Precise quantification of microRNAs based on proximity ligation of AuNPs-immobilized DNA probes.

MiRNAs are critical regulators of target gene expression in many biological processes and are considered promising biomarkers for diseases. In this study, we developed a simple, specific, and sensitive miRNA detection method based on proximity ligation reaction, which is easy to operate. The method uses a pair of target-specific DNA probes immobilized on the same gold nanoparticles (AuNPs), which hybridize to the target miRNA. Hybridization brings the probes close together, allowing the formation of a continuous DNA sequence that can be amplified by Quantitative Real-time PCR (qPCR). This method eliminates the need for complex reverse transcription design and achieves high specificity for discriminating single base mismatches between miRNAs through a simple procedure. This method can sensitively measure three different miRNAs with a detection limit of 20 aM, providing high versatility and sensitivity, even distinguishing single-base variations among members of the miR-200 family with high selectivity. Due to its high selectivity and sensitivity, this method has important implications for the investigation of miRNA biological functions and related biomedical research.

Approved immune checkpoint inhibitors in hepatocellular carcinoma: a large-scale meta-analysis and systematic review.

A meta-analysis was performed to assess the benefits and safety profile of approved immune checkpoint inhibitors in hepatocellular carcinoma patients. Eligible studies were searched from Cochrane, Embase, and PubMed databases based on a well-established strategy. Following the exclusion of ineligible studies, 12 studies were included in this meta-analysis. Compared with control group, immune checkpoint inhibitors were associated with improved ORR (OR 3.03, 95% CI 2.26-4.05, P < 0.00001), SD (OR 0.77, 95% CI 0.62-0.95, P = 0.02), OS (HR 0.75, 95% CI 0.68-0.83, P < 0.00001), and PFS (HR 0.74, 95% CI 0.63-0.87, P < 0.0003). However, no significant differences were observed in DCR (OR 1.33, 95% CI 0.97-1.81, P = 0.07), PD (OR 0.90, 95% CI 0.67-1.21, P = 0.48), and all caused any-grade adverse events (OR 1.22, 95% CI 0.62-2.39, P = 0. 57), all caused ≥ grade 3 adverse events (OR 1.10, 95% CI 0.97-1.25, P = 0.14), treatment-related any-grade adverse events (OR 1.13, 95% CI 0.55-2.32, P = 0.73), and treatment-related ≥ grade 3 events (OR 0.82, 95% CI 0.34-1.97, P = 0.65) between the two groups. After subgroup analysis conducted, patients in the immune checkpoint inhibitor group compared with targeted drug group showed significant improvements in OS (HR 0.74, 95% CI 0.66-0.84, P < 0.00001) and PFS (HR 0.75, 95% CI 0.61-0.91, P = 0.004). Immune checkpoint inhibitors have demonstrated peculiar benefits in the treatment of HCC with an acceptable safety profile. Compared to targeted drugs, immune checkpoint inhibitors still offer advantages in the treatment of hepatocellular carcinoma. However, there is still considerable room for further improvement.

Prenatal diagnosis and outcomes in fetuses with duplex kidney.

OBJECTIVE: Duplex kidney is a relatively frequent form of urinary system abnormality. This study aimed to elucidate the value of chromosomal microarray analysis (CMA) and whole exome sequencing (WES) for duplex kidney and the perinatal outcomes of duplex kidney fetuses. METHODS: This retrospective cohort study included 63 patients with duplex kidney diagnosed using antenatal ultrasound between August 2013 and January 2023. We reviewed the clinical characteristics, genetic test results, and pregnancy outcomes of the patients. RESULTS: Among the 63 cases based on the inclusion criteria, the CMA detected seven (11.1%) clinically significant variants and nine variants of uncertain significance (VUS), and the pathogenic/likely pathogenic (P/LP) copy number variations (CNVs) in the recurrent region that were associated with prenatal duplex kidney included 17q12, 17p13.3, and 22q11.2. No significant disparity was observed in the CMA detection rate between the unilateral and bilateral groups, or between the isolated and non-isolated groups. WES identified three (50%) P/LP single-gene variants in six fetuses with duplex kidney. We detected the following pathogenic genes in the duplex kidney fetuses: KMT2D, SMPD4, and FANCI. Pregnancy termination in cases where clinically significant variants were detected by genetic testing was different in statistical significance from that in cases with negative results (9/10, 90.0% vs 8/48, 16.7%, P < 0.001). CONCLUSION: This study elucidated the value of CMA and WES for fetal duplex kidney, proving that CMA and WES may be useful tools in prenatal diagnosis and genetic counseling.

