Monocyte-derived exosomal XIST exacerbates acute lung injury by regulating the miR-448-5p/HMGB2 axis.

Monocyte-derived exosomes (Exos) have been implicated in inflammation-related autoimmune/inflammatory diseases via transferring bioactive cargoes to recipient cells. The purpose of this study was to investigate the possible effect of monocyte-derived Exos on the initiation and the development of acute lung injury (ALI) by delivering long non-coding RNA XIST. Key factors and regulatory mechanisms in ALI were predicted by bioinformatics methods. BALB/c mice were treated with lipopolysaccharide (LPS) to establish an ALI in vivo model and then injected with Exos isolated from monocytes transduced with sh-XIST to evaluate the effect of monocyte-derived exosomal XIST on ALI. HBE1 cells were co-cultured with Exos isolated from monocytes transduced with sh-XIST for further exploration of its effect. Luciferase reporter, RIP and RNA pull-down assays were performed to verify the interaction between miR-448-5p and XIST, miR-448-5p and HMGB2. miR-448-5p was significantly poorly expressed while XIST and HMGB2 were highly expressed in the LPS-induced mouse model of ALI. Monocyte-derived Exos transferred XIST into HBE1 cells where XIST competitively inhibited miR-448-5p and reduced the binding of miR-448-5p to HMGB2, thus upregulating the expression of HMGB2. Furthermore, in vivo data revealed that XIST delivered by monocyte-derived Exos downregulated miR-448-5p expression and up-regulated HMGB2 expression, ultimately contributing to ALI in mice. Overall, our results indicate that XIST delivered by monocyte-derived Exos aggravates ALI via regulating the miR-448-5p/HMGB2 signaling axis.

[Retracted] MicroRNA­448 suppresses metastasis of pancreatic ductal adenocarcinoma through targeting JAK1/STAT3 pathway.

Following the publication of this paper, it was drawn to the Editors' attention by a concerned reader that certain of the western blot data shown in Figs. 4B and 7, the stratch­wound assay data shown in Figs. 2B and E and Fig. 6B, and the cellular images shown in Fig. 3 were strikingly similar to data appearing in different form in other articles written by different authors in different research institutions. Owing to the fact that the contentious data in the above article had already been published elsewhere prior to its submission to Oncology Reports, the Editor has decided that this paper should be retracted from the Journal. The authors were asked for an explanation to account for these concerns, but the Editorial Office did not receive a reply. The Editor apologizes to the readership for any inconvenience caused. [Oncology Reports 38: 1075­1082, 2017; DOI: 10.3892/or.2017.5781].

Micro ribonucleic acid-448 regulates zinc finger e-box binding homeobox 1 to inhibit the growth of breast cancer cells and increase their sensitivity to chemotherapy.

OBJECTIVE: This study aimed to investigate the effect of Zinc Finger E-box Binding Homeobox 1 (ZEB1) regulation by Micro Ribonucleic acid (miR)-448 on Breast Cancer (BC) cells and their sensitivity to chemotherapy. METHODS: miR-448 and ZEB1 mRNA levels in BC and normal tissues were detected by qPCR, and ZEB1 protein was detected by Western Blotting (WB). The correlation between miR-448 and tumor metastasis, clinical staging, and ZEB1 expression was analyzed. MCF-7 cells were transfected or co-transfected with the miR-448 mimic, oe-ZEB1, or their negative controls. Changes in miR-448 and ZEB1 expression were detected by qPCR and WB. Cell proliferation was determined by CCK-8 assays, invasion changes were analyzed by Transwell assays, and apoptosis was detected by flow cytometry. RESULTS: miR-448 expression in BC tissues was lower than that in normal tissues, while ZEB1 expression was increased in the former. ZEB1 expression was lower in BC patients with lymph node metastasis than in those without. In patients with clinical stage I-III BC, miR-448 expression decreased with an increase in tumor stage, which was negatively correlated with ZEB1 expression. Upregulation of miR-448 expression can suppress MCF-7 cell proliferation and invasion and promote apoptosis. Upregulation of ZEB1 expression in cells overexpressing miR-448 can partially reverse the inhibition of BC cell growth induced by miR-448. miR-448 can enhance the sensitivity of cells toward paclitaxel and 5-fluorouracil. CONCLUSIONS: miR-448 suppresses cell proliferation and invasion and promotes apoptosis by targeting ZEB1. Moreover, it can increase the sensitivity of cells toward paclitaxel and 5-fluorouracil.

