Hypoxia differently regulates the proportion of ALDHhi cells in lung squamous carcinoma H520 and adenocarcinoma A549 cells via the Wnt/ß-catenin pathway.

BACKGROUND: Cancer stem cells (CSCs) are a specific subpopulation of cancer cells with the ability of self-renewal, infinite proliferation, multidifferentiation and tumorigenicity, and play critical roles in cancer progression and treatment resistance. CSCs are tightly regulated by the tumor microenvironment, such as hypoxia; however, how hypoxia regulates CSCs in non-small cell lung cancer (NSCLC) remains unclear. METHODS: The proportion of ALDHhi cells was examined using the Aldefluor assay. Tankyrase inhibitor XAV939 and siRNA were used to inhibit ß-catenin while pcDNA3-ß-catenin (S33Y) plasmid enhanced the expression of ß-catenin. Western blot was administered for protein detection. The mRNA expression was measured by quantitative real-time PCR. RESULTS: We found that hypoxia led to an increase in the proportion of ALDHhi cells in lung squamous carcinoma (LUSC) H520 cells, while causing a decrease in the ALDHhi cell proportion in lung adenocarcinoma (LUAD) A549 cells. Similarly, ß-catenin expression was upregulated in H520 cells but downregulated in A549 cells upon exposure to hypoxia. Mechanically, the proportion of ALDHhi cells in both cell lines was decreased by ß-catenin inhibitor or siRNA knockdown, whereas increased after ß-catenin overexpression. Furthermore, hypoxia treatment suppressed E-cadherin expression in H520 cells and enhanced N-cadherin and ß-catenin expression, while this effect was completely opposite in A549 cells. CONCLUSION: The hypoxia-EMT-ß-catenin axis functions as an important regulator for the proportion of CSCs in NSCLC and could potentially be explored as therapeutic targets in the future.

Deciphering metabolic heterogeneity in retinoblastoma unravels the role of monocarboxylate transporter 1 in tumor progression.

BACKGROUND: Tumors exhibit metabolic heterogeneity, influencing cancer progression. However, understanding metabolic diversity in retinoblastoma (RB), the primary intraocular malignancy in children, remains limited. METHODS: The metabolic landscape of RB was constructed based on single-cell transcriptomic sequencing from 11 RB and 5 retina samples. Various analyses were conducted, including assessing overall metabolic activity, metabolic heterogeneity, and the correlation between hypoxia and metabolic pathways. Additionally, the expression pattern of the monocarboxylate transporter (MCT) family in different cell clusters was examined. Validation assays of MCT1 expression and function in RB cell lines were performed. The therapeutic potential of targeting MCT1 was evaluated using an orthotopic xenograft model. A cohort of 47 RB patients was analyzed to evaluate the relationship between MCT1 expression and tumor invasion. RESULTS: Distinct metabolic patterns in RB cells, notably increased glycolysis, were identified. This metabolic heterogeneity correlated closely with hypoxia. MCT1 emerged as the primary monocarboxylate transporter in RB cells. Disrupting MCT1 altered cell viability and energy metabolism. In vivo studies using the MCT1 inhibitor AZD3965 effectively suppressed RB tumor growth. Additionally, a correlation between MCT1 expression and optic nerve invasion in RB samples suggested prognostic implications. CONCLUSIONS: This study enhances our understanding of RB metabolic characteristics at the single-cell level, highlighting the significance of MCT1 in RB pathogenesis. Targeting MCT1 holds promise as a therapeutic strategy for combating RB, with potential prognostic implications.

Preparation and characterization of vitamin E microcapsules stabilized by Zein with different polysaccharides.

