RESUMO
The purpose of this paper is to expand on the phenotype of oculocutaneous albinism type 7 (OCA7). We described three patients with OCA7: two from a consanguineous family of Kurdish origin and one patient of Dutch origin. We compared them with all patients described to date in the literature. All newly described patients had severely reduced visual acuity (VA), nystagmus, hypopigmentation of the fundus, severe foveal hypoplasia, and chiasmal misrouting. None had iris translucency. All patients had normal pigmentation of skin and hair. We found one novel mutation in the Dutch patient: c.565G > A; p.(Gly189Ser). We compared our patients to the 15 described in the literature to date. All 18 patients had substantially pigmented skin and hair, very poor VA (0.4-1.3 logMAR), nystagmus, (mild) ocular hypopigmentation, foveal hypoplasia, and misrouting. Although pigmentation levels were mildly affected in OCA7, patients had a severe ocular phenotype with VA at the poorer end of the albinism spectrum, severe foveal hypoplasia, and chiasmal misrouting. OCA7 patients had a phenotype restricted to the eyes, and similar to that of X-linked ocular albinism. We therefore propose to rename the disorder in ocular albinism type 2. Unfolding the role of LRMDA in OCA7, may bring us a step closer in identifying the responsible factors for the co-occurrence of foveal hypoplasia and misrouting.
Assuntos
Albinismo Ocular , Albinismo Oculocutâneo , Hipopigmentação , Nistagmo Patológico , Humanos , Albinismo Ocular/diagnóstico , Albinismo Ocular/genética , Albinismo Oculocutâneo/diagnóstico , Albinismo Oculocutâneo/genética , Retina , Mutação , Transtornos da VisãoRESUMO
Aland island eye disease (AIED), an incomplete form of X-linked congenital stationary night blindness (CSNB2A), and X-linked cone-rod dystrophy type 3 (CORDX3) display many overlapping clinical findings. They result from mutations in the CACNA1F gene encoding the α1F subunit of the Cav1.4 channel, which plays a key role in neurotransmission from rod and cone photoreceptors to bipolar cells. Case report: A 57-year-old Caucasian man who had suffered since his early childhood from nystagmus, nyctalopia, low visual acuity and high myopia in both eyes (OU) presented to expand the diagnostic process, because similar symptoms had occurred in his 2-month-old grandson. Additionally, the patient was diagnosed with protanomalous color vision deficiency, diffuse thinning, and moderate hypopigmentation of the retina. Optical coherence tomography of the macula revealed retinoschisis in the right eye and foveal hypoplasia in the left eye. Dark-adapted (DA) 3.0 flash full-field electroretinography (ffERG) amplitudes of a-waves were attenuated, and the amplitudes of b-waves were abolished, which resulted in a negative pattern of the ERG. Moreover, the light-adapted 3.0 and 3.0 flicker ffERG as well as the DA 0.01 ffERG were consistent with severely reduced responses OU. Genetic testing revealed a hemizygous form of a stop-gained mutation (c.4051C>T) in exon 35 of the CACNA1F gene. This pathogenic variant has so far been described in combination with a phenotype corresponding to CSNB2A and CORDX3. This report contributes to expanding the knowledge of the clinical spectrum of CACNA1F-related disease. Wide variability and the overlapping clinical manifestations observed within AIED and its allelic disorders may not be explained solely by the consequences of different mutations on proteins. The lack of distinct genotype-phenotype correlations indicates the presence of additional, not yet identified, disease-modifying factors.
