[Expression changes of RNA m6A regulators in mouse cerebellum affected by hypobaric hypoxia stimulation].

Objective: To investigate the role of RNA m6A methylation in mediating cerebellar dysplasia through analyzing the phenotypes of the mouse cerebella and the expression of several key m6A regulators upon hypobaric hypoxia treatment. Methods: Five-day old C57/BL6 mice were exposed to hypobaric hypoxia for 9 days. The status of mouse cerebellar development was analyzed by comparing the body weights, brain weights and histological features. Immunostaining of cell-type-specific markers was performed to analyze the cerebellar morphology. Real-time PCR, Western blot and immunohistochemical staining were performed to detect the expression of key m6A regulators in the mouse cerebella. Results: Compared with the control, the body weights, brain weights and cerebellar volumes of hypobaric hypoxic mice were significantly reduced (P<0.01). The expression of specific markers in different cells, including NeuN (mature neuron), Calbindin-D28K (Purkinje cell) and GFAP (astrocyte), was decreased in hypobaric hypoxic mouse cerebella (P<0.01), accompanied with disorganized cellular structure. The expression of methyltransferase METTL3 was significantly down-regulated in the cerebella of hypobaric hypoxic mice (P<0.05). Conclusions: Hypobaric hypoxia stimulation causes mouse cerebellar dysplasia, with structural abnormalities in mature granular neurons, Purkinje cells and astrocytes. Expression of METTL3 is decreased in hypobaric hypoxic mice cerebellum compared with that of normobaric normoxic mice, suggesting that its mediated RNA m6A methylation may play an important role in hypobaric hypoxia-induced mouse cerebellar dysplasia.

[A case report of bronchial granular cell tumor].

Granular cell tumor (GCT) is a relatively rare tumor that develops in soft tissues at various sites in the body, and GCT originating in the bronchus is rather rare. Here, we reported a case of primary GCT of the bronchial to improve the understanding of this disease.

[Gastric cancer-derived mesenchymal stem cells regulate the M2 polarization of macrophages within gastric cancer microenvironment via JAK2/STAT3 signaling pathway].