Vitamin E (VE) microencapsulation using a green surfactant emulsifier not only protects the active substance and is also environmentally friendly. In this study, we used alcohol ether glycoside as an emulsifier to prepare VE microcapsules using the biological macromolecule Zein and various polysaccharides. The resulting nano microcapsules exhibited a spherical structure, stable morphology, uniform size, and a >90% encapsulation efficiency. They also had good thermal stability and slow-release properties. Of these, xanthan gum/Zein-VE microcapsules were superior, with antioxidant properties up to 3.05-fold higher than untreated VE. We successfully developed VE nano microcapsules that meet eco-friendly and sustainable requirements, which may have applications in the food and pharmaceutical industries.

Nanotechnological advances in cancer: therapy a comprehensive review of carbon nanotube applications.

Nanotechnology is revolutionising different areas from manufacturing to therapeutics in the health field. Carbon nanotubes (CNTs), a promising drug candidate in nanomedicine, have attracted attention due to their excellent and unique mechanical, electronic, and physicochemical properties. This emerging nanomaterial has attracted a wide range of scientific interest in the last decade. Carbon nanotubes have many potential applications in cancer therapy, such as imaging, drug delivery, and combination therapy. Carbon nanotubes can be used as carriers for drug delivery systems by carrying anticancer drugs and enabling targeted release to improve therapeutic efficacy and reduce adverse effects on healthy tissues. In addition, carbon nanotubes can be combined with other therapeutic approaches, such as photothermal and photodynamic therapies, to work synergistically to destroy cancer cells. Carbon nanotubes have great potential as promising nanomaterials in the field of nanomedicine, offering new opportunities and properties for future cancer treatments. In this paper, the main focus is on the application of carbon nanotubes in cancer diagnostics, targeted therapies, and toxicity evaluation of carbon nanotubes at the biological level to ensure the safety and real-life and clinical applications of carbon nanotubes.

CD276-dependent efferocytosis by tumor-associated macrophages promotes immune evasion in bladder cancer.

Interplay between innate and adaptive immune cells is important for the antitumor immune response. However, the tumor microenvironment may turn immune suppressive, and tumor associated macrophages are playing a role in this transition. Here, we show that CD276, expressed on tumor-associated macrophages (TAM), play a role in diminishing the immune response against tumors. Using a model of tumors induced by N-butyl-N-(4-hydroxybutyl) nitrosamine in BLCA male mice we show that genetic ablation of CD276 in TAMs blocks efferocytosis and enhances the expression of the major histocompatibility complex class II (MHCII) of TAMs. This in turn increases CD4 + and cytotoxic CD8 + T cell infiltration of the tumor. Combined single cell RNA sequencing and functional experiments reveal that CD276 activates the lysosomal signaling pathway and the transcription factor JUN to regulate the expression of AXL and MerTK, resulting in enhanced efferocytosis in TAMs. Proving the principle, we show that simultaneous blockade of CD276 and PD-1 restrain tumor growth better than any of the components as a single intervention. Taken together, our study supports a role for CD276 in efferocytosis by TAMs, which is potentially targetable for combination immune therapy.

The polymorphism analysis for CD36 among platelet donors.

CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.

Consistency Analysis of Programmed Death Ligand 1 Expression in Non-Small Cell Lung Cancer Between Pleural Effusion and Matched Primary Lung Cancer Tissues by Immunohistochemical Double Staining.