LncRNA NEAT1 Promotes the Malignant Progression of Colorectal Cancer by Targeting ZEB1 via miR-448.

Background: Long noncoding RNAs have been associated with various types of malignant tumors; however, the specific role of long noncoding RNAs in tumorigenesis still remains unclear in colorectal cancer. Here, we aim to elucidate the role of long noncoding RNA nuclear paraspeckle assembly transcript 1 in the malignant progression of colorectal cancer and investigate its underlying mechanisms. Methods: Real-time polymerase chain reaction was used to detect the expression of nuclear paraspeckle assembly transcript 1 in colorectal cancer tissues and cells. Cell Counting Kit-8 assay was used to determine the effect of nuclear paraspeckle assembly transcript 1 in proliferation. Transwell assay was used to explore the role of nuclear paraspeckle assembly transcript 1 in metastasis. Bioinformatics method was used to predict the core nuclear paraspeckle assembly transcript 1 interaction network. Real-time polymerase chain reaction was used to detect nuclear paraspeckle assembly transcript 1 and miR-448 expression levels. Western blotting was used to detect the expression levels of ZEB1. Luciferase assay was used to verify the relationship among nuclear paraspeckle assembly transcript 1, miR-448, and ZEB1. The effect of nuclear paraspeckle assembly transcript 1 on tumor growth was detected by tumorigenesis test in nude mice. Results: Long noncoding RNA-nuclear paraspeckle assembly transcript 1 was up-regulated in colorectal cancer tissues and cells. Knocking down of nuclear paraspeckle assembly transcript 1 can suppress colorectal cancer proliferation and invasion, and caused a reduction of ZEB1 expression and an increase of miR-448 expression. Furthermore, knockdown of nuclear paraspeckle assembly transcript 1 regulated miR-448/ZEB1 axis to inhibit the expression of ZEB1. miR-448 silencing can reverse the effect of nuclear paraspeckle assembly transcript 1 knockdown. Conclusion: Our result demonstrated that long noncoding RNA nuclear paraspeckle assembly transcript 1 promotes proliferation and invasion of colorectal cancer by targeting miR-448 to promote the expression of ZEB1, which may play a significant role in the tumorigenesis of colorectal cancer.

MiR-448 suppresses cell proliferation and glycolysis of hepatocellular carcinoma through inhibiting IGF-1R expression.

Background: Microribonucleic acids (miRNAs) have been shown to play important roles in hepatocellular carcinoma (HCC) progression. MiR-448 has frequently been shown to be a tumor suppressor, and is abnormally expressed in HCC tumor tissues. However, little is known about the role of miR-448 in HCC development. In this article, the regulatory role of miR-448 on insulin-like growth factor 1 receptor (IGF-1R) in modulating hepatoma cell viability and glycolysis was investigated. Methods: The expression of miR-448 profiles in clinical tumor tissues and cell lines was examined using quantitative real-time polymerase chain reaction (qRT-PCR). HepG2 and Huh7 cells were transfected with miR-448 mimics, inhibitors, and scramble sequences. Cell viability and apoptosis were determined by a Cell Counting Kit-8 assay and a flow cytometry analysis. IGF-1R, a potential target of miR-448, was selected following a bioinformatic analysis, and the regulatory effects of miR-448 on IGF-1R expression was confirmed by luciferase reporter assay, qRT-PCR, and western blot. Glucose uptake, lactate production, and adenosine triphosphate (ATP) generation were detected by corresponding kits. Results: Decreased miR-448 expression was observed in both HCC patients' tumor tissues and hepatoma cells in vitro. The overexpression of miR-448 in HepG2 and Huh7 cells decreased cell viability and increased apoptosis. Additionally, the overexpression of miR-448 or the knockdown of IGF-1R lowered the level of glucose uptake, lactate production, and ATP generation, while the knockdown of miR-448 increased glycolysis. Further, aberrantly expressed miR-448 downregulated IGF-1R levels, while the inhibition of miR-448 resulted in the upregulation of IGF-1R in both HepG2 and Huh7 cells. In addition, miR-448 interacted with the wild-type 3'untranslated regions (3'UTRs) of IGF-1R, but had no effect on the mutant 3'UTRs. The expression of IGF-1R was increased in HCC patients' tumor tissues and serum, and was inversely correlated with miR-448 expression. Conclusions: The increased expression of miR-448 appears to downregulate the expression of IGF-1R by interacting with the 3'UTR in HCC progression. These findings highlight its role as a potential target for HCC therapy.