Functional analysis of a novel splice site variant in the ASAH1 gene.

BACKGROUND: Acid ceramidase (ACDase) deficiency is an ultrarare autosomal recessive lysosomal disorder caused by pathogenic N-acylsphingosine amidohydrolase (ASAH1) variants. It presents with either Farber disease (FD) or spinal muscular atrophy with progressive myoclonic epilepsy (SMA-PME). OBJECTIVE: The study aims to identify a novel splice site variant in a hydrops fetus that causes ASAH1-related disorder, aid genetic counseling, and accurate prenatal diagnosis. METHODS: We report a case of hydrops fetalis with a novel homozygous mutation in ASAH1 inherited from non-consanguineous parents. We performed copy number variation sequencing (CNV-Seq) and whole exome sequencing (WES) on the fetus and family, respectively. Minigene splicing analyses were conducted to confirm the pathogenic variants. RESULTS: WES data revealed a splice site variant of the ASAH1 (c.458-2A>T), which was predicted to affect RNA splicing. Minigene splicing analyses found that the c.458-2A>T variant abolished the canonical splicing of intron 6, thereby activating two cryptic splicing products (c.456_458ins56bp and c.458_503del). CONCLUSIONS: Overall, we identified a novel splice site variant in the mutational spectrum of ASAH1 and its aberrant effect on splicing. These findings highlight the importance of ultrasonic manifestation and family history of fetal hydrops during ASAH1-related disorders and could also aid genetic counseling and accurate prenatal diagnosis. To the best of our knowledge, this is the shortest-lived account of ASAH1-related disorders in utero with severe hydrops fetalis.

Prenatal diagnosis of polycystic renal diseases: diagnostic yield, novel disease-causing variants, and genotype-phenotype correlations.

BACKGROUND: Polycystic renal disease is a frequent congenital anomaly of the kidneys, but research using chromosomal microarray analysis and exome sequencing in fetuses with polycystic renal disease remains sparse, with most studies focusing on the multisystem or genitourinary system. OBJECTIVE: This study aimed to assess the detection rate of detectable genetic causes of fetal polycystic renal disease at different levels, novel disease-causing variants, and genotype-phenotype correlations. STUDY DESIGN: This study included 220 fetal polycystic renal disease cases from January 2014 to June 2022. Cases were divided into the following 3 groups: isolated multicystic dysplastic kidneys, nonisolated multicystic dysplastic kidneys, and suspected polycystic kidney disease group. We reviewed data on maternal demographics, ultrasonographic results, chromosomal microarray analysis/exome sequencing results, and pregnancy outcomes. RESULTS: In our cohort, chromosomal microarray analysis identified 19 (8.6%) fetuses carrying chromosomal abnormalities, and the most common copy number variation was 17q12 microdeletion (7/220; 3.2%). Furthermore, 94 families chose to perform trio-exome sequencing testing, and 21 fetuses (22.3%) were found to harbor pathogenic/likely pathogenic variants. There was a significant difference in the live birth rate among the 3 groups (91/130 vs 46/80 vs 1/10; P<.001). Among 138 live birth cases, 106 (78.5%) underwent postnatal ultrasound review, of which 95 (89.6%) had a consistent prenatal-postnatal ultrasound diagnosis. CONCLUSION: For both isolated and nonisolated polycystic renal disease, our data showed high detection efficiency with both testing tools. The detection of novel pathogenic variants expands the known disease spectrum of polycystic renal disease-associated genes while enriching our understanding of the genotype-phenotype correlation. Therefore, we consider it feasible to perform chromosomal microarray analysis+exome sequencing testing in fetal polycystic renal disease. Moreover, prenatal-postnatal ultrasound concordance was greater, the live birth rate was higher, and prognosis was better when known genetic disorders were excluded, indicating that genetic testing results significantly influenced pregnancy decisions.