In clinical practice, programmed death ligand 1 (PD-L1) detection is prone to nonspecific staining due to the complex cellular composition of pleural effusion smears. In this study, diaminobenzidine (DAB) and 3-amino-9-ethylcarbazole (AEC) immunohistochemistry double staining was performed to investigate PD-L1 expression in tumor cells from malignant pleural effusion (MPE). MPE was considered as a metastasis in non-small cell lung cancer patients; thus, the heterogeneity between metastatic and primary lung cancer was revealed as well. Ninety paired specimens of MPE cell blocks and matched primary lung cancer tissues from non-small cell lung cancer patients were subjected to PD-L1 and thyroid transcription factor-1(TTF-1)/p63 immunohistochemistry double staining. Two experienced pathologists independently evaluated PD-L1 expression using 3 cutoffs (1%, 10%, and 50%). PD-L1 expression in MPE was strongly correlated with that in matched primary lung cancer tissues (R = 0.813; P < .001). Using a 4-tier scale (cutoffs: 1%, 10%, and 50%), the concordance was 71.1% (Cohen's κ = .534). Using a 2-tier scale, the concordance was 75.6% (1%, Cohen's κ = 0.53), 78.9% (10%, Cohen's κ = 0.574), and 95.6% (50%, Cohen's κ = 0.754). The rates of PD-L1 positivity in MPE (56.7%) were higher than that in lung tissues (32.2%). All 27 discordant cases had higher scores in MPE. The double-staining method provided superior identification of PD-L1-positive tumor cells on a background with nonspecific staining. In conclusion, PD-L1 expression was moderately concordant between metastatic MPE cell blocks and matched primary lung carcinoma tissues, with variability related to tumor heterogeneity. MPE should be considered to detect PD-L1 when histological specimens are unattainable, especially when PD-L1 expression is >50%. PD-L1 positivity rates were higher in MPE. Double staining can improve PD-L1 detection by reducing false-negative/positive results.

Biofluid biomarkers for Alzheimer's disease.

Alzheimer's disease (AD) is a multifactorial neurodegenerative disease, with a complex pathogenesis and an irreversible course. Therefore, the early diagnosis of AD is particularly important for the intervention, prevention, and treatment of the disease. Based on the different pathophysiological mechanisms of AD, the research progress of biofluid biomarkers are classified and reviewed. In the end, the challenges and perspectives of future research are proposed.

Composite System of Lauryl Glucoside and Lauryl Glycoside Sulfosuccinate: Properties and Applications in Vitamin E Nanoemulsions.

The synergistic effect of surfactant compounding on performance can be leveraged to enhance product application performance. An investigation of the surface tension and emulsification properties revealed the complex synergistic effect of the composite system comprising lauryl glucoside (LG) and lauryl glycoside sulfosuccinate (LG-SS). The composite system was used as an emulsifier for vitamin E (VE) emulsification. VE nanoemulsions with high VE content were successfully prepared. The nanoemulsion appears homogeneous and transparent and has an average size of approximately 200 nm. It has better temperature and centrifugal stability, an antioxidant capacity 2.89 times that of untreated VE, and is not easily oxidized and deactivated. In this study, we successfully constructed a complex system of LG and its derivatives and applied it to VE emulsification - this is a step toward expanding the effective application of glycosides and their derivative composite systems in food, pharmaceutics, and other industries.

The use of amino acids and their derivates to mitigate against pesticide-induced toxicity.

Exposure to pesticides induces oxidative stress and deleterious effects on various tissues in non-target organisms. Numerous models investigating pesticide exposure have demonstrated metabolic disturbances such as imbalances in amino acid levels within the organism. One potentially effective strategy to mitigate pesticide toxicity involves dietary intervention by supplementing exogenous amino acids and their derivates to augment the body's antioxidant capacity and mitigate pesticide-induced oxidative harm, whose mechanism including bolstering glutathione synthesis, regulating arginine-NO metabolism, mitochondria-related oxidative stress, and the open of ion channels, as well as enhancing intestinal microecology. Enhancing glutathione synthesis through supplementation of substrates N-acetylcysteine and glycine is regarded as a potent mechanism to achieve this. Selection of appropriate amino acids or their derivates for supplementation, and determining an appropriate dosage, are of the utmost importance for effective mitigation of pesticide-induced oxidative harm. More experimentation is required that involves large population samples to validate the efficacy of dietary intervention strategies, as well as to determine the effects of amino acids and their derivates on long-term and low-dose pesticide exposure. This review provides insights to guide future research aimed at preventing and alleviating pesticide toxicity through dietary intervention of amino acids and their derivates.