Objective: To investigate the role and mechanism of tumor-derived mesenchymal stem cells in regulating the M2 polarization of macrophages within gastric cancer microenvironment. Methods: Gastric cancer tissues and the adjacent non-cancerous tissues were collected from patients underwent gastric cancer resection in the First People's Hospital of Lianyungang during 2018. In our study, THP-1-differentiated macrophages were co-cultured with gastric cancer-derived mesenchymal stem cells (GC-MSCs). Then, the M2 subtype-related gene, the markers expressed on cell surface and the cytokine profile were analyzed by real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR), flow cytometry and Luminex liquid chip, respectively. The key cytokines mediating the inducing effect of GC-MSCs on macrophage polarization into the M2 subtype were detected and screened by Luminex liquid chip, which were further confirmed by the neutralizing antibody test. The expressions of macrophage proteins involved in M2 polarization-related signaling pathways under the different co-culture conditions of GC-MSCs were detected by western blot. Results: In Mac+ GC-MSC-culture medium (CM) group, the expression levels of Ym-1 and Fizz-1 (1.53±0.32 and 13.22±1.05, respectively), which are markers for M2 subtype, were both significantly higher than those of Mac group (1.00±0.05 and 1.21±0.38, respectively, P<0.05). The level of iNOS in Mac+ GC-MSC-CM group (0.60±0.41) was significantly lower than that of Mac group (1.06±0.38, P=0.023). In Mac+ GC-MSC-Transwell (TW) group, the expression levels of Ym-1 and Fizz-1 (1.47±0.09 and 13.16±2.77, respectively) were both significantly higher than those of Mac group (1.00±0.05 and 1.21±0.38, respectively, P<0.05). The level of iNOS in Mac+ GC-MSC-CM group (0.56±0.03) was significantly lower than that of Mac group (1.06±0.38, P=0.026). The ratios of CD163(+) /CD204(+) cells in Mac+ GC-MSC-CM and Mac+ GC-MSC-TW groups (3.80% and 4.40%, respectively) were both remarkably higher than that of Mac group (0.60%, P<0.05). The expression levels of IL-10, IL-6, MCP-1 and VEGF in Mac+ GC-MSC-CM group were (592.60±87.52), (1 346.80±64.70), (11 256.00±29.03) and (1 463.90±66.67) pg/ml, respectively, which were significantly higher than those of Mac group [(41.03±2.59), (17.35±1.79), (5 213.30±523.71) and (267.12±12.06) pg/ml, respectively, P<0.05]. The levels of TNF-α, IP-10, RANTES and MIP-1α were (95.57±9.34), (410.48±40.68), (6 967.30±1.29) and (1 538.70±283.04) pg/ml, which were significantly lower than those of Mac group [(138.01±24.31, (1 298.60±310.50), (14 631.00±4.21) and (6 633.20±1.47) pg/ml, respectively, P<0.05]. The levels of IL-6 and IL-8 in GC-MSCs [(11 185.02±2.82) and (12 718.03±370.17) pg/ml, respectively] were both strikingly higher than those of MSCs from adjacent non-cancerous gastric cancer tissues [(270.71±59.38) and (106.04±32.84) pg/ml, repectively, P<0.05]. The ratios of CD86(+) cells in Mac+ IL-6-blocked-GC-MSC-CM and Mac+ IL-8-blocked-GC-MSC-CM groups (28.80% and 31.40%, respectively) were both higher than that of Mac+ GC-MSC-CM group (24.70%). Compared to Mac+ GC-MSC-CM group (13.70%), the ratios of CD204(+) cells in Mac+ IL-6-blocked-GC-MSC-CM and Mac+ IL-8-blocked-GC-MSC-CM groups (9.90% and 8.70%, separately) were reduced. The expression levels of p-JAK2 and p-STAT3, which are proteins of macrophage M2 polarization-related signaling pathway, in Mac+ GC-MSC-CM group (0.86±0.01 and 1.08±0.01, respectively) were significantly higher than those of Mac group (0.50±0.01 and 0.82±0.01, respectively, P<0.05). The expression levels of p-JAK2 in Mac+ IL-6-blocked-GC-MSC-CM group (0.47±0.02) were significantly lower those that of Mac+ GC-MSC-CM group (0.86±0.01, P<0.05). The expression levels of p-JAK2 and p-STAT3 in Mac+ IL-8-blocked-GC-MSC-CM group (0.50±0.01 and 0.85±0.01, respectively) were both significantly lower than those of Mac+ GC-MSC-CM group (0.86±0.01 and 1.08±0.01, P<0.05). The expression levels of p-JAK2 and p-STAT3 in Mac+ IL-6/IL-8-blocked-GC-MSC-CM group (0.37±0.01 and 0.65±0.01, respectively) were both significantly lower than those of Mac+ GC-MSC-CM group (0.86±0.01 and 1.08±0.01, P<0.05). Conclusion: GC-MSCs promote the activation of JAK2/STAT3 signaling pathway in macrophages via high secretions of IL-6 and IL-8, which subsequently induce the macrophage polarization into a pro-tumor M2 subtype within gastric cancer microenvironment.

[Detection of circulating tumor cells with chromosomes 7 and 8 polysomy in non-small cell lung cancer and its correlation with epidermal growth factor receptor mutations in cancer tissue].