Disabled-2 overexpression mediates immune suppression in systemic lupus erythematosus by modulating Treg/Th17 cell differentiation.

Systemic lupus erythematosus (SLE) is an autoimmune disorder. T helper 17 (Th17) and regulatory T (Treg) cells play key roles in SLE progression. Disabled-2 (DAB2) exhibits immunomodulatory effects in inflammatory diseases. However, the role of DAB2 in SLE and the precise mechanisms remain unknown. Here, a decreased DAB2 expression and an increased miR-448-3p level were observed in peripheral blood mononuclear cells (PBMCs) from SLE patients. DAB2 level was negatively correlated with SLE Disease Activity Index (SLEDAI), suggesting a functional correlation between DAB2 and SLE. To test this, we used 8-week-old MRL/lpr mice and treated them with lentivirus-mediated DAB2 (LV-DAB2) or its negative control (LV-NC). LV-DAB2 treatment increased DAB2 expression and reduced serum immunoglobulin G (IgG) and anti-dsDNA IgG levels. DAB2 upregulation alleviated splenomegaly and lymphadenopathy and SLE-related organ damage. Moreover, DAB2 enhanced the percentage of CD25+ Foxp3+ Treg cells, but reduced Th17 cell frequency in lupus, along with the reduction in tumour necrosis factor α (TNF-α), interleukin (IL)-6 (IL-6) and IL-17A levels, and the elevation in IL-10. In vitro, naive CD4+ T cells isolated from MRL/lpr mice were polarized into Th17 or Treg phenotypes and treated with lentivirus. LV-DAB2 treatment downregulated IL-17A expression and inhibited the generation of CD4+ IL-17A+ Th17 cells. DAB2 triggered the production of IL-10 and the activation of Treg cells. Furthermore, DAB2 was verified as a direct target for miR-448-3p. MiR-448-3p overexpression cancelled the promoting effect of DAB2 on Treg cell differentiation. Taken together, DAB2 exerts an immunosuppressive effect on SLE through promoting Treg cell activation and inhibiting Th17 cell differentiation, which may be modulated by miR-448-3p.

Micro ribonucleic acid-448 regulates zinc finger e-box binding homeobox 1 to inhibit the growth of breast cancer cells and increase their sensitivity to chemotherapy

Abstract Objective: This study aimed to investigate the effect of Zinc Finger E-box Binding Homeobox 1 (ZEB1) regulation by Micro Ribonucleic acid (miR)-448 on Breast Cancer (BC) cells and their sensitivity to chemotherapy. Methods: miR-448 and ZEB1 mRNA levels in BC and normal tissues were detected by qPCR, and ZEB1 protein was detected by Western Blotting (WB). The correlation between miR-448 and tumor metastasis, clinical staging, and ZEB1 expression was analyzed. MCF-7 cells were transfected or co-transfected with the miR-448 mimic, oe-ZEB1, or their negative controls. Changes in miR-448 and ZEB1 expression were detected by qPCR and WB. Cell proliferation was determined by CCK-8 assays, invasion changes were analyzed by Transwell assays, and apoptosis was detected by flow cytometry. Results: miR-448 expression in BC tissues was lower than that in normal tissues, while ZEB1 expression was increased in the former. ZEB1 expression was lower in BC patients with lymph node metastasis than in those without. In patients with clinical stage I-III BC, miR-448 expression decreased with an increase in tumor stage, which was negatively correlated with ZEB1 expression. Upregulation of miR-448 expression can suppress MCF-7 cell proliferation and invasion and promote apoptosis. Upregulation of ZEB1 expression in cells overexpressing miR-448 can partially reverse the inhibition of BC cell growth induced by miR-448. miR-448 can enhance the sensitivity of cells toward paclitaxel and 5-fluorouracil. Conclusions: miR-448 suppresses cell proliferation and invasion and promotes apoptosis by targeting ZEB1. Moreover, it can increase the sensitivity of cells toward paclitaxel and 5-fluorouracil.

Inhibition of miR-448-3p Attenuates Cerebral Ischemic Injury by Upregulating Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2).

