A new risk factor for coronary artery disease can be detected by an ApoA1 mAb-based assay.

BACKGROUND: This study aimed to find coronary artery disease (CAD) related apolipoprotein A1 (ApoA1) monoclonal antibody (mAb) and to evaluate the diagnostic value of the assay based on it. METHODS: Patients with CAD diagnosed by coronary angiography (disease group, n = 180) and healthy subjects (control group, n = 199) were recruited. The correlation between methods and CAD were evaluated by Spearman's rank correlation coefficients. Receiver operating characteristic (ROC) curve analysis was used to evaluate the auxiliary diagnostic value of methods for CAD. Odds ratios (ORs) of the test results in CAD were estimated using logistic regression analysis. RESULTS: Measurements from an ApoA1 mAb were found significantly positively correlated with CAD (r = 0.243, P < 0.01), unlike the measurements from the ApoA1 pAb were negatively correlated with CAD (r = -0.341, P < 0.001). The areas under the ROC curve of the ApoA1 mAb and pAb measurements were 0.704 and 0.563, respectively, in patients with normal HDL-C levels. ApoA1 values from the mAb assay had a significant positive impact on CAD risk. CONCLUSION: An ApoA1 mAb-based assay can distinguish a high-density lipoprotein (HDL) subclass positively related to CAD, which can be used to improve and reappraise CAD risk assessment.

Generation of a homozygous CRISPR/Cas9-mediated knockout human iPSC line for PTCH1 gene.

PTCH1 is the receptor protein of Hedgehog signaling pathway, and Hedgehog pathway plays a vital role in mammalian embryonic development. However, the specific biological role of PTCH1 is incompletely understood for embryonic development. Here, we used a CRISPR/Cas9 genome editing approach to generate a homozygous PTCH1 knock-out iPSC line (SCMCi001-A-1) from a healthy donor, which will be a valuable in vitro model to study the pathogenic mechanism of PTCH1 dysfunction in congenital disease.

Identification of the genetic basis of sporadic polydactyly in China by targeted sequencing.

PURPOSE: Polydactyly is a highly heterogeneous group of skeletal deformities in clinical and genetic background. The variation spectrum in Chinese sporadic polydactyly has not been comprehensively analyzed. To elucidate genetic variation spectrum and genotype-phenotype correlations in Chinese patients with polydactyly, we conducted comprehensive genetic analysis of patients nationwide using targeted sequencing. METHODS: A total of 181 patients diagnosed with polydactylies were recruited. We designed a targeted capture panel for sequencing 721 genes that are associated with the pathogenesis of skeletal dysplasia. We performed rigorous variant- and gene-level filtrations to identify potentially damaging variants, followed by enrichment analysis and gene prioritization. RESULTS: A total of 568 deleterious variants of 293 genes were identified in 173 of 181 patients with a positive rate of 95.6% by targeted sequencing. For each sample, an average of 3.17 deleterious variants were identified. Especially, 14 pathogenic or likely pathogenic variants were identified in 10 genes in 14 patients out of the 181 patients, providing a positive molecular diagnostic rate of 7.7%. CONCLUSION: Targeted sequencing analysis provides a high efficiency approach for the genetic diagnosis of polydactyly. This is the largest next generation sequencing study performed to date in patients with polydactyly and represents the genetic basis of polydactyly typically encountered in genetics clinics.

Nonframeshifting indel variations in polyalanine repeat of HOXD13 gene underlies hereditary limb malformation for two Chinese families.