Objective: To investigate the value of chromosomes 7 and 8 polysomy in circulating tumor cells (CTCs) for the diagnosis of non-small cell lung cancer, and the correlation of CTCs with clinical pathological characteristics and epidermal growth factor receptor (EGFR) mutations in cancer tissue. Methods: Fifty-seven patients with non-small cell lung cancer and 21 patients with benign lung diseases were enrolled at Beijing Chaoyang Hospital, Capital Medical University, Beijing, China from November 2017 to October 2020. Negative enrichment combined with immunofluorescence in situ hybridization (imFISH) was used to identify CTCs polysomy on chromosomes 7 and 8. EGFR mutations in 56 lung cancer patients was detected using ARMS-PCR. Results: CTCs were detected in 93.0% (53/57) of non-small cell lung cancers and 28.6% (6/21) benign lung lesions. The difference between lung cancer patients and the control cohort was statistically significant (P<0.01). Receive operator curve (ROC) analyses showed that, when the cut-off value was 1 cell/3.2 mL, Youden index had the highest sensitivity of 93.0% and specificity of 71.4% (AUC=0.906, 95%CI:0.833-0.980, P<0.01). The positive rate of CTCs in stage Ⅲ-Ⅳ cancers was significantly higher than that in stage Ⅰ-Ⅱ (P=0.023). No significant correlation was observed between positive rate of CTCs or chromosome polysomy and age, gender, smoking status, pathologic types and EGFR mutation status. The number of CTCs in EGFR mutated group was higher than that in the non-mutated group (6.5±1.1 vs. 3.7±0.7, P=0.045). The detection rate for CTCs ≥5 in the EGFR mutated group was also higher than the EGFR non-mutated group (52.0% vs. 19.4%,P=0.010). Conclusion: Detection of CTCs with chromosomes 7 and 8 polysomy has potential value in auxiliary diagnosis of non-small cell lung cancer, and the number of CTCs is correlated to TNM stage and EGFR gene mutation status.

[Determination of Cyclohexene in workplace air by Solvent desorption gas chromatography].

Objective: To establish a solvent desorption gas chromatography method for determination of cyclohexene in workplace air. Methods: Cyclohexene in the air of workplace was collected with carbon tube and desorbed by carbon disulfide. The target toxicant was separated with the GC column and analyzed with FID detector, identified by retention time, and quantified by peak area. Results: The linear range of cyclohexene in the air of workplace was 0.77~4 050.00 µg/ml, with a correlation coefficient of 0.9999. The limit of detection was 0.23 µg/ml. The lower limit of quantification was 0.77 µg/ml. The minimum detectable concentration was 0.15 mg/m(3) under1.5 L sampling volume and 1.0 ml extraction solution volume. The within-run precision of different cyclohexene concentrations was 0.62%~1.9% and the between-run precisions was 1.5%~3.5%; The average extraction efficiency was 96.4%; Penetration capacity (100 mg of carbon tube) was 29.4 mg; The average collection efficiency was 100%; The samples could be stored for 7 days at room temperature. When placed in 4 ℃ refrigerator, the samples could be stored for 14 days. The potential coexistence of cyclohexane, hexane, benzene, toluene and ethylbenzene with cyclohexene in the air did not interfere with the results of determination. Conclusion: This method has high sensitivity, precision, accuracy and lower limit of detection and it is applicable for determination of cyclohexene in workplace air.

[Discussion on the consistency of detection methods of main indexes of workplace air, ambient air and indoor air].

Major air pollutants include particulate matter, ozone, sulfur dioxide and nitrogen dioxide, etc. Recent posts have confirmed that air pollution has a variety of adverse health effects on people's health.For professional people, because of occupational hazards of these major atmospheric pollutants also exist in the workplace, is likely to suffer from the double hazards of occupational hazards and air pollutants in the workplace, if similar pollutants are present in the home, the daily exposure concentration of the occupational population may be significantly higher than that of the general population. Exposure limits and testing methods for major atmospheric pollutants (particulate matter or dust, ozone, sulfur dioxide and nitrogen dioxide) are set by relevant standards in workplace air, ambient air and indoor air. However, due to different places and different management departments, there are differences in the detection methods of the same indicators, which brings difficulties to estimate the total daily exposure level. The purpose of this paper is to discuss the "consistency" of the detection method of relevant pollutants in the air, in order to provide scientific basis for estimating the daily exposure level of pollutants in different populations.

m6A methyltransferase METTL3 promotes the progression of prostate cancer via m6A-modified LEF1.