BACKGROUND: Nuclear factor erythroid 2-related factor 2 (Nrf2) is a key regulator responsible for oxidative stress in brain injury. This study aimed to investigate the potential mechanism of miR-448-3p and Nrf2 in cerebral ischemia/reperfusion (I/R) injury. METHODS: In vitro and in vivo cerebral I/R injury models were constructed, and Nrf2 expression levels were detected by qRT-PCR and Western blot. The potential miRNAs for Nrf2 were predicted by bioinformatic analysis. The binding interaction between miR-448-3p and Nrf2 was determined by luciferase reporter assay. The effects of miR-448-3p on neurological deficit, infarct volume, and brain water content in mice were tested. The effects of miR-448-3p on oxidative stress indicators (SOD activity, MDA content, and ROS production) were detected by commercial assay kits. The levels of HO-1 and cleaved caspase-3 were evaluated by Western blot. Cell viability was evaluated by MTT assay, and cell apoptosis was evaluated by TUNEL staining and flow cytometry. RESULTS: Nrf2 was significantly downregulated and miR-448-3p was upregulated in cerebral I/R injury both in vivo and in vitro. MiR-448-3p downregulation efficiently attenuated brain injury and reduced oxidative stress and apoptosis. MiR-448-3p was identified to act as ceRNA of Nrf2 and negatively regulated Nrf2 expression, which was consistent with the animal studies. In addition, Nrf2 silencing obviously attenuated the neuroprotective effects of miR-448-3p inhibitor in vitro. CONCLUSION: MiR-448-3p participated in the regulation of cerebral I/R injury via inhibiting Nrf2.

Long non-coding RNA AK006774 inhibits cardiac ischemia-reperfusion injury via sponging miR-448.

In recent years, the incidence and mortality of myocardial infarction (MI) have been increasing throughout the world, threatening public health. Non-coding RNAs (ncRNAs), including microRNAs (miRNAs) and long non-coding RNAs (lncRNAs), play critical roles in the progression of MI. The present study aimed to investigate the role of lncRNA AK006774 in the progression of myocardial infarction and find out novel therapeutic or diagnostic target of myocardial infarction. A mouse ischemia/reperfusion (I/R) model and 2,3,5-Triphenyte-trazoliumchloride (TTC) staining were performed to evaluate the effects of AK006774 on I/R injury in vivo. Hypoxia/reoxygenation (H/R) models using primary cardiomyocytes have been established. Flow cytometry and Terminal Deoxynucleotide Transferase dUTP Nick End Labeling (TUNEL) assays were performed to evaluate the effects of AK006774 on cardiomyocyte apoptosis. Luciferase and RNA pull-down assays were performed to verify the interaction between miR-448 and its targets. Western blotting and quantitative PCR were performed to determine protein and gene expression, respectively. We first found that AK006774 overexpression reduced I/R-induced infarct area and cardiomyocyte apoptosis in vivo. Accordingly, AK006774 inhibited apoptosis and oxidative stress in cardiomyocytes subjected to H/R treatment in vitro. Mechanistically, AK006774 modulated the expression of bcl-2 by sponging miR-448. Overexpression of miR-448 antagonized the effects of AK006774 on cardiomyocyte apoptosis. The AK006774/miR-448/bcl-2 signaling axis acts as a key regulator of I/R injury and may be a potential therapeutic or diagnostic target for the treatment of MI.

Circular RNA circHIPK3 modulates prostate cancer progression via targeting miR-448/MTDH signaling.

PURPOSE: Prostate cancer (PCa) is one of the most diagnosed cancers in men worldwide. Several studies have identified that circular RNAs (circRNAs) have a crucial impact on the biological processes in PCa. Therefore, it is necessary to study the molecular mechanism of circRNAs in tumor progression and metastasis. METHODS: RNA interference was used to decrease circHIPK3 and MTDH expression. Overexpression vector was used to increase circHIPK3 and MTDH expression. Luciferase reporter assay were used to detect the relationship between circHIPK3 and miR-448 or between miR-448 and MTDH. MTT assay, colony formation assay and transwell assay were used to measure proliferation and migration of PCa cells. RESULTS: Circular RNA circHIPK3 was significantly increased in PCa tissues and cell lines. And overexpression of circHIPK3 promoted the migration, proliferation, and invasion of PC-3 and 22Rv1 cells, while knockdown of circHIPK3 markedly repressed the above-mentioned series of biological processes. Furthermore, circHIPK3 promoted metadherin (MTDH) expression by sponging miR-448. In vivo experiments, it was also found that overexpression of circHIPK3 significantly promoted tumor growth. CONCLUSIONS: Our research shows that circHIPK3 plays a carcinogenic effect in PCa by regulating the miR-448/MTDH axis, indicating that circHIPK3 may be a potential therapeutic target for PCa.