Assuntos
Albinismo Ocular , Oftalmopatias Hereditárias , Doenças Genéticas Ligadas ao Cromossomo X , Miopia , Cegueira Noturna , Doenças Retinianas , Retinose Pigmentar , Retinosquise , Masculino , Humanos , Pré-Escolar , Lactente , Pessoa de Meia-Idade , Canais de Cálcio Tipo L/metabolismo , Doenças Genéticas Ligadas ao Cromossomo X/genética , Retina/metabolismo , MutaçãoRESUMO
SIGNIFICANCE: Carriers of ocular albinism demonstrate signs of retinal mosaicism with unique features on fundus autofluorescence testing, which differentiate this condition from other x-linked retinal disorders in carrier patients. Distinctive findings include a mud-splattered fundus with peripheral hyperpigmented streaks, which correlate with areas of hyperautofluorescence and hypoautofluorescence. PURPOSE: This is the first reported case series of a family that demonstrates diagnostic retinal and fundus autofluorescence abnormalities related to retinal mosaicism in three sisters who were unaware they were carriers of ocular albinism type 1. Multimodal imaging, electrodiagnostic testing, and genetic testing can be used to confirm the diagnosis and differentiate this clinical presentation from other sight-threatening hereditary retinal diseases. CASE REPORTS: Three sisters, aged 21, 17, and 13 years, were referred to determine the cause of abnormal retinal pigmentation. All presented with normal vision, and anterior segment examination was unremarkable without iris transillumination. They denied family history of ocular disease. Fundus examination of all three sisters revealed a mud-splattered pattern of pigmentation in the posterior pole and radial pigmentary streaks. Fundus autofluorescence showed a pattern of hyperautofluorescence and hypoautofluorescence corresponding to this pigmentary pattern. Spectral domain optical coherence tomography, electro-oculogram, and electroretinogram were normal in all three sisters. Genetic testing of their father, who was unaware of any disorder, tested positive for ocular albinism. CONCLUSIONS: Ocular albinism carriers have abnormal retinal pigmentation in a characteristic pattern. Fundus autofluorescence shows a correlative pattern that can confirm carrier status of ocular albinism in individuals unaware of their status and rule out other retinal degenerations.
Assuntos
Albinismo Ocular , Humanos , Albinismo Ocular/diagnóstico , Albinismo Ocular/genética , Retina , Fundo de Olho , Eletrorretinografia , Tomografia de Coerência Óptica , AngiofluoresceinografiaRESUMO
INTRODUCTION: Hermansky-Pudlak syndrome (HPS) is a rare autosomal-recessive disease characterized by ocular albinism (OA) or oculocutaneous albinism (OCA), platelet dysfunction, and other symptoms. This study aimed to analyze the molecular defect in two Chinese families with suspected OA, as well as to investigate the profile of HPS6 variants and their genotype-phenotype correlations. METHODS: Seven members from two families were recruited and underwent clinical ophthalmologic examinations. The genomic DNA was extracted from peripheral blood leukocytes. Whole-exome sequencing was performed on the proband of family JX. The single coding exon of HPS6 was directly Sanger sequenced based on PCR amplification in all available family members. An additional 46 probands from families or sporadic cases with the pathogenic variants of HPS6 reported in the literature were reviewed. RESULTS: We identified two different compound heterozygous truncating variants of HPS6 in probands with suspected OA from two independent families. The proband of family JX had c.1674dup and c.503-504del variants, and the other proband from family CZ had a nonsense variant of c.1114C>T and a frameshift variant of c.1556del. Among them, c.1674dup and c.1556del variants in HPS6 have not been reported previously. Therefore, our patients were diagnosed as HPS6 disease by molecular diagnostics. In the retrospective cohort of HPS6 patients, we delineated the profile of HPS6 variants and revealed a significant overlap between CpG islands and the variants of HPS6, suggesting a potential link between DNA methylation and HPS6 variants. We also observed a spatial aggregation of the variants in 3D structure of HPS6 protein, implying the possible functional significance of these structural regions. In addition, we did not find any significant genotype-phenotype correlation of HPS6, and neither did we observe a correlation between the truncation length of the HPS6 protein and the phenotype of HPS6 disease. CONCLUSION: Our research expands the spectrum of HPS6 variants, providing a comprehensive delineation of their profile and systematically investigating genotype-phenotype correlations in HPS6. These findings could offer potentially valuable clues for investigating the molecular mechanism underlying HPS6 pathogenesis, as well as aiding the clinical diagnosis of HPS6 patients and improving disease prognosis.