OBJECTIVE: This study aims to uncover the regulatory effects of METTL3 on promoting the progression of prostate cancer (PCa) through N6-Methyladenosine (m6A) methylation on LEF1 mRNA. PATIENTS AND METHODS: The relative levels of METTL3 and LEF1 in 48 paired PCa tissues and adjacent ones were determined by quantitative Real Time-Polymerase Chain Reaction (qRT-PCR). Their correlation in PCa tissues was analyzed by Spearman correlation test. The survival of PCa patients affected by METTL3 was assessed by introducing Kaplan-Meier method. Wound closure assay was performed to evaluate the potential influence of METTL3 on migratory ability in PC-3 cells. Protein level of LEF1 in PC-3 cells with METTL3 or IGF2BP2 knockdown was examined. The activity of the Wnt pathway was tested through TOP/FOP-Flash. Furthermore, the interaction between LEF1 with METTL3 or IGF2BP2 was verified through RIP (RNA-Binding Protein Immunoprecipitation) assay. At last, the regulatory effects of METTL3/LEF1 axis on the activity of the Wnt pathway and migratory ability in PC-3 cells were determined. RESULTS: METTL3 and LEF1 were upregulated in PCa tissues, and they presented a positive correlation in PCa. A high level of METTL3 predicted poor prognosis in PCa patients. The knockdown of METTL3 suppressed the migratory ability in PC-3 cells. Meanwhile, the knockdown of METTL3 downregulated protein level of LEF1 and decreased the activity of the Wnt pathway. The results of RIP assay indicated that METTL3 methylation sites were present on LEF1 mRNA. Moreover, the silence of METTL3 decreased the enrichment abundance of LEF1 in anti-IGF2BP2. Rescue experiments demonstrated that the overexpression of LEF1 partially reversed the regulatory effects of METTL3 on the Wnt activity and migratory ability in PCa cells. CONCLUSIONS: METTL3 is upregulated in PCa tissues. METTL3 influences the activity of the Wnt pathway through m6A methylation on LEF1 mRNA, thereafter, promoting the progression of PCa.

Augmented Scaled Particle Theory.

The original motivation for scaled particle theory (SPT) is to derive a simple equation of state for a bulk hard sphere (HS) fluid. It is now widely recognized that SPT provides also the surface tension of a HS fluid near a spherical hard wall, including three contributions, i.e., the planar surface tension and two bending rigidities due to the surface curvatures (integrated mean and Gauss curvatures). This conforms to the basic assumption of morphological thermodynamics. The existence of non-Hadwiger terms, i.e., higher-order curvature terms, has been evidenced recently. Augmenting SPT by only one non-Hadwiger term, i.e., third-order curvature term, allows us to obtain two new analytical theories, which not only describe very accurately bulk thermodynamic properties but also improve systematically surface ones with respect to SPT.

[Comparison between pyrophosphate method and infrared spectrophotometry for determination of silicon dioxide content in dust].

Objective: To discuss the difference between pyrophosphoric acid method and infrared spectrophotometry for the determination of silica content in dust. Methods: The content of silica in the laboratory comparison samples organized by CDC Occupational Health Institute in China in 2018, and purchased quality control samples were determined by pyrophosphate method. Meanwhile, the samples were qualitatively and quantitatively analyzed by infrared spectrophotometry, and the results obtained by the two methods were compared. Results: Four samples (062C1、062C2、GDOHZKTG012-1、GDOHZKTG012-2) were detected by pyrophosphate method and infrared spectrophotometry. The results of pyrophosphate method were 55.49%, 5.24%, 4.90% and 54.72%, respectively. The results of infrared spectrophotometry were 0.91%, 1.87%, 1.29% and 1.16% respectively. Conclusion: The content of silica in dust determined by pyrophosphate method is higher than that by infrared spectrophotometry.

[Expression of heterogeneous nuclear ribonucleo-protein A2B1 in mouse cerebellar development and human medulloblastoma].