LncRNA PITPNA-AS1 as a Potential Diagnostic Marker and Therapeutic Target Promotes Hepatocellular Carcinoma Progression via Modulating miR-448/ROCK1 Axis.

Background: Long non-coding RNAs are critical to hepatocellular carcinoma (HCC) developments. LncRNA PITPNA antisense RNA 1 (PITPNA-AS1) is a new regulator in several tumors. However, the mechanism by which PITPNA-AS1 mediates the tumorigenesis of HCC remains unclear. Methods: RT-qPCR was used to detect the level of PITPNA-AS1 in HCC specimens and cells. The biological functions of PITPNA-AS1 were explored by several functional experiments in vivo and in vitro. The binding relationship among PITPNA-AS1, miR-448 and ROCK1 were studied by Luciferase assay and pull-down assays. Results: We found that PITPNA-AS1 expressions were distinctly upregulated in both HCC specimens and cell lines. High PITPNA-AS1 levels were an unfavorable biomarker for patients with HCC. Functionally, knockdown of PITPNA-AS1 suppressed the proliferation, migration and invasion of HCC cells. Mechanistically, PITPNA-AS1 functioned as competing endogenous RNA to increase ROCK1 expressions via sponging miR-448. Conclusion: The newly identified PITPNA-AS/miR-448/ROCK1 axis promoted the oncogenicity of HCC cells. This novel axis is likely to be a promising HCC therapeutic aim.

LncRNA XIST regulates cell proliferation, migration and invasion of glioblastoma via regulating miR-448 and ROCK1.

Long non-coding ribonucleic acids (lncRNAs) have been recognized as markers in several cancers and play important roles in glioblastoma (GBM). But the role of lncRNA X inactive-specific transcript (XIST) in GBM and its possible mechanisms are rarely studied in depth. This study was conducted to explore the detailed roles of XIST in cell proliferation, migration, and invasion of GBM. Expressions of XIST, miR-448, and ρ associated coiled coil containing protein kinase 1 (ROCK1) were detected by qRT-PCR or Western blot in A172 and U251 cells. The interactions among XIST, miR-448 and ROCK1 were verified through luciferase reporter assay and RNA immunoprecipitation (RIP) assay. Cell Counting Kit-8 (CCK-8) assay and Transwell assay were introduced to detect how XIST knockdown, miR-448 overexpression, or along with ROCK1 overexpression affect cellular malignancy of GBM cells. XIST and ROCK1 were up-regulated while miR-448 expression was decreased in GBM cells. XIST knockdown or miR-448 overexpression could dramatically inhibit GBM cell proliferation, migration, and invasion. Moreover, XIST negatively regulated miR-448 expression through the function as competing endogenous RNA (ceRNA), thus leading to the up-regulation of ROCK1, one miR-448 target gene. Moreover, ROCK1 overexpression could reverse the suppression of XIST knockdown or miR-448 upregulation on cellular malignancy. In brief, the effects of XIST may promote cellular malignancy of GBM through miR-448/ROCK1 axis, which will provide new understanding of GBM pathogenesis and progression.

Tumor expression of miR-448 is a prognostic marker in oral squamous cell carcinoma.