BACKGROUND: Polydactyly and syndactyly are the most common hereditary limb malformations. Molecular genetic testing is of great significance for hereditary limb malformations, which can establish prognosis and recurrence risk of surgical intervention. METHODS: The present study aimed to identify the genetic etiologies of a three-generation family with postaxial polydactyly and a four-generation family with postaxial syndactyly. Whole exome sequencing was used, followed by standard mutation screening procedure, Sanger sequencing and bioinformatics analysis. RESULTS: Two nonframeshifting insertion/deletion (indel) mutations in HOXD13 (c.206_207ins AGCGGCGGCTGCGGCGGCGGCGGC:p.A68insAAAAAAAA or c.171_182delGGCGGCGGCGGC: p.56_60delAAAA) were successfully identified as the pathogenic mutation. The two nonframeshifting indel mutations led to truncation or expansion of homopolymeric alanine (Poly-Ala) repeats of HOXD13 proteins. Sequence alignment of HOXD13 protein among many different species for Poly-Ala position is highly conserved. Hypothetical three-dimensional (3-D) structural analysis further showed mutant HOXD13 proteins (p.A68insAAAAAAAA and p.56_60delAAAA) converted the disordered fragment into a short ß-strand (residues 63-68 or residues 64-68), thereby forming a conformational change. CONCLUSIONS: The present study identified two nonframeshifting mutations of HOXD13 polyalanine repeat location in two Chinese families with postaxial polydactyly or postaxial syndactyly. Our results also provide new insights into genetic counseling and clinical management.

Identification of miRNA-mRNA-TFs Regulatory Network and Crucial Pathways Involved in Tetralogy of Fallot.

Tetralogy of Fallot (TOF) is the most common cyanotic congenital heart disease. However, its pathogenesis remains unknown. To explore key regulatory connections and crucial pathways underlying the TOF, gene or microRNA expression profile datasets of human TOF were obtained from the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) database. The differentially expressed mRNAs (DEmRNAs) and microRNAs (DEmiRs) between TOF and healthy groups were identified after data preprocessing, followed by Gene Ontology (GO) analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis. Then, we further constructed protein-protein interaction (PPI) network and subnetwork of modules. Ultimately, to investigate the regulatory network underlying TOF, a global triple network including miRNAs, mRNAs, and transcription factors (TFs) was constructed based on the integrated data. In the present study, a total of 529 DEmRNAs, including 115 downregulated and 414 upregulated DEmRNAs, and 7 significantly upregulated DemiRs, including miR-499, miR-23b, miR-222, miR-1275, miR-93, miR-155, and miR-187, were found between TOF and control groups. Furthermore, 22 hub genes ranked by top 5% genes with high connectivity and six TFs, including SRF, CNOT4, SIX6, SRRM3, NELFA, and ONECUT3, were identified and might play crucial roles in the molecular pathogenesis of TOF. Additionally, an miRNA-mRNA-TF co-regulatory network was established and indicated ubiquitin-mediated proteolysis, energy metabolism associated pathways, neurodevelopmental disorder associated pathways, and ribosomes might be involved in the pathogenesis of TOF. The current research provides a comprehensive perspective of regulatory mechanism networks underlying TOF and also identifies potential molecule targets of genetic counseling and prenatal diagnosis for TOF.

Exome Sequencing Identified a Novel FBN2 Mutation in a Chinese Family with Congenital Contractural Arachnodactyly.

Congenital contractural arachnodactyly (CCA) is an autosomal dominant disorder of connective tissue. CCA is characterized by arachnodactyly, camptodactyly, contrature of major joints, scoliosis, pectus deformities, and crumpled ears. The present study aimed to identify the genetic cause of a three-generation Chinese family with CCA. We successfully identified a novel missense mutation p.G1145D in the fibrillin-2 (FBN2) gene as the pathogenic mutation by whole exome sequencing (WES). The p.G1145D mutation occurs in the 12th calcium-binding epidermal growth factor-like (cbEGF) domain. The p.G1145D mutation caused a hydrophobic to hydrophilic substitution, altering the amino acid property from neutral to acidic. Three-dimensional structural analysis showed that this mutation could alter the conformation of the residue side chain, thereby producing steric clashes with spatially adjacent residues, disrupting the formation of H bonds and causing folding destabilization. Therefore, this amino acid appears to play an important role in the structure and function of FBN2. Our results may also provide new insights into the cause and diagnosis of CCA and may have implications for genetic counseling and clinical management.

Association between ABO Blood Group and Risk of Congenital Heart Disease: A 6-year large cohort study.