Objective: To investigate the expression and potential role of heterogeneous nuclear ribonucleo-protein A2B1 (HNRNPA2B1) in mouse cerebellar development and the significance of HNRNPA2B1 in human medulloblastoma. Methods: The data of HNRNPA2B1 RNA expression in mouse and human cerebella were obtained from databases. Western blot and immunohistochemical staining were performed to detect the protein level of HNRNPA2B1 in mouse cerebella at different ages. The expression level of HNRNPA2B1 in control human cerebellum and medulloblastoma was detected by immunohistochemical staining. m6A-IP-qPCR method was applied to confirm whether HNRNPA2B1 RNA in Daoy cells was modified with m6A.Western blot was used to detect the effect of MG132 treatment on the HNRNPA2B1 protein level in Daoy cells. Results: The level of HNRNPA2B1 protein in postnatal mouse cerebella was higher than that in adult mouse cerebella, with weak HNRNPA2B1 staining in external granular cells while strong staining in mature Purkinje cells and molecular layer. Compared with control normal human cerebella, the RNA expression level of HNRNPA2B1 increased in medulloblastoma, while immunohistochemical staining showed that the mean intensity of HNRNPA2B1 decreased in medulloblastoma. HNRNPA2B1 RNA in medulloblastoma and Daoy cells was modified by m6A. The HNRNPA2B1 protein level in Daoy cells increased upon MG132 treatment. Conclusions: HNRNPA2B1 is dynamically expressed during mouse cerebellar development. Compared with normal human cerebella, HNRNPA2B1 is significantly up-regulated at transcriptional level but obviously down-regulated at translational level in medulloblastoma. These results indicate that HNRNPA2B1 may be involved in cerebellar development process and medulloblastoma tumorigenesis. The m6A methylation in HNRNPA2B1 transcript and protein ubiquitin-proteasome pathway may account for the down-regulation of HNRNPA2B1 at protein level.

[Clinical features and MYH9 gene variant in two Chinese siblings with Fechtner syndrome].

Objective: To summarize the clinical data and molecular characteristics of two siblings with Fechtner syndrome. Methods: A retrospective analysis was made on the clinical data, laboratory tests and genetic test results of two siblings with Fechtner syndrome in a family who were followed up in the Department of Nephrology, Children's Hospital Affiliated to Nanjing Medical University from April 2018 to August 2018. Results: Both siblings showed proteinuria, microscopic hematuria and thrombocytopenia. Giant platelets and leucocyte inclusions were easily seen in peripheral blood smears and bone marrow cells, but the results of renal function, hearing and ophthalmologic examinations were normal. The father of the siblings presented with proteinuria, thrombocytopenia, and hearing loss. At the age of 26 years, he developed uremia and now requires hemodialysis. The renal biopsy of the elder sister suggested focal segmental glomerulosclerosis. Gene analysis showed that the siblings and their father MYH9 gene 25 exon c.3195_c.3215 delCGAGCTCCAGCCCAGATCGC (p.A1065_A1072 del) deletion mutation. The elder sister was treated with benazepril hydrochloride for 4 months and the proteinuria was improved. Her younger brother was given tacrolimus for 3 months, but the proteinuria did not improve significantly, then benazepril hydrochloride was given for 1 month and proteinuria improved. Conclusions: Fechtner syndrome is characterized by nephritis, thrombocytopenia, giant platelets and leucocyte inclusions. The variant of MYH9 gene is the cause of Fechtner syndrome. The deletion mutation of p.A1065_A1072del is the second international report. Angiotensin-converting enzyme inhibitors may be effective in reducing proteinuria in patients with Fechtner syndrome.

MicroRNA-126 affects cell apoptosis, proliferation, cell cycle and modulates VEGF/TGF-ß levels in pulmonary artery endothelial cells.

