this is due to their high circulating osteocalcin levels. We propose that osteocalcin defines a bony-vertebrate-specific endocrine mediation of the ASR.

Genetic data for PowerPlex 21™ autosomal and PowerPlex 23 Y-STR™ loci from population of the state of Uttar Pradesh, India.

In the present study, the statistical forensic parameters were evaluated for the loci present in PowerPlex 21 autosomal and PowerPlex 23 Y-STR multiplex systems in 168 unrelated individuals living in the state of Uttar Pradesh, India. The combined discrimination power (CPD) and combined exclusion power (CPE) was 1 and 0.999999 respectively for all 20 autosomal STR loci. Penta E showed the greatest (0.980) and CSF1PO showed the lowest (0.855) power of discrimination in the studied population. The haplotype diversity for 23 Y-STR loci was observed to be 0.999. The study also presents the first global report on polymorphism on D1S1656, D6S1043 and D12S391 autosomal STR loci in the Indian population. The resulting data revealed that these STR multiplex systems are highly polymorphic and can be used for forensic purposes.

Integrated Bioinformatics, Environmental Epidemiologic and Genomic Approaches to Identify Environmental and Molecular Links between Endometriosis and Breast Cancer.

We present a combined environmental epidemiologic, genomic, and bioinformatics approach to identify: exposure of environmental chemicals with estrogenic activity; epidemiologic association between endocrine disrupting chemical (EDC) and health effects, such as, breast cancer or endometriosis; and gene-EDC interactions and disease associations. Human exposure measurement and modeling confirmed estrogenic activity of three selected class of environmental chemicals, polychlorinated biphenyls (PCBs), bisphenols (BPs), and phthalates. Meta-analysis showed that PCBs exposure, not Bisphenol A (BPA) and phthalates, increased the summary odds ratio for breast cancer and endometriosis. Bioinformatics analysis of gene-EDC interactions and disease associations identified several hundred genes that were altered by exposure to PCBs, phthalate or BPA. EDCs-modified genes in breast neoplasms and endometriosis are part of steroid hormone signaling and inflammation pathways. All three EDCs-PCB 153, phthalates, and BPA influenced five common genes-CYP19A1, EGFR, ESR2, FOS, and IGF1-in breast cancer as well as in endometriosis. These genes are environmentally and estrogen responsive, altered in human breast and uterine tumors and endometriosis lesions, and part of Mitogen Activated Protein Kinase (MAPK) signaling pathways in cancer. Our findings suggest that breast cancer and endometriosis share some common environmental and molecular risk factors.

Improvement of efficiency of oil extraction from wild apricot kernels by using enzymes.

An experiment was conducted to evaluate and standardize the protocol for enhancing recovery of oil and quality from cold pressed wild apricot kernels by using various enzymes. Wild apricot kernels were ground into powder in a grinder. Different lots of 3 kg powdered kernel were prepared and treated with different concentrations of enzyme solutions viz. Pectazyme (Pectinase), Mashzyme (Cellulase) and Pectazyme + Mashzyme. Kernel powder mixed with enzyme solutions were kept for 2 h at 50(±2) °C temperature for enzymatic treatment before its use for oil extraction through oil expeller. Results indicate that use of enzymes resulted in enhancement of oil recovery by 9.00-14.22 %. Maximum oil recovery was observed at 0.3-0.4 % enzyme concentration for both the enzymes individually, as well as in combination. All the three enzymatic treatments resulted in increasing oil yield. However, with 0.3 % (Pectazyme + Mashzyme) combination, maximum oil recovery of 47.33 % could be observed against were 33.11 % in control. The oil content left (wasted) in the cake and residue were reduced from 11.67 and 11.60 % to 7.31 and 2.72 % respectively, thus showing a high increase in efficiency of oil recovery from wild apricot kernels. Quality characteristics indicate that the oil quality was not adversely affected by enzymatic treatment. It was concluded treatment of powdered wild apricot kernels with 0.3 % (Pectazyme + Mashzyme) combination was highly effective in increasing oil recovery by 14.22 % without adversely affecting the quality and thus may be commercially used by the industry for reducing wastage of highly precious oil in the cake.

Standardization of technology for preparation and storage of wild apricot fruit bar.

The study was conducted to standardize the protocol for preparation of wild apricot fruit bar. Wild apricot fruits were harvested at optimum maturity from Distt Tehri Garhwal, Uttarakhand and after thorough sorting and proper washing, used for hot extraction of pulp through a pulper. Pulp was preserved in 500 ppm SO2 (using potassium metabisulphite). For preparation of fruit bars, additives like sugar and pectin were added to the pulp in different proportions and the mixture dried in mechanical dehydrator. Dried fruit bar sheets were cut into rectangular shapes (2.5 × 4.0 cm(2)) using a stainless steel knife and wrapped in polythene paper. Best recipe was selected on the basis of sensory evaluation. For storage, wild apricot fruit bar was packed in aluminium laminated pouches and polyethylene pouches, kept for 6 months and analyzed periodically for changes in quality. Results of the sensory evaluation indicate that a very good quality fruit bar can be prepared by using wild apricot pulp +60% sugar +0.30% pectin and drying the mixture in a mechanical dehydrator at 55 ± 2 °C for 6 h. During 6 months of storage, there was about 3% moisture gain, 6.00 and 9.35% loss in total sugars and vitamin C respectively, along with slight losses in titratable acidity and sensory quality. The changes in chemical and sensory quality attributes were minimum in wild apricot fruit bar, packed in aluminium laminated pouches as compared to those packed in polyethylene pouches, and the product stored under vacuum than that under normal atmosphere. Further, the products were stable up to 6 months during storage under ambient condition.