Acupuncture Extended the Thrombolysis Window by Suppressing Blood-Brain Barrier Disruption and Regulating Autophagy-Apoptosis Balance after Ischemic Stroke.

BACKGROUND: Ischemic stroke (IS) is one of the leading causes of death and disability worldwide. The narrow therapeutic window (within 4.5 h) and severe hemorrhagic potential limits therapeutic efficacy of recombinant tissue type plasminogen activator (rt-PA) intravenous thrombolysis for patients. Xingnao Kaiqiao (XNKQ) acupuncture is an integral part of traditional Chinese medicine, specifically designed to address acute ischemic stroke by targeting key acupoints such as Shuigou (GV26) and Neiguan (PC6). In this study, we explored the therapeutic potential of XNKQ acupuncture in extending the time window for thrombolysis and interrogated the molecular mechanisms responsible for this effect. METHODS: The effect of extending the thrombolysis window by acupuncture was evaluated via TTC staining, neuronal score evaluation, hemorrhagic transformation assay, and H&E staining. RNA sequencing (RNA-seq) technology was performed to identify the therapeutic targets and intervention mechanisms of acupuncture. Evans blue staining and transmission electron microscopy were used to assess blood-brain barrier (BBB) integrity. Immunofluorescence staining and co-immunoprecipitation were performed to evaluate the level of autophagy and apoptosis and validate their interactions with BBB endothelial cells. RESULTS: Acupuncture alleviated infarction and neurological deficits and extended the thrombolysis window to 6 h. The RNA-seq revealed 16 potential therapeutic predictors for acupuncture intervention, which related to suppressing inflammation and restoring the function of BBB and blood vessels. Furthermore, acupuncture suppressed BBB leakage and preserved tight junction protein expression. The protective effect was associated with regulation of the autophagy-apoptosis balance in BBB endothelial cells. Acupuncture intervention dissociated the Beclin1/Bcl-2 complex, thereby promoting autophagy and reducing apoptosis. CONCLUSION: XNKQ acupuncture could serve as an adjunctive therapy for rt-PA thrombolysis, aiming to extend the therapeutic time window and mitigate ischemia-reperfusion injury. Acupuncture suppressed BBB disruption by regulating the autophagy-apoptosis balance, which in turn extended the therapeutic window of rt-PA in IS. These findings provide a rationale for further exploration of acupuncture as a complementary candidate co-administered with rt-PA.

Associations between non-insulin-based insulin resistance indices and heart failure prevalence in overweight/obesity adults without diabetes mellitus: evidence from the NHANES 2001-2018.

BACKGROUND: The triglyceride glucose (TyG) index and triglyceride-to-high-density lipoprotein cholesterol (TG/HDL-C) ratio are recognized as simple non-insulin-based insulin resistance indices. Our study aimed to explore the relationship between these two indicators and heart failure (HF) in overweight or obesity individuals without diabetes. METHODS: This cross-sectional study selected 13,473 participants from the National Health and Nutrition Examination Survey (NHANES) 2001-2018 dataset. Weighted multivariable logistic regression and subgroup analysis were employed to evaluate the relationships between TyG index, TG/HDL-C ratio, and HF prevalence, respectively. Additionally, smooth curve fitting was utilized to analyze the dose-response relationships. RESULTS: A total of 13,473 obesity or overweight people without diabetes were included in this study through screening, among whom 291 (2.16%) had comorbid HF. The results of multivariable logistic regression suggested that the highest TyG index (OR = 2.4, 95% CI = 1.4-4.2, p = 0.002) and the highest TG/HDL-C ratio (OR = 1.2, 95% CI = 1.1-1.3, p < 0.001) both increased the prevalence of HF, especially in the non-Hispanic population. Dose-response relationships suggested nonlinear relationships between these two indicators and HF. CONCLUSION: Our study demonstrated that elevated TyG index and TG/HDL-C ratio were closely associated with the prevalence of HF, and both exhibited nonlinear relationships with HF prevalence in overweight/obesity adults without diabetes. Based on these findings, additional prospective studies are needed for further validation.