OBJECTIVE: In the clinic, therapeutic options for pulmonary arterial hypertension are limited; therefore, investigating the therapeutic strategies and novel therapies is critical for pulmonary arterial hypertension (PAH) treatment. This study aimed to evaluate the role of miRNA-126 (miR-126) and its associated signaling pathways and specific mechanisms for the pathogenesis of PAH. MATERIALS AND METHODS: The pulmonary artery endothelial cells (PAECs) were isolated and identified. The miR-126 mimic and miR-126 inhibitor were synthesized. LV-3-miR-126 mimic viral vector and LV-3-miR-126 inhibitor vector were established and infected into pulmonary artery endothelial cells. Expression of sprouty-related EVH1 domain-containing protein 1 (SPRED1), phosphoinositide-3-kinase regulatory subunit 2 (PIK3R2) and miR-126 were detected using Real-time PCR (RT-PCR). Cell apoptosis (Annexin V-PE/7-AAD) and proliferation (PKH26) were examined by using FACScan flow cytometry. Vascular endothelial growth factor (VEGF), transforming growth factor ß1 (TGF-ß1) and TGF-ß3 levels were evaluated using enzyme-linked immunosorbent assay (ELISA) kits. RESULTS: miR-126 inhibited the endothelial cells related to SPRED1 and PIK3R2 expression. Over-expression of miR-126 significantly inhibited the PAECs apoptosis compared to PAECs and blank LV-3 vector group (p<0.05). miR-126 significantly triggered the PAECs proliferation compared to PAECs and blank LV-3 vector group (p<0.05). In functional analysis, miR-126 mimic significantly increased the cells amounts of S phases compared to PAECs and blank LV-3 vector group (p<0.05). Pre-infection with miR-126 mimic significantly enhanced the levels of VEGF, TGF-ß1, and TGF-ß3 compared to PAECs and blank LV-3 vector group (p<0.05). CONCLUSIONS: miR-126 could affect cell apoptosis, proliferation, cell cycle, and modulate VEGF/TGF-ß levels.

Connect the Thermodynamics of Bulk and Confined Fluids: Confinement-Adsorption Scaling.

A fluid (a gas or a liquid) adsorbed in a porous material can behave very differently from its bulk counterpart. The advent of various synthesized materials with nanopores and their wide applications have provided strong impetus for studying fluids in confinement because our current understanding is still incomplete. From a large number of Monte Carlo simulations, we found a scaling relation that allows for connecting some thermodynamic properties (chemical potential, free energy per particle, and grand potential per particle) of a confined fluid to the bulk ones. Upon rescaling the adsorbed fluid density, the adsorption isotherms for many different confining environments collapse to the corresponding bulk curve. We also reveal the intimate connection of the reported scaling relation to Gibbs theory of inhomogeneous fluids and morphological thermodynamics. The advance in our understanding of confined fluids, gained from this study, also opens attractive perspectives for circumventing experimental difficulty for directly measuring some fluid thermodynamic properties in nanoporous materials.

A biological study of supernumerary teeth derived dental pulp stem cells based on RNA-seq analysis.

AIM: To identify the basic characteristics and gene expression profiles of supernumerary teeth derived stem cells (SNTSCs) and compare them with those of normal dental pulp stem cells (DPSCs). METHODOLOGY: Flow cytometry was conducted to identify the protein expression of stem cell markers. Cell proliferation, migration and differentiation abilities of both SNTSCs and DPSCs were determined by CCK8, transwell and differentiation assays, respectively. Gene expression profiles were studied by RNA sequencing analyses. After knocking down the expression of certain differential expression genes (DEGs), the function of DEGs was investigated by CCK8 and transwell assays. Statistical differences were determined using a two-tailed t-test and P values below 0.05 were considered significant. RESULTS: Supernumerary teeth derived stem cells were capable of differentiating into adipocyte, chondrocyte and osteoblast lineage cells, and compared to ordinary DPSCs, SNTSCs had a significantly higher cell proliferation rate (P < 0.01) and significantly lower migration rate (P < 0.01). RNA-seq results revealed the differential expression genes (DEGs) between SNTSCs and DPSCs. A principal component analysis (PCA) and cluster analysis revealed that the gene expression patterns of SNTSCs and DPSCs were different from each other. A total of 12 861 genes were differentially expressed at a significant P value (P ≤ 0.01), and 5292 of these increased in SNTSCs and 7569 decreased. Further study on the selected DEGs revealed that FUT11, FAM155A and BRD2 inhibited the cell proliferation rate of SNTSCs, and FUT11 and GLUD1 inhibited the cell migration rate, whilst FAM155A promoted the migration rate. CONCLUSIONS: The biological characteristics and gene expression profile of SNTSCs was revealed. The stem cell properties of SNTSCs were similar to normal DPSCs but they had a high cell proliferation rate and may have greater potential for cell differentiation.