ABO blood group, except its direct clinical implications for transfusion and organ transplantation, is generally accepted as an effect factor for coronary heart disease, but the associations between ABO blood group and congenital heart disease (CHD) are not coherent by previous reports. In this study, we evaluated the the potential relationship between ABO blood group and CHD risk. In 39,042 consecutive inpatients (19,795 CHD VS 19,247 controls), we used multivariable logistic regression to evaluate the roles of ABO blood group, gender, and RH for CHD. The associations between ABO blood group and CHD subgroups, were further evaluated using stratification analysis, adjusted by gender. A blood group demonstrated decreased risk for isolated CHD (OR 0.82; 95% CI, 0.78-0.87) in individuals with A blood group in the overall cohort analysis, and the finding was consistently replicated in independent subgroup analysis. ABO blood group may have a role for CHD, and this novel finding provides ABO blood group as a possible marker for CHD, but more studies need to be done.

ARE/SUZ12 dual specifically-regulated adenoviral TK/GCV system for CML blast crisis cells.

BACKGROUND: Treatment of blast phase chronic myeloid leukemia (BP-CML) remains a challenge, and the median survival is less than 6 months. Because effective treatments are lacking, we studied tight targeting of blast crisis CML cells using adenoviral (Ad) vectors expressing a HSV-TK system under dual control of a specific SUZ12 promoter and an antioxidant response element (ARE). METHODS: A potential SUZ12 promoter fragment was designed with bioinformatics databases and identified with a luciferase assay. Next, we cloned the ARE element of the NQO1 gene and developed Ad vectors expressing TK kinase or luciferase under the dual control of a specific SUZ12 promoter and an ARE element. An in vitro transfection assay with Ad-ARE/SUZ12-Luc was used to determine promoter activity of ARE/SUZ12 regulatory element in blast crisis CML cells. After incubating human BP-CML-derived cells with Ad-ARE/SUZ12-TK and ganciclovir, Western blot, CCK8, Immunofluorescent assays and Annexin V assays were conducted to assess the efficacy of an ARE/SUZ12 dual-specific TK/GCV system for BP-CML cell lines. RESULTS: Here, luciferase data confirmed significantly higher and specificer promoter activity of the ARE/SUZ12 composite component in CML blast crisis-derived cell lines (K562, KCL22, and K562/G01) compared to HepG2 cells, and Ad-AS-TK/GCV system could exhibit enhanced apoptotic effects and decreased cell viability for BP-CML cell lines. Additionally, Ad-AS-TK/GCV system altered expression of cycle-related and apoptosis-related proteins in BP-CML cell lines. CONCLUSIONS: Thus, ARE/SUZ12 dual targeting TK/GCV system was effective in killing BP-CML cells. Moreover, efficacy and specificity of CML cell eradication were enhanced by synergistic effects of ARE/SUZ12 dual-specific regulation. We conclude that suicide gene-targeted therapy might hold promise for BP-CML treatment.

MDR1 gene polymorphisms and imatinib response in chronic myeloid leukemia: a meta-analysis.

BACKGROUND: MDR1 gene polymorphisms were demonstrated to be associated with interindividual variability of imatinib response for chronic myeloid leukemia (CML) patients in several studies; however, the results have been inconclusive. MATERIALS & METHODS: To clarify the effect of common MDR1 variants on clinical response to imatinib, we performed a meta-analysis to quantify the accumulated information from genetic association studies. After a thorough search of the published literature, we undertook a meta-analysis to evaluate the effect of MDR1 C1236T, G2677T and C3435T polymorphisms on imatinib response. RESULTS: Our pooled data showed a significant association between MDR1 C1236T polymorphism and the increasing risk of imatinib resistance in Asian CML patients. However, no significant association was found for the MDR1 G2677T or C3435T polymorphisms in an Asian CML population as well as a Caucasian CML population. CONCLUSION: The synonymous MDR1 C1236T polymorphism might be a risk factor for nonoptimal clinical response to imatinib in Asian CML patients.