BACKGROUND: Prognosis is poor for patients with malignant progression such as distant metastasis of oral squamous cell carcinoma (OSCC). Evidence indicates that miR-448 promotes the proliferation and inhibits apoptosis of OSCC cells. Therefore, we aimed to investigate the function of miR-448 to predict tumor progression and prognosis of OSCC. METHODS: Real-time quantitative reverse transcription PCR was used to measure miR-448 expression in 221 pairs of OSCC tissues and the corresponding noncancerous tissues. Patients were diagnosed with OSCC from 2009 through 2011 at the Tianjin Medical University Cancer Institute and Hospital. Chi-squared tests were performed to assess the associations between miR-448 expression and clinicopathological parameters. Kaplan-Meier analysis was employed to evaluate the association of overall survival (OS) and disease-free survival (DFS) with miR-448 levels. Univariate and multivariate analyses were performed using the Cox proportional hazards regression model. RESULTS: We show here that miR-448 expression was significantly up-regulated in OSCC tissues compared with noncancerous tissues (P < 0.01). High miR-448 expression was significantly associated with advanced T stage (P = 0.001), lymph node metastasis (P = 0.007) and higher TNM stage (P = 0.009). Moreover, Kaplan-Meier and univariate analyses revealed that patients with high expression of miR-448 experienced significantly shorter OS and DFS. Furthermore, multivariate analysis demonstrated that miR-448 expression was an independent prognostic factor for OS (P = 0.004) and DFS (P = 0.002). CONCLUSIONS: Our present data suggests that miR-448 may play an important role in tumor progression and serves as a prognostic marker for OSCC. Further studies are required to assess the potential value of miR-448 to contribute to personalized treatment of OSCC.

MiR-448 targets BLC2 and inhibits the growth of pituitary adenoma cells.

There is an increasing body of evidence indicating the important roles of miRNAs in the progression of pituitary adenoma. Recent studies have shown decreased expression and tumor suppressive function of miR-448 in cancers; however, the clinical significance of miR-448 in pituitary adenoma has remained largely unknown. In our study, we found that miR-448 was down-regulated in pituitary adenoma tissues and cell lines. Overexpression of miR-448 significantly inhibited the proliferation and migration of pituitary adenoma cells. Increased cell apoptosis was also observed with overexpression of miR-448. To further understand the mechanisms behind the regulation of pituitary adenoma by miR-448 in, the targets of miR-448 were predicted using the bioinformatics tools. B cell lymphoma 2 (BCL2) was identified as a target of miR-448. MiR-448 bound the 3'-untranslated region (UTR) of BCL2 and inhibited the expression of BCL2 in pituitary adenoma cells. There was a consistent and significantly negative correlation between the level of miR-448 and BCL2 in pituitary adenoma tissues. When BCL2 was highly expressed, the inhibitory impact of miR-448 on the proliferation and apoptosis of pituitary adenoma cells was significantly inhibited. Collectively, our findings emphasize the significance of the miR-448-BCL2 axis in the development of pituitary adenoma, highlighting the potential therapeutic significance of miR-448 in pituitary adenoma.

Circular RNA circ-ZEB1 acts as an oncogene in triple negative breast cancer via sponging miR-448.

BACKGROUND: Circular RNAs (circRNAs) play an important role in tumor development. The miRNA sponge is a common role played by circRNAs in various tumors, including breast cancer. OBJECTIVE: This study aimed to explore the role of circ-ZEB1 in the proliferation and apoptosis of triple negative breast cancer (TNBC) cells. METHODS: The expressions of several circRNAs which were predicted to be bound with miR-448 were detected in 30 clinical TNBC tumor tissues and paired paracancer tissues. The cell counting kit-8 assay was performed to detect the TNBC cell proliferation. The TNBC cell apoptosis was detected using the TUNEL assay. The binding between circ-ZEB1 and miR-448, as well as between miR-448 and eukaryotic elongation factor 2 kinase (eEF2 K), was detected using the RNA pull-down assay and/or the luciferase reporter assay. The effect of circ-ZEB1 knockdown on TNBC tumor growth was detected using the mouse xenograft model. RESULTS: Compared with normal tissues and breast epithelial cells, the expression of circ-ZEB1 was markedly higher in TNBC tumor tissues and tumor cell lines. The small hairpin RNA-mediated circ-ZEB1 knockdown inhibited TNBC cell proliferation and induced cell apoptosis. The RNA pull-down assay and the luciferase reporter assay confirmed the binding between circ-ZEB1 and miR-448, as well as between miR-448 and eEF2 K. The knockdown of circ-ZEB1 was proven to inhibit TNBC cell proliferation and tumor growth via releasing miR-448, and subsequently reducing the expression of the miR-448 target, eEF2 K. CONCLUSION: In conclusion, our findings identified a new functional circ-ZEB1 in TNBC tumorigenesis, and revealed the important regulatory role of circ-ZEB1 via sponging miR-448, providing a novel insight for TNBC pathogenesis.

miR-448-3p alleviates diabetic vascular dysfunction by inhibiting endothelial-mesenchymal transition through DPP-4 dysregulation.