Exome sequencing improves genetic diagnosis of congenital orofacial clefts.

Objective: This retrospective study aims to evaluate the utility of exome sequencing (ES) in identifying genetic causes of congenital orofacial clefts (OFCs) in fetuses with or without other structural abnormalities, and to further explore congenital OFCs genetic causes. Methods: The study enrolled 107 singleton pregnancies diagnosed with fetal OFCs between January 2016 and May 2022, and categorized them into two groups: isolated cleft lip and/or palate (CL/CP) and syndromic CL/CP. Cases with positive karyotyping and chromosomal microarray analysis results were excluded. Whole-exome sequencing was performed on eligible fetuses and their parents. Monogenic variants identified by ES and perinatal outcomes were recorded and evaluated during postnatal follow-up. Results: Clinically significant variants were identified in 11.2% (12/107) of fetuses, with no significant difference in detection rate between the isolated CL/CP group and the syndromic CL/CP group (8/83, 9.6% vs. 4/24, 16.7%, p = 0.553). Additionally, sixteen (16/107, 15.0%) fetuses had variants of uncertain significance. We identified 12 clinically significant variations that correlated with clinical phenotypes in 11 genes from 12 fetuses, with CHD7 being the most frequently implicated gene (n = 2). Furthermore, we observed a significant difference in termination rates and survival rates between the isolated CL/CP and syndromic CL/CP groups (41.0% vs. 70.8% and 56.6% vs. 20.8%, p < 0.05 for both). Conclusion: Based on our findings, it is clear that ES provides a significant increase in diagnostic yield for the molecular diagnosis of congenital OFCs, thereby substantially improving the existing prenatal diagnostic capabilities. This study also sheds light on seven novel pathogenic variants, broadening our understanding of the genetic underpinnings of OFCs and expanding the disease spectrums of relevant genes.

Influence of Al Addition on the Microstructure and Mechanical Properties of Mg-Zn-Sn-Mn-Ca Alloys.

The effects of Al addition on the microstructure and mechanical properties of Mg-Zn-Sn-Mn-Ca alloys are studied in this paper. It was found that the Mg-6Sn-4Zn-1Mn-0.2Ca-xAl (ZTM641-0.2Ca-xAl, x = 0, 0.5, 1, 2 wt.%; hereafter, all compositions are in weight percent unless stated otherwise) alloys have α-Mg, Mg2Sn, Mg7Zn3, MgZn, α-Mn, CaMgSn, AlMn, Mg32(Al,Zn)49 phases. The grain is also refined when the Al element is added, and the angular-block AlMn phases are formed in the alloys. For the ZTM641-0.2Ca-xAl alloy, the higher Al content is beneficial to elongation, and the double-aged ZTM641-0.2Ca-2Al alloy has the highest elongation, which is 13.2%. The higher Al content enhances the high-temperature strength for the as-extruded ZTM641-0.2Ca alloy; overall, the as-extruded ZTM641-0.2Ca-2Al alloy has the best performance; that is, the tensile strength and yield strength of the ZTM641-0.2Ca-2Al alloy are 159 MPa and 132 MPa at 150 °C, and 103 MPa and 90 MPa at 200 °C, respectively.

Corrigendum to "Establishment and functional characterization of the reversibly immortalized mouse glomerular podocytes (imPODs)" [Genes & Diseases 5 (2018) 137-149].

[This corrects the article DOI: 10.1016/j.gendis.2018.04.003.].

Corrigendum to "The development of a sensitive fluorescent protein-based transcript reporter for high throughput screening of negative modulators of lncRNAs" [Genes & Diseases 5 (2018) 62-74].

[This corrects the article DOI: 10.1016/j.gendis.2018.02.001.].

Corrigendum to "Characterization of the essential role of bone morphogenetic protein 9 (BMP9) in osteogenic differentiation of mesenchymal stem cells (MSCs) through RNA interference" [Genes & Diseases 5(2018):172-184].

[This corrects the article DOI: 10.1016/j.gendis.2018.04.006.].

Prenatal diagnosis in the fetal hyperechogenic kidneys: assessment using chromosomal microarray analysis and exome sequencing.