Sublethal effects of chlorantraniliprole on immunity in Spodoptera frugiperda (Smith) (Lepidoptera: Noctuidae): Promote encapsulation by upregulating a heat shock protein 70 family gene SfHSP68.1.

As an agricultural pest, the fall armyworm (FAW), Spodoptera frugiperda, poses a severe threat to agriculture in China. Chlorantraniliprole has been widely used to control this pest. In our previous studies, we discovered that LD10, LD20, and LD30 chlorantraniliprole promoted encapsulation in the 4th instar larvae of the FAW, with LD30 chlorantraniliprole having the most significant effect. To further investigate the molecular mechanism underlying the sublethal effects of chlorantraniliprole on encapsulation in the FAW, this study conducted the effects of encapsulation in 4th instar larvae of the FAW exposed to LD30 chlorantraniliprole. Then, we analyzed the transcriptome of the FAW hemolymph treated with LD30 chlorantraniliprole and identified genes related to encapsulation using RNAi. Our results showed that the encapsulation in the FAW was enhanced at 6, 12, 18, 24, and 48 h after exposure to LD30 chlorantraniliprole. Additionally, LD30 chlorantraniliprole significantly affected the expression of certain immune-related genes, with the heat shock protein 70 family gene SfHSP68.1 showing the most significant upregulation. Subsequent interference with SfHSP68.1 resulted in a significant inhibition of encapsulation in FAW. These findings suggested that LD30 chlorantraniliprole can promote encapsulation in the FAW by upregulating SfHSP68.1 expression. This study provides valuable insights into the sublethal effects of chlorantraniliprole on encapsulation in the FAW and the interaction between encapsulation and heat shock proteins (HSPs).

Optical Information Transmission and Multimode Fluorescence Anticounterfeiting of Ca2-xMgxGe7O16:Mn2.

Multimode emission of Mn2+ for multimode fluorescence anticounterfeiting is achieved by cation site and interstitial occupancy in Ca2-xMgxGe7O16. The rings in Ca2-xMgxGe7O16 have a significant distortion for Mn2+ ions to enter the ring interstitials with a luminescence center at 665 nm, which is supported by XRD refinement results and first-principles calculations. The interstitial Mn2+ ion has good thermal stability with an activation energy of 0.36 eV. Surprisingly, these two luminescence centers, the cation site Mn and the interstitial Mn, have an obvious afterglow, and the disappearing afterglow will reappear by heating or irradiating with the 980 nm laser. The afterglow is significantly enhanced, as MnO2 is used as the manganese source, which is explained in detail by the thermal luminescence spectrum. Finally, Ca2-xMgxGe7O16:Mn2+ fully demonstrates its excellent prospects in fluorescent anticounterfeiting, information encryption, and optical information storage.

Genetic overlap between schizophrenia and cognitive performance.

Schizophrenia (SCZ), a highly heritable mental disorder, is characterized by cognitive impairment, yet the extent of the shared genetic basis between schizophrenia and cognitive performance (CP) remains poorly understood. Therefore, we aimed to explore the polygenic overlap between SCZ and CP. Specifically, the bivariate causal mixture model (MiXeR) was employed to estimate the extent of genetic overlap between SCZ (n = 130,644) and CP (n = 257,841), and conjunctional false discovery rate (conjFDR) approach was used to identify shared genetic loci. Subsequently, functional annotation and enrichment analysis were carried out on the identified genomic loci. The MiXeR analyses revealed that 9.6 K genetic variants are associated with SCZ and 10.9 K genetic variants for CP, of which 9.5 K variants are shared between these two traits (Dice coefficient = 92.8%). By employing conjFDR, 236 loci were identified jointly associated with SCZ and CP, of which 139 were novel for the two traits. Within these shared loci, 60 exhibited consistent effect directions, while 176 had opposite effect directions. Functional annotation analysis indicated that the shared genetic loci were mainly located in intronic and intergenic regions, and were found to be involved in relevant biological processes such as nervous system development, multicellular organism development, and generation of neurons. Together, our findings provide insights into the shared genetic architecture between SCZ and CP, suggesting common pathways and mechanisms contributing to both traits.