Assuntos
Albinismo Ocular , Síndrome de Hermanski-Pudlak , Humanos , Albinismo Ocular/diagnóstico , Albinismo Ocular/genética , Estudos Retrospectivos , Síndrome de Hermanski-Pudlak/diagnóstico , Síndrome de Hermanski-Pudlak/genética , Fenótipo , Proteínas/genética , Mutação , Linhagem , Peptídeos e Proteínas de Sinalização Intracelular/genéticaRESUMO
Purpose: The aim of this systematic review was to investigate the available data on the epidemiology of oculocutaneous albinism (OCA) around the world, and to determine whether a generalizable, worldwide prevalence figure could be proposed. Methods: Extensive literature search strategies were conducted, interrogating PubMed, Scopus, and Web of Science, to locate relevant literature. Ultimately 34 studies reporting original data were included for analysis. Results: Findings showed that most data were outdated, and only 6 of 34 articles (18%) were published after 2010. There were few good studies with sound methodology and large, clearly defined population samples. Only a small proportion of countries worldwide (26/193 [13%]) have produced prevalence figures for OCA. By continent, African studies were disproportionately represented (15/34 [44%]). The highest prevalence rates (range, 1 in 22 to 1 in 1300; mean, 1 in 464) were reported in population isolates. The mean prevalence from four African countries was 1 in 4264 (range, 1 in 1755 to 1 in 7900). Prevalence for three countries in Europe (mean, 1 in 12,000; range, 1 in 10,000 to 1 in 15,000) may be underestimated, as the phenotype, in fair-skinned populations, may be missed or misdiagnosed as ocular albinism or isolated visual impairment. Population rates may vary depending on local cultural factors (e.g., consanguineous matings) and may change over time. Conclusions: The prevalence of OCA varies widely between continents and population groups, and it is often influenced by local factors. It was not possible, therefore, to determine a single, generalizable worldwide prevalence rate for OCA, although continental rates for Africa and Europe are useful.
Assuntos
Albinismo Ocular , Albinismo Oculocutâneo , Humanos , Mutação , Prevalência , Albinismo Oculocutâneo/epidemiologia , Albinismo Oculocutâneo/diagnóstico , Fenótipo , Albinismo Ocular/epidemiologia , Albinismo Ocular/genéticaAssuntos
Albinismo Ocular , Humanos , Albinismo Ocular/diagnóstico , Albinismo Ocular/genética , Retina , Acuidade Visual , CorioideRESUMO
The diagnostic yield of genetic testing for ocular/oculocutaneous albinism (OA/OCA) in a diverse pediatric population in the United States (U.S.) is unclear. Phenotypes of 53 patients who presented between 2006-2022 with OA/OCA were retrospectively correlated with genetic testing results. Genetic diagnostic yield was defined as detection of pathogenic/likely pathogenic variant(s) matching the anticipated inheritance for that gene-disease relationship. Variant reclassifications of those with variants of uncertain significance (VUS) and without positive diagnostic yield were completed. Overall initial genetic diagnostic yield of OA/OCA was 66%. There was no significant difference (p = 0.59) between race and ethnicities (Black (78%), White (59%), Hispanic/Latino (64%)); however, the diagnostic yield of OA (33%) was significantly lower (p = 0.007) than OCA (76%). Causative variants in OCA2 (28%) and TYR (20%) were most common. Further, Hermansky-Pudlak syndrome variants were identified in 9% of patients. Re-classification of VUS in non-diagnostic cases resulted in genetic diagnoses for 29% of individuals and increased overall diagnostic yield to 70% of all subjects. There is a high diagnostic yield of genetic testing of patients overall with OA/OCA in a diverse U.S. based pediatric population. Presence or absence of cutaneous involvement of albinism significantly affects genetic diagnostic yield.