Fetal hyperechogenic kidneys (HEK) is etiologically a heterogeneous disorder. The aim of this study was to identify the genetic causes of HEK using prenatal chromosomal microarray analysis (CMA) and exome sequencing (ES). From June 2014 to September 2022, we identified 92 HEK fetuses detected by ultrasound. We reviewed and documented other ultrasound anomalies, microscopic and submicroscopic chromosomal abnormalities, and single gene disorders. We also analyzed the diagnostic yield of CMA and ES and the clinical impact the diagnosis had on pregnancy management. In our cohort, CMA detected 27 pathogenic copy number variations (CNVs) in 25 (25/92, 27.2%) fetuses, with the most common CNV being 17q12 microdeletion syndrome. Among the 26 fetuses who underwent further ES testing, we identified 7 pathogenic/likely pathogenic variants and 8 variants of uncertain significance in 9 genes in 12 fetuses. Four novel variants were first reported herein, expanding the mutational spectra for HEK-related genes. Following counseling, 52 families chose to continue the pregnancy, and in 23 of them, postnatal ultrasound showed no detectable renal abnormalities. Of these 23 cases, 15 had isolated HEK on prenatal ultrasound. Taken together, our study showed a high rate of detectable genetic etiologies in cases with fetal HEK at the levels of chromosomal (aneuploidy), sub-chromosomal (microdeletions/microduplications), and single gene (point mutations). Therefore, we speculate that combined CMA and ES testing for fetal HEK is feasible and has good clinical utility. When no genetic abnormalities are identified, the findings can be transient, especially in the isolated HEK group.

Whole exome sequencing improves genetic diagnosis of fetal clubfoot.

OBJECTIVE: This retrospective study aimed to investigate the value of whole exome sequencing (WES) for clubfoot (CF) fetuses with or without other structural abnormalities and to further explore the genetic causes of fetal CF. METHODS: this study included 83 singleton pregnancies diagnosed with fetal CF referred to our center between January 2016 and March 2022; cases were divided into two groups: isolated CF and non-isolated CF. After excluding cases with positive karyotyping and chromosomal microarray analysis results, WES was performed for the eligible fetuses and parents. Monogenic variants detected by WES and perinatal outcomes were recorded and evaluated at postnatal follow-up. RESULTS: overall, clinically significant variations were identified in 12.0% (10/83) of fetuses, and the detection rate was significantly higher in the non-isolated than in the isolated CF group (8/36, 22.2% vs. 2/47, 4.3%, p = 0.031). We additionally detected eight (9.6%) fetuses harboring variants of unknown significance. We identified 11 clinically significant variations correlating with clinical phenotypes in nine genes from ten fetuses, with KLHL40 being the most frequent (n = 2). Furthermore, we observed a significant difference in termination and survival rates between isolated and non-isolated CF cases (27.6 vs. 77.8% and 59.6 vs. 19.4%, p < 0.001 for both). CONCLUSION: our data indicate that WES has a high additional diagnostic yield for the molecular diagnosis of fetal CF, markedly enhancing existing prenatal diagnostic capabilities and expanding our understanding of intrauterine genetic disorders, thus assisting us to better interpret fetal phenotype in the future.

HCG11 inhibits salivary adenoid cystic carcinoma by upregulating EphA2 via binding to miR-1297.

OBJECTIVE: Ephrin receptor A2 (EphA2) was reported to be related to the tumorigenesis of salivary adenoid cystic carcinoma (SACC), which is a rare malignancy accounting for less than 1% of all oral and maxillofacial tumors. This research aimed to assess the molecular mechanisms of EphA2 in SACC. STUDY DESIGN: The expression of long non-coding RNA human leukocyte antigen complex group 11 (HCG11), microRNA-1297 (miR-1297), and EphA2 in SACC cell lines compared with normal human salivary gland (HSG) cell line was measured by reverse transcription-quantitative polymerase chain reaction. EphA2 protein level was detected by western blot. 5-ethynyl-2'-deoxyuridine (EdU), colony formation, Transwell, and wounding healing experiments were applied to evaluate SACC cell proliferation, migration, and invasion. The relationship among HCG11, miR-1297, and EphA2 was confirmed by luciferase reporter, RNA pulldown, and RNA immunoprecipitation experiments. RESULTS: HCG11 and EphA2 were downregulated while miR-1297 was upregulated in SACC cells. EphA2 overexpression suppressed SACC cell proliferation, migration, and invasion. HCG11 bound to miR-1297 to reduce the inhibition of miR-1297 on EphA2 expression. EphA2 knockdown reversed the suppression of HCG11 overexpression on SACC cell phenotypes. CONCLUSION: This study identified the HCG11/miR-1297/EphA2 regulatory axis in SACC, which might provide novel therapeutic targets for SACC.