Novel actions of progesterone: what we know today and what will be the scenario in the future?

OBJECTIVES: This article is aimed to review the novel actions of progesterone, which otherwise is considered as a female reproductive hormone. The article focuses on its important physiological actions in males too and gives an overview of its novel perspectives in disorders of central and peripheral nervous system. KEY FINDINGS: Progesterone may have a potential benefit in treatment of traumatic brain injury, various neurological disorders and male related diseases like benign prostatic hypertrophy (BPH), prostate cancer and osteoporosis. Norethisterone (NETA), a progesterone derivative, decreases bone mineral loss in male castrated mice suggesting its role in osteoporosis. In the future, progesterone may find use as a male contraceptive too, but still needs confirmatory trials for safety, tolerability and acceptability. Megestrol acetate, a progesterone derivative is preferred in prostatic cancer. Further, it may find utility in nicotine addiction, traumatic brain injury (recently entered Phase III trial) and Alzheimer's disease, diabetic neuropathy and crush injuries. Studies also suggest role of progesterone in stroke, for which further clinical trials are needed. The non genomic actions of progesterone may be in part responsible for these novel actions. SUMMARY: Although progesterone has shown promising role in various non-hormonal benefits, further clinical studies are needed to prove its usefulness in conditions like stroke, traumatic brain injury, neuropathy and crush injury. In male related illnesses like BPH and prostatic Ca, it may prove a boon in near future. New era of hormonal male contraception may be initiated by use of progesterone along with testosterone.

Comparative evaluation of genetic diversity using RAPD, SSR and cytochrome P450 gene based markers with respect to calcium content in finger millet (Eleusine coracana L. Gaertn.).

Genetic relationships among 52 Eleusine coracana (finger millet) genotypes collected from different districts of Uttarakhand were investigated by using randomly amplified polymorphic DNA (RAPD), simple sequence repeat (SSR) and cytochrome P450 gene based markers. A total of 18 RAPD primers, 10 SSR primers, and 10 pairs of cytochrome P450 gene based markers, respectively, revealed 49.4%, 50.2% and 58.7% polymorphism in 52 genotypes of E. coracana. Mean polymorphic information content (PIC) for each of these marker systems (0.351 for RAPD, 0.505 for SSR and 0.406 for cyt P450 gene based markers) suggested that all the marker systems were effective in determining polymorphisms. Pair-wise similarity index values ranged from 0.011 to 0.999 (RAPD), 0.010 to 0.999 (SSR) and 0.001 to 0.998 (cyt P450 gene based markers) and mean similarity index value of 0.505, 0.504 and 0.499, respectively. The dendrogram developed by RAPD, SSR and cytochrome P450 gene based primers analyses revealed that the genotypes are grouped in different clusters according to high calcium (300-450 mg/100 g), medium calcium (200-300 mg/100 g) and low calcium (100-200 mg/100 g). Mantel test employed for detection of goodness of fit established cophenetic correlation values above 0.95 for all the three marker systems. The dendrograms and principal coordinate analysis (PCA) plots derived from the binary data matrices of the three marker systems are highly concordant. High bootstrap values were obtained at major nodes of phenograms through WINBOOT software. Comparison of RAPD, SSR and cytochrome P450 gene based markers, in terms of the quality of data output, indicated that SSRs and cyt P450 gene based markers are particularly promising for the analysis of plant genome diversity. The genotypes of finger millet collected from different districts of Uttarakhand constitute a wide genetic base and clustered according to calcium contents. The identified genotypes could be used in breeding programmes and amajor input into conservation biology of cereal crops.

Identification of novel genes regulated by LH in the primate corpus luteum: insight into their regulation during the late luteal phase.

The process of luteinization, during which granulosa cells are transformed into luteal cells, is accompanied by dramatic changes in the response of luteal cells to LH. Although luteal cells require LH-cAMP signalling cascade for survival, whether these cells respond to trophic factors through changes in gene expression remains poorly characterized. In an attempt to characterize gonadotrophin (LH)-regulated gene expression in the bonnet monkey corpus luteum (CL), changes in gene expression after GnRH antagonist treatment to inhibit LH secretion, different stages of CL and during hCG-simulated early pregnancy were examined using differential display RT-PCR, Northern blot and semiquantitative RT-PCR analyses. We have identified seven non-redundant cDNA's whose expression were regulated by LH. The results show that inhibition of LH secretion not only leads to down-regulation in the expression of genes, e.g. low density lipoprotein (LDL) receptor and Aldose reductase, but expression of some of the genes was up-regulated, e.g. Humanin, RNA helicase, Lyric protein, Acidic ribosomal phosphoprotein and KIAA1750. mRNA levels of the genes identified as up-regulated after LH inhibition were higher during late compared to the early and mid-luteal phase CL, but treatment with hCG down-regulated their expressions. We conclude that we have identified novel genes (known and unknown) that are up or down-regulated by LH, and the results suggest that LH-mediated activation and repression of expression of many genes is central to the regulation of the structure and function of the CL in the monkey.