[Determination of p-Phenylene diamine in workplace air by elution solution-liquid chromatography].

Objective: To establish a elution solution-liquid chromatography method for determination of p-Phenylene diamine (PPD) in workplace air. Methods: p-Phenylene diamine (PPD) in the air of workplace was collected with glass fiber filters coated with dilute sulfuric acid and extracted with an aqueous EDTA solution. The target toxicant was separated with the C(18) column and analyzed with UV detector, identified by retention time, and quantified by peak area. Results: The linear range of PPD in the air of workplace was 2.00~10.00 µg/ml, with a correlation coefficient of 0.999 96. The limit of detection was 0.07 µg/ml. The lower limit of quantification was 0.23 µg/ml. The minimum detectable concentration was 0.003 1 mg/m(3) under 45.0 L sampling volume and 2.0 ml extraction solution volume. The within-run precision of different PPD concentrations was 0.15%~2.3% and the between-run precisions was 1.4%~2.6%; The extraction efficiencies was 91.4%~95.4%; The average collection efficiencies was 96.6%; The samples could be stored for 7 days isolation of air. The potential coexistence of m-Phenylene diamine and o-Phenylene diamine with p-Phenylene diamine (PPD) in the air did not interfere with the results of determination. Conclusion: This method has high sensitivity, precision, accuracy and lower limit of detection and it is applicable for determination of p-Phenylene diamine (PPD) in workplace air.

Isodon eriocalyx and its bioactive component Eriocalyxin B enhance cytotoxic and apoptotic effects of gemcitabine in pancreatic cancer.

BACKGROUND: Pancreatic cancer, associated with poor prognosis and low survival rate, has been the fourth leading cause of cancer-related death in the US. Although gemcitabine (Gem) is the first-line chemotherapeutic drug in the management of pancreatic cancer, the median survival extension is only 1.5 months, indicating unsatisfactory clinical results. Therefore, exploring agents that can enhance the anti-cancer activity of Gem would be an attractive strategy. PURPOSE: Our previous studies have demonstrated that eriocalyxin b (EriB), an ent­kaurane diterpenoid isolated from Isodon eriocalyx (Dunn.) Hara, possesses anti-pancreatic cancer effects, thus acting as a potential therapeutic agent. In this study, we further investigated whether EriB or the ethanol extract of I. eriocalyx (Isodon) could potentiate the cytotoxic activity of Gem in human pancreatic adenocarcinoma cells. In addition, the mechanism associated with their effects was also studied. METHODS: The anti-proliferation effect was assessed by MTT assay and Ki-67 immunostaining. The combination effect (addition, synergism and antagonism) of various agents was calculated by the Calcusyn software (Biosoft), utilizing the T.C. Chou Method. Apoptosis was detected using Annexin V and PI double staining followed by quantitative flow cytometry. Protein expression regulated by various treatments was analyzed by western blotting. RESULTS: The combination index revealed that Gem and EriB (or Isodon extract) had synergistic anti-proliferative effect. Both cellular apoptotic and anti-proliferative effects of Gem were significantly increased after combination with EriB (or Isodon extract). The underlying mechanisms involved in the combination effects were elucidated, which include: (1) increased activation of the caspase cascade; (2) reduction of PDK1 and AKT phosphorylation; (3) induction of JNK phosphorylation by Isodon and Gem combination. CONCLUSION: Gem and EriB (or Isodon extract) taken together in combination regulated PDK1/AKT1/caspase and JNK signaling and promoted apoptosis synergistically, which may contribute to the much increased anti-proliferative activity compared to either agent alone.