The Value of a Comprehensive Genomic Evaluation in Prenatal Diagnosis of Genetic Diseases: A Retrospective Study.

Currently, there are still many challenges in prenatal diagnosis, such as limited or uncertain fetal phenotyping, variant interpretation, and rapid turnaround times. The aim of this study was to illustrate the value of a comprehensive genomic evaluation in prenatal diagnosis. We retrospectively reviewed 20 fetuses with clinically significant copy number variants (CNVs) detected by chromosomal microarray analysis (CMA) and no further exome sequencing testing in our tertiary center between 2019 and 2020. The residual DNA from the prenatal cases was used for the parallel implementation of CNV sequencing (CNV-seq) and trio-based clinical exome sequencing (trio-CES). CMA revealed 26 clinically significant CNVs (18 deletions and eight duplications) in 20 fetuses, in which five fetuses had two or more CNVs. There were eight fetuses with pathogenic CNVs (e.g., del 1p36), nine fetuses with likely pathogenic CNVs (e.g., dup 22q11.21), and three fetuses with variants of unknown significance (VOUS, e.g., dup 1q21.1q21.2). Trio-CES identified four fetuses with likely pathogenic mutations (SNV/InDels). Of note, a fetus was detected with a maternally inherited hemizygous variant in the SLX4 gene due to a 16p13.3 deletion on the paternal chromosome. The sizes of CNVs detected by CNV-seq were slightly larger than that of the SNP array, and four cases with mosaic CNVs were all identified by CNV-seq. In conclusion, microdeletion/duplication syndromes and monogenic disorders may co-exist in a subject, and CNV deletion may contribute to uncovering additional recessive disease alleles. The application of a comprehensive genomic evaluation (CNVs and SNV/InDels) has great value in the prenatal diagnosis arena. CNV-seq based on NGS technology is a reliable and a cost-effective technique for identifying CNVs.

Identification of two CUL7 variants in two Chinese families with 3-M syndrome by whole-exome sequencing.

BACKGROUND: 3-M syndrome is a rare autosomal recessive disorder characterized by primordial growth retardation, large head circumference, characteristic facial features, and mild skeletal changes, which is associated with the exclusive variants in three genes, namely CUL7, OBSL1, and CCDC8. Only a few 3-M syndrome patients have been reported in Chinese population. METHODS: Children with unexplained severe short stature, facial dysmorphism, and normal intelligence in two Chinese families and their relatives were enrolled. Trio-whole-exome sequencing (trio-WES) and pathogenicity prediction analysis were conducted on the recruited patients. A conservative analysis of the mutant amino acid sequences and function prediction analysis of the wild-type (WT) and mutant CUL7 protein were performed. RESULTS: We identified a homozygous missense variant (NM_014780.4: c.4898C > T, p.Thr1633Met) in CUL7 gene in a 6-month-old female infant from a non-consanguineous family, and a homozygous frameshift variant (NM_014780.4: c.3722_3749 dup GGCTGGCACAGCTGCAGCAATGCCTGCA, p. Val1252Glyfs*23) in CUL7 gene in two affected siblings from a consanguinity family. These two variants may affect the properties and structure of CUL7 protein. CONCLUSION: These two rare variants were observed in Chinese population for the first time and have not been reported in the literature. Our findings expand the variant spectrum of 3-M syndrome in Chinese population and provide valuable insights into the early clinical manifestations and pathogenesis of 3-M syndrome for pediatricians and endocrinologists.

A simplified system for the effective expression and delivery of functional mature microRNAs in mammalian cells.