Assuntos
Albinismo Ocular , Síndrome de Hermanski-Pudlak , Criança , Humanos , Estudos Retrospectivos , Mutação , Proteínas de Membrana Transportadoras/genética , Testes Genéticos , Albinismo Ocular/genética , Síndrome de Hermanski-Pudlak/genéticaRESUMO
BACKGROUND: Oculocutaneous albinism (OCA) could be either non-syndromic or syndromic. There are significant challenges in clinically recognizing and differentiating Hermansky-Pudlak syndrome (HPS) from non-syndromic OCA. MATERIALS AND METHODS: In a prospective consecutive case series, 63 patients (less than 18 years old) with a molecular genetic diagnosis of albinism (except OCA1A), Ocular albinism (OA) and Hermansky-Pudlak syndrome seen over a 3-year period were evaluated and analyzed. Hair colour, iris colour was graded, compared and correlated with the degree of fundus pigmentation and foveal development. RESULTS: A total of 63 patients were evaluated. Forty-five patients had non-syndromic OCA (11 OCA1B, 24 OCA2, 9 OCA4, and 1 OCA6), 5 patients had OA and 13 patients had HPS. All 3 BLOC-related HPS categories were seen (1 with BLOC1, 7 with BLOC-2 and 5 with BLOC-3 related HPS). All patients with OA were hyperopic, had darker fundus pigmentation, but had poor foveal development. All HPS patients had lighter fundus pigmentation. The degree of fundus pigmentation correlated positively with the iris pigmentation and also with the foveal development only in OCA2. CONCLUSIONS: Careful observation of the phenotype by comparison of the skin, hair, iris colour, with the degree of fundus pigmentation and foveal development may help clinically differentiate HPS from OCA patients of Chinese ethnicity even in the absence of any bleeding tendency.
Assuntos
Albinismo Ocular , Albinismo Oculocutâneo , Albinismo , Síndrome de Hermanski-Pudlak , Humanos , Síndrome de Hermanski-Pudlak/diagnóstico , Síndrome de Hermanski-Pudlak/genética , População do Leste Asiático , Estudos Prospectivos , Albinismo Oculocutâneo/diagnóstico , Albinismo Oculocutâneo/genética , Albinismo Ocular/diagnóstico , Albinismo Ocular/genética , Cabelo , IrisRESUMO
Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.
Assuntos
Proteínas do Olho , Doenças Genéticas Ligadas ao Cromossomo X , Glicoproteínas de Membrana , Nistagmo Congênito , Humanos , Albinismo Ocular/genética , Albinismo Ocular/diagnóstico , Proteínas do Olho/genética , Iris , Glicoproteínas de Membrana/genética , Mutação/genética , Nistagmo Congênito/genética , Nistagmo Congênito/diagnóstico , LinhagemRESUMO
A 16-year-old male patient had poor binocular vision, alternating exotropia, horizontal nystagmus, and no obvious pigmentation loss in the eyes and other parts of the body. Optical coherence tomographic examination showed no normal central macular depression. The three-channel flash visual evoked potential method was used to examine each eye. The left and right channel reactions were found to be significantly asymmetric, and the clinical diagnosis was ocular albinism.