Diabetes mellitus (DM) often causes vascular endothelial damage and alters vascular microRNA (miR) expression. miR-448-3p has been reported to be involved in the development of DM, but whether miR-448-3p regulates diabetic vascular endothelial dysfunction remains unclear. To investigate the molecular mechanism of diabetic vascular endothelial dysfunction and the role of miR-448-3p therein, Sprague-Dawley rats were injected with streptozotocin (STZ) to establish diabetic animal model and the rat aortic endothelial cells were treated with high glucose to establish diabetic cell model. For the treatment group, after the induction of diabetes, the miR-448-3p levels in vivo and in vitro were upregulated by adeno-associated virus serotype 2 (AAV2)-miR-448-3p injection and miR-448-3p mimic transfection, respectively. Our results showed that AAV2-miR-448-3p injection alleviated the body weight loss and blood glucose level elevation induced by STZ injection. The miR-448-3p level was significantly decreased and the dipeptidyl peptidase-4 (DPP-4) messenger RNA level was increased in diabetic animal and cell models, which was reversed by miR-448-3p treatment. Moreover, the diabetic rats exhibited endothelial damage and endothelial-mesenchymal transition (EndMT), while AAV2-miR-448-3p injection relieved those situations. In vitro experiments demonstrated that miR-448-3p overexpression in endothelial cells alleviated endothelial damage by inhibiting EndMT through blocking the transforming growth factor-ß/Smad pathway. We further proved that miR-448-3p negatively regulated DPP-4 by binding to its 3'-untranslated region, and DPP-4 overexpression reversed the effect of miR-448-3p overexpression on EndMT. Overall, we conclude that miR-448-3p overexpression inhibits EndMT via targeting DPP-4 and further ameliorates diabetic vascular endothelial dysfunction, indicating that miR-448-3p may serve as a promising therapeutic target for diabetic endothelial dysfunction.

MicroRNA-448 targets SATB1 to reverse the cisplatin resistance in lung cancer via mediating Wnt/ß-catenin signalling pathway.

This study aims to examine whether miR-448 reverses the cisplatin (DDP) resistance in lung cancer by modulating SATB1. QRT-PCR and immunohistochemistry were used to examine the miR-448 and SATB1 expressions in DDP-sensitive and -resistant lung cancer patients. A microarray was used to investigate the cytoplasmic/nucleic ratio (C/N ratios) of genes in A549 cells targeted by miR-448, followed by Dual-luciferase reporter gene assay. A549/DDP cells were transfected with miR-448 mimics/inhibitors with or without SATB1 siRNA followed by MTT assay, Edu staining, flow cytometry, qRT-PCR and western blotting. MiR-448 was lower but SATB1 was increased in DDP-resistant patients and A549/DDP cells. And the patients showed low miR-448 expression or SATB1 positive expression had poor prognosis. SATB1, as a target gene with higher C/N ratios (>1), was found negatively regulated by miR-448. Besides, miR-448 inhibitors increased resistance index of A549/DDP cells, promoted cell proliferation, increased cell distribution in S phrase, declined cell apoptosis and activated Wnt/ß-catenin pathway. However, SATB1 siRNA could reverse the above effect caused by miR-448 inhibitors. MiR-448 targeting SATB1 to counteract the DDP resistance of lung cancer cells via Wnt/ß-catenin pathway.

Knockdown of Linc00052 alleviated spinal nerve ligation-triggered neuropathic pain through regulating miR-448 and JAK1.

The dysfunction of the nervous system contributes to neuropathic pain. Long noncoding RNAs are reported to participate in neuropathic pain. Recently, Linc00052 is implicated to be closely associated with multiple diseases. Nevertheless, the mechanisms of Linc00052 remain barely explored in neuropathic pain development. Currently, spinal nerve ligation (SNL) triggered neuropathic pain was employed in our investigation. Here, we assessed the function of Linc00052 in SNL rat models. Interestingly, we reported Linc00052 was significantly elevated in SNL rats. Loss of Linc00052 could reduce neuropathic pain progression via regulating the behaviors of neuropathic pain. Additionally, knockdown of Linc00052 repressed the processes of neuroinflammation. Interleukin (IL)-6 and tumor necrosis factor α level were inhibited while IL-10 was induced by the silence of Linc00052. Moreover, we predicted miR-448 can serve as a target of Linc00052. miR-448 exerts a crucial power in several diseases. Currently, we exhibited miR-448 was remarkably downregulated in SNL rats. RNA immunoprecipitation experiments validated the association between miR-448 and Linc00052. Inhibition of Linc00052 could reverse the roles of miR-448 on neuropathic pain development. Furthermore, Janus kinase 1 (JAK1) was displayed as the putative target of miR-448 in the present investigation. It was showed that JAK1 was induced in SNL rats. Loss of miR-448 could dramatically induce the expression of JAK1, which was rescued by knockdown of Linc00052. Taken these together, our study implied that Linc00052 functioned as a novel target of neuropathic pain via sponging miR-448 and regulating JAK1.