MicroRNAs (miRNAs) are ~22 nucleotide noncoding RNAs that are involved in virtually all aspects of cellular process as their deregulations are associated with many pathological conditions. Mature miRNAs (mMIRs) are generated through a series of tightly-regulated nuclear and cytoplasmic processing events of the transcribed primary, precursor and mMIRs. Effective manipulations of miRNA expression enable us to gain insights into miRNA functions and to explore potential therapeutic applications. Currently, overexpression of miRNAs is achieved by using chemically-synthesized miRNA mimics, or shRNA-like stem-loop vectors to express primary or precursor miRNAs, which are limited by low transfection efficacy or rate-limiting miRNA processing. To overcome rate-limiting miRNA processing, we developed a novel strategy to express mMIRs which are driven by converging U6/H1 dual promoters. As a proof-of-concept study, we constructed mMIR expression vectors for hsa-miR-223 and hsa-Let-7a-1, and demonstrated that the expressed mMIRs effectively silenced target gene expression, specifically suppressed miRNA reporter activity, and significantly affected cell proliferation, similar to respective primary and precursor miRNAs. Furthermore, these mMIR expression vectors can be easily converted into retroviral and adenoviral vectors. Collectively, our simplified mMIR expression system should be a valuable tool to study miRNA functions and/or to deliver miRNA-based therapeutics.

A large scale meta analysis identifies common adverse events with checkpoint inhibitors vs chemotherapy in melanoma patients.

BACKGROUND: A meta-analysis was performed to assess the risk of common adverse events in melanoma patients treated with checkpoint inhibitors. METHODS: Eligible studies were downloaded from PubMed, Embase, and Cochrane databases based on an established strategy. Review manager version 5.3 was used to analyze data. RESULTS: After exclusion of ineligible studies, six studies were finally included in the meta-analysis, which comprised of 2136 patients in intervention group and 1773 patients in control group. There was a difference in low grade risk of pruritus (OR 5.63, 95% CI 2.92-10.85, P < 0.00001), diarrhea/colitis (OR 1.51, 95% CI 1.09-2.09, P = 0.01), but not fatigue (low grade, OR 0.96, 95% CI 0.72-1.29, P = 0.80; high grade, OR 0.72, 95% CI 0.23-2.24, P = 0.57) and some high grade risk between the intervention group and control group. Subgroups analysis revealed that low grade risk of pruritus (OR 8.17, 95% CI 4.29-15.55, P < 0.00001) and high grade risk of pruritus (OR 7.08, 95% CI 1.25-40.09, P = 0.03) were significantly different between patients treated with chemotherapy and those treated with checkpoint inhibitors. But fatigue and diarrhea/colitis were not different between the two groups. CONCLUSION: Checkpoint inhibitors are associated with a higher risk in some side effects than chemotherapy in melanoma patients. Therefore, strategies that reduce the risk of adverse events in patients taking checkpoint inhibitors should be developed.

BMP9-induced osteoblastic differentiation requires functional Notch signaling in mesenchymal stem cells.

Mesenchymal stem cells (MSCs) are multipotent progenitors that can differentiate into multiple lineages including osteoblastic lineage. Osteogenic differentiation of MSCs is a cascade that recapitulates most, if not all, of the molecular events occurring during embryonic skeletal development, which is regulated by numerous signaling pathways including bone morphogenetic proteins (BMPs). Through a comprehensive analysis of the osteogenic activity, we previously demonstrated that BMP9 is the most potent BMP for inducing bone formation from MSCs both in vitro and in vivo. However, as one of the least studied BMPs, the essential mediators of BMP9-induced osteogenic signaling remain elusive. Here we show that BMP9-induced osteogenic signaling in MSCs requires intact Notch signaling. While the expression of Notch receptors and ligands are readily detectable in MSCs, Notch inhibitor and dominant-negative Notch1 effectively inhibit BMP9-induced osteogenic differentiation in vitro and ectopic bone formation in vivo. Genetic disruption of Notch pathway severely impairs BMP9-induced osteogenic differentiation and ectopic bone formation from MSCs. Furthermore, while BMP9-induced expression of early-responsive genes is not affected by defective Notch signaling, BMP9 upregulates the expression of Notch receptors and ligands at the intermediate stage of osteogenic differentiation. Taken together, these results demonstrate that Notch signaling may play an essential role in coordinating BMP9-induced osteogenic differentiation of MSCs.