Assuntos
Albinismo Ocular , Masculino , Humanos , Adolescente , Potenciais Evocados Visuais , Acuidade Visual , Visão Binocular/fisiologia , Tomografia de Coerência ÓpticaRESUMO
BACKGROUND: Albinism is a group of genetic disorders characterized by general skin and retinal hypopigmentation. It is in most cases an autosomal recessive condition. Foveal hypoplasia (FH) is one of the main criteria for the diagnosis of albinism. The aim of this study was to analyze the macular profile of the parents of patients with albinism. METHODS: This study included a case series of 27 patients with albinism seen in Rothschild Foundation between April 2017 and February 2020. Spectral-domain optical coherence tomography (SD-OCT) and OCT angiography (OCT-A) were performed in every patient when possible and in every available parents. FH was graded according to Thomas' classification based on OCT. Next generation sequencing-based gene panel testing was performed in parents and children when a FH was detected on OCT in a parent. RESULTS: Twenty-seven patients with albinism were examined. Nine parents had FH based on the OCT B-scan (33%). In parents without FH based on the SD-OCT B-scan (67%), OCT-A showed a reduced avascular zone in the deep vascular plexus in 4 parents. Six parents carried variants that could explain their phenotype, including TYR R402Q hypomorphic alleles. CONCLUSION: This study showed the presence of FH in parents of patients with albinism, and aimed to genetically explain this phenotype.
Assuntos
Albinismo Ocular , Albinismo Oculocutâneo , Albinismo , Humanos , Fóvea Central/anormalidades , Retina , Albinismo/genética , Albinismo Oculocutâneo/diagnóstico , Albinismo Oculocutâneo/genética , Albinismo Ocular/diagnóstico , Albinismo Ocular/genética , Transtornos da Visão/diagnóstico , Tomografia de Coerência Óptica/métodosRESUMO
This case series details macular findings in three female siblings who were found to be carriers of a previously unreported splice mutation in GPR143 (X-linked ocular albinism [OA1]). Presumed lyonization is responsible for both the subtle and varied findings in OA1 carriers, even among siblings, and especially in patients with darker skin pigmentation. In this series, we used green-light autofluorescence to reveal subtle subfoveal involvement and used optical coherence tomography angiography to uncover previously unreported narrowing of the foveal avascular zone, consistent with foveal hypoplasia. [Ophthalmic Surg Lasers Imaging Retina 2022;53:460-463.].
Assuntos
Albinismo Ocular , Albinismo Ocular/diagnóstico , Albinismo Ocular/genética , Proteínas do Olho/genética , Feminino , Humanos , Glicoproteínas de Membrana/genética , MutaçãoRESUMO
Purpose: To study the retinal and choroidal thickness variations on enhanced depth imaging optical coherence tomography scans in ocular albinism (OA) and compare with age-matched healthy subjects. Methods: This retrospective observational study had 48 eyes of 24 patients diagnosed clinically as OA and age, sex, and axial length-matched control healthy subjects. All patients underwent detailed ophthalmic examination and a single-line horizontal-raster enhanced depth imaging - optical coherence tomography scan (Spectralis, Heidelberg Engineering). Retinal and choroidal thickness was measured, compared, and analyzed between the two groups. Mann-Whitney U test was used for analysis between the two groups. P < 0.05 was considered significant. Results: The mean age was 28.3 ± 11.6 and 29.9 ± 10.6 years in the OA group and control group, respectively. Spherical equivalents ranged from -8.5D to +10.5D in the OA group and from -8.0D to +10.0D in the control group. The mean axial length between the two groups (P = 0.652) were comparable. The average retinal thickness (272 ± 34.3 vs. 213 ± 13.8 µm; P < 0.001) was greater in the OA group as compared to controls. The mean choroidal thickness (184 ± 78.4 vs. 287 ± 46.4 µm; P < 0.001) was significantly thinner in the OA group. Conclusion: Acquisition of OCT scans in OA can be challenging. This study showed that the subfoveal retinal thickness and choroidal thickness measured across the scans were significantly different in the OA group compared to controls. In the future, more studies are required to evaluate the role of the choroid and its relationship to emmetropization in albinism.