[Clinical features and genetic variants of Dent disease in 10 children].

Objective: To summarize the clinical features and genetic analysis results of 10 children with Dent disease. Methods: The clinical data and gene test results of 10 boys aged from 8 months to 12 years with Dent disease diagnosed in Children's Hospital of Nanjing Medical University from January 2014 to July 2017 were analyzed retrospectively. Results: All patients had insidious onset, 5 cases were found to have proteinuria on routine urine examination after hospitalization duo to other diseases, 4 cases were admitted to hospital because increased foams in the urine, and 1 case was found to have proteinuria on health checkup. All cases presented with low molecular weight proteinuria, urine protein electrophoresis showed that the proportion of low molecular weight protein was greater than 50%, 7 cases had nephrotic-range proteinuria, but none had hypoproteinemia. Six cases had hypercalciuria, 3 cases had nephrocalcinosis, 1 case had nephrolithiasis, 2 cases had glomerular microscopic hematuria, in 1 case urine glucose wa weakly positive but blood glucose was normal. All patients had normal renal function, normal serum calcium, no hypophosphoremia and none had rickets. Genetic analysis results showed that 7 patients with variants in the CLCN5 gene, including 2 nonsense variants (p.R637X, p.Y143X), 3 missense variants (p.A540D, p.G135E, p.G703V), 1 deletion variant (exons 9, 10, 11, 12, 13, 1 missing), and 1 frameshift variant (p.T260Tfs*10). Three cases had missense variants of OCRL gene (p.I274T, p.I371T, p.F399S). Except for p.R637X and p.I274T, the other 8 cases had newly discovered variants. Five patients underwent a renal biopsy, the biopsy revealed focal global glomerulosclerosis in 3 patients, mild mesangial proliferative glomerulonephritis in 1 patient and renal minimal change in 1 patient. Mild focal tubular atrophy and interstitial fibrosis were noted in three cases. Mild segmental foot process effacement was noted under electron microscope in all five cases. Conclusions: All the children with Dent disease had insidious onset, low molecular weight proteinuria is the main clinical manifestation, most cases presented with nephrotic-range proteinuria, but there was no hypoalbuminemia, some cases were not associated with hypercalciuria. The pathogenic genes in most cases were CLCN5 and a few were OCRL. The types of genetic variation include missense variant, nonsense variant, deletion variant and frameshift variant. Although Dent disease is a renal tubular disease, renal biopsy suggests that most cases are associated with glomerular lesions.

[Effects of p-Phenylene diamine on liver and kidney functions of occupational exposed workers].

Objective: To study the effect of p-phenylenediamine (PPD) on liver and kidney function in occupational exposed workers. Methods: Workers in a hair dye production enterprise which used p-phenylenediamine as a raw material for production were selected as the main research population. Then we conducted a questionnaire survey on the basic conditions of workers and conducted occupational health checkups on general health status, liver and kidney function. Occupational health examination assessment results were tested in Taizhou Cancer Hospital. All data was built using EpiData 3.1 software, and statistical analysis was performed using software SPSS 20.0. Results: The liver function indicators including direct bilirubin, prealbumin, total protein, and white protein, globulin, aspartate aminotransferase, glutamyl transpeptidase, and total bilirubin in the workers exposed to high concentration of PPD were at high normal values, and these indicators were significantly different from low PPD concentration group (P<0.05) . The serum creatinine and serum uric acid in the renal function index were significantly higher in workers exposed to PPD than in workers exposed to low concentrations and in the control group (P<0.05) . Conclusion: Occupational exposed to PPD may have a hazard to the workers' liver and kidney function. Long-term occupational exposure to PPD may lead to increased cumulative exposure of workers, which may cause potential chronic liver and kidney damage in occupationally exposed populations.