Decoding emotional responses to AI-generated architectural imagery.

Introduction: The integration of AI in architectural design represents a significant shift toward creating emotionally resonant spaces. This research investigates AI's ability to evoke specific emotional responses through architectural imagery and examines the impact of professional training on emotional interpretation. Methods: We utilized Midjourney AI software to generate images based on direct and metaphorical prompts across two architectural settings: home interiors and museum exteriors. A survey was designed to capture participants' emotional responses to these images, employing a scale that rated their immediate emotional reaction. The study involved 789 university students, categorized into architecture majors (Group A) and non-architecture majors (Group B), to explore differences in emotional perception attributable to educational background. Results: Findings revealed that AI is particularly effective in depicting joy, especially in interior settings. However, it struggles to accurately convey negative emotions, indicating a gap in AI's emotional range. Architecture students exhibited a greater sensitivity to emotional nuances in the images compared to non-architecture students, suggesting that architectural training enhances emotional discernment. Notably, the study observed minimal differences in the perception of emotions between direct and metaphorical prompts among architecture students, indicating a consistent emotional interpretation across prompt types. Conclusion: AI holds significant promise in creating spaces that resonate on an emotional level, particularly in conveying positive emotions like joy. The study contributes to the understanding of AI's role in architectural design, emphasizing the importance of emotional intelligence in creating spaces that reflect human experiences. Future research should focus on expanding AI's emotional range and further exploring the impact of architectural training on emotional perception.

Therapeutic and immune-regulation effects of Scutellaria baicalensis Georgi polysaccharide on pseudorabies in piglets.

Pseudorabies virus (PRV) can cause fatal encephalitis in newborn pigs and escape the immune system. While there is currently no effective treatment for PRV, Scutellaria baicalensis Georgi polysaccharides (SGP) and Rodgersia sambucifolia Hemsl flavonoids (RHF) are traditional Chinese herbal medicines with potential preventive and therapeutic effects against PRV infection. In order to explore which one is more effective in the prevention and treatment of PRV infection in piglets. We investigate the therapeutic effects of RHF and SGP in PRV-infected piglets using clinical symptom and pathological injury scoring systems. The immune regulatory effects of RHF and SGP on T lymphocyte transformation rate, cytokines, T cells, and Toll-like receptors were also measured to examine the molecular mechanisms of these effects. The results showed that SGP significantly reduced clinical symptoms and pathological damage in the lungs, liver, spleen, and kidneys in PRV-infected piglets and the T lymphocyte conversion rate in the SGP group was significantly higher than that in the other treatment groups, this potential dose-dependent effect of SGP on T lymphocyte conversation. Serum immunoglobulin and cytokine levels in the SGP group fluctuated during the treatment period, with SGP treatment showing better therapeutic and immunomodulatory effects in PRV-infected piglets than RHF or the combined SGP + RHF treatment. In conclusion, RHF and SGP treatments alleviate the clinical symptoms of PRV infection in piglets, and the immunomodulatory effect of SGP treatment was better than that of the RHF and a combination of both treatments. This study provides evidence for SGP in controlling PRV infection in piglets.

The mediating effect of perceived stress on the relationship between big five personality traits and suboptimal health status in Chinese population: a nationwide survey in the framework of predictive, preventive, and personalized medicine.