The antitumor effect of miR-448 in epithelial ovarian cancer.

BACKGROUND: Ovarian cancer (OC) is the seventh most commonly diagnosed cancer in the world and the tenth most common in China. Target agents such as bevacizumab and poly (ADP-ribose) polymerase (PARP) inhibitors show efficacy only in the early stages of some cases; therefore, more effective molecular targeting agents need to be developed. microRNAs (miRNA) have emerged as new biomarkers in the clinical diagnosis and treatment of OC. Among these, miRNA-448 has been shown to exert a tumor-suppressor role in numerous cancer types. However, the function of miR-448 in OC remains poorly understood. METHODS: The miR-448 in cancer tissues and cell lines was tested by quantitative real-time polymerase chain (qRT-PCR). The miR-448 levels were altered by miR-448 mimics (UUGCAUAUGUAGGAUGUCCCAU) or miR-448 antisense oligonucleotide transfection (miR20001532-1-5). Cell growth was evaluated by MTT assay, and cell apoptosis was assayed by annexin V-FITC (detecting apoptotic cells by binding to phosphatidylserine) and propidium iodide (PI, detecting death cells by binding to DNA) (Cat. No. ab54775, Abacam). The target gene of miR-448 was confirmed by dual-luciferase reporter assays. RESULTS: In this study, we found that miR-448 showed low expression in epithelial ovarian cancer (EOC) tissues and that the low expression of miR-448 was related to low survival rate. miR-448 may thus inhibit cellular proliferation and promote apoptosis by binding the 3'UTR of zinc finger E-box-binding homeobox 2 (ZEB2) and inhibiting the expression of ZEB2. CONCLUSIONS: Our study suggests that miR-448 has an inhibitory role in OC.

miR-448 targets IDO1 and regulates CD8+ T cell response in human colon cancer.

BACKGROUND: Indoleamine 2,3-dioxygenase 1 (IDO1) is a critical regulator of T cell function, contributing to immune tolerance. Upregulation of IDO1 has been found in many cancer types; however, the regulatory mechanisms and clinical significance of IDO1 in colon cancer are still unclear. Here, we investigated the role of dysregulated microRNA (miRNA) targeting IDO1 in the colon cancer microenvironment. METHODS: We elucidated IDO1 function by performing cell-based assays and establishing transplanted tumor models in BALB/c mice and BALB/c nude mice. We evaluated IDO1 protein expression by immunohistochemistry (IHC) in a tissue microarray (TMA) and analyzed IDO1 mRNA expression with The Cancer Genome Atlas (TCGA). We screened miRNAs targeting IDO1 by using a dual luciferase reporter assay. We tested the function of microRNA-448 (miR-448) by using western blotting (WB) and fluorescence-activated cell sorting (FACS). RESULTS: We demonstrated that stable IDO1 overexpression enhanced xenograft tumor growth in BALB/c mice but not in BALB/c nude mice. We also revealed the involvement of posttranscriptional regulation of IDO1 in colon cancer by observing IDO1 protein levels and mRNA levels. Furthermore, ectopic expression of miRNA mimics suggested that miR-448 could significantly downregulate IDO1 protein expression. Notably, we proved that miR-448 suppressed the apoptosis of CD8+ T cells by suppressing IDO1 enzyme function. CONCLUSION: Our findings indicated that IDO1 suppressed the CD8+ T cell response in colon cancer. miR-448, as a tumor-suppressive miRNA, enhanced the CD8+ T cell response by inhibiting IDO1 expression. The results provide a theoretical basis for the development of new immunotherapy for the treatment of colon cancer.