Background: The effects of psychological factors on suboptimal health status (SHS) have been widely described; however, mechanisms behind the complex relationships among the Big Five personality traits and SHS are unclear. Identifying people with specific traits who are susceptible to SHS will help improve life quality and reduce the chronic disease burden under the framework of predictive, preventive, and personalized medicine (PPPM / 3PM). This study investigated the relationships among personality traits and SHS. It also explored whether perceived stress plays a mediating role in SHS development. Method: A nationwide cross-sectional survey based on multistage random sampling was conducted in 148 cities in China between June 20 and August 31, 2022. Personality traits, perceived stress, and SHS were evaluated using the Big Five Inventory-10 (BFI-10), the 4-item Perceived Stress Scale (PSS-4), and the Short-Form Suboptimal Health Status Questionnaire (SHSQ-SF), respectively. Pearson's correlation analysis was employed to examine the associations between personality traits, perceived stress, and SHS. Structural equation modeling (SEM) was used to discern the mediating role of perceived stress in the relationships among personality traits and SHS. Result: A total of 22,897 participants were enrolled in this study, among whom the prevalence of SHS was 52.9%. SHS was negatively correlated with three trait dimensions (i.e., extraversion, agreeableness, and conscientiousness) but positively correlated with neuroticism. Meanwhile, stress was negatively correlated with extraversion, agreeableness, conscientiousness, and openness, whereas it was positively correlated with neuroticism. The SEM results showed that, when adjusting for covariates (i.e., gender, age, BMI, educational level, current residence, marital status, and occupational status), higher agreeableness (ß = - 0.049, P < 0.001) and conscientiousness (ß = - 0.103, P < 0.001) led to lower SHS prevalence, higher neuroticism (ß = 0.130, P < 0.001), and openness (ß = 0.026, P < 0.001) caused SHS to be more prevalent. Perceived stress played a partial mediating role in the relationships among personality traits and SHS, respectively, contributing 41.3%, 35.9%, and 32.5% to the total effects of agreeableness, conscientiousness, and neuroticism on SHS. Additionally, the mediating impact of stress was significant even though extraversion had no direct effect on SHS. Conclusion: This study revealed a high prevalence of SHS in Chinese residents. Personality traits significantly influenced SHS rates, which perceived stress tended to mediate. From a PPPM perspective, early screening and targeted intervention for people with neuroticism (as well as stress alleviation) might contribute to health enhancement and chronic disease prevention. Supplementary Information: The online version contains supplementary material available at 10.1007/s13167-023-00349-x.

Mapping the landscape: a bibliometric analysis of resting-state fMRI research on schizophrenia over the past 25 years.

Schizophrenia, a multifaceted mental disorder characterized by disturbances in thought, perception, and emotion, has been extensively investigated through resting-state fMRI, uncovering changes in spontaneous brain activity among those affected. However, a bibliometric examination regarding publication trends in resting-state fMRI studies related to schizophrenia is lacking. This study obtained relevant publications from the Web of Science Core Collection spanning the period from 1998 to 2022. Data extracted from these publications included information on countries/regions, institutions, authors, journals, and keywords. The collected data underwent analysis and visualization using VOSviewer software. The primary analyses included examination of international and institutional collaborations, authorship patterns, co-citation analyses of authors and journals, as well as exploration of keyword co-occurrence and temporal trend networks. A total of 859 publications were retrieved, indicating an overall growth trend from 1998 to 2022. China and the United States emerged as the leading contributors in both publication outputs and citations, with Central South University and the University of New Mexico being identified as the most productive institutions. Vince D. Calhoun had the highest number of publications and citation counts, while Karl J. Friston was recognized as the most influential author based on co-citations. Key journals such as Neuroimage, Schizophrenia Research, Schizophrenia Bulletin, and Biological Psychiatry played pivotal roles in advancing this field. Recent popular keywords included support vector machine, antipsychotic medication, transcranial magnetic stimulation, and related terms. This study systematically synthesizes the historical development, current status, and future trends in resting-state fMRI research in schizophrenia, offering valuable insights for future research directions.