Assuntos
Albinismo Ocular , Adolescente , Adulto , Albinismo Ocular/diagnóstico , Corioide , Humanos , Retina/diagnóstico por imagem , Estudos Retrospectivos , Tomografia de Coerência Óptica/métodos , Adulto JovemRESUMO
Mutations in the GPR143 gene cause X-linked ocular albinism type 1 (OA1), a disease that severely impairs vision. We recently generated induced pluripotent stem cells (iPSCs) from skin fibroblasts of an OA1 patient carrying a point mutation in intron 7 of GPR143. This mutation activates a new splice site causing the incorporation of a pseudoexon. In this study, we present a high-performance CRISPR-Cas ribonucleoprotein strategy to permanently correct the GPR143 mutation in these patient-derived iPSCs. Interestingly, the two single-guide RNAs available for SpCas9 did not allow the cleavage of the target region. In contrast, the cleavage achieved with the CRISPR-AsCas12a system promoted homology-directed repair at a high rate. The CRISPR-AsCas12a-mediated correction did not alter iPSC pluripotency or genetic stability, nor did it result in off-target events. Moreover, we highlight that the disruption of the pathological splice site caused by CRISPR-AsCas12a-mediated insertions/deletions also rescued the normal splicing of GPR143 and its expression level.
Assuntos
Albinismo Ocular , Células-Tronco Pluripotentes Induzidas , Albinismo Ocular/genética , Albinismo Ocular/metabolismo , Albinismo Ocular/patologia , Sistemas CRISPR-Cas/genética , Proteínas do Olho/genética , Proteínas do Olho/metabolismo , Edição de Genes , Humanos , Células-Tronco Pluripotentes Induzidas/metabolismo , Glicoproteínas de Membrana/genética , Glicoproteínas de Membrana/metabolismo , MutaçãoRESUMO
Congenital Stationary Night Blindness type 2 (CSNB2) and Aland island Eye Disease (AIED) associated with CACNA1F mutation demonstrate a significant phenotype overlapping. We report two cases with different clinical presentation carrying two novel mutations in CACNA1F gene. Subjects underwent a complete neurophtahlmological examination associated with structural and electrofunctional insight. Next Generation Sequencing (NGS) analysis of 31 genes previously associated with retinal dystrophy (RD) was performed. Messenger RNAs derived from probands 'peripheral blood samples were analyzed by RT-PCR and cDNA sequencing. The neuro-ophthalmological examinations revealed different clinical, structural and morphological presentations, more severe in patient 1 compared with patient 2. Molecular analysis revealed, that both patients had the hemizygous form of two novel mutations in CACNA1F gene. Patient 1 presented a duplication (c.425dupC) in exon 4, resulting in shifting of the reading frame with the insertion of a premature Stop codon. In Patient 2 variant c.5156G > C localized in the donor's splicing site of exon 43 was identified. Complementary DNA sequencing demonstrated skipping of exon 43 with a deletion of 55 amino acids that causes a frame shift with insertion of a Stop codon. These findings suggest that the effect and the localization of the mutations in the CACNA1F gene can explain different clinical phenotypes. Clinical spectrum is more severe and resembles the AIED phenotype when the mutation affects the first part of the protein, while it is more similar to CSNB2 if the mutation is localized at the end of the protein. Genetic testing results to be an essential tool to provide more accurate diagnosis and prognosis in patients with inherited retinal degenerative disorders and could help, in the future, to develop more specific therapeutic strategies.
Assuntos
Canais de Cálcio Tipo L , Doenças Genéticas Ligadas ao Cromossomo X , Miopia , Cegueira Noturna , Albinismo Ocular , Canais de Cálcio Tipo L/genética , Oftalmopatias Hereditárias , Finlândia , Doenças Genéticas Ligadas ao Cromossomo X/diagnóstico , Doenças Genéticas Ligadas ao Cromossomo X/genética , Humanos , Mutação , Miopia/diagnóstico , Miopia/genética , Cegueira Noturna/diagnóstico , Cegueira Noturna/genética , FenótipoRESUMO
PURPOSE: To characterize the genotypic and phenotypic spectrum of foveal hypoplasia (FH). DESIGN: Multicenter, observational study. PARTICIPANTS: A total of 907 patients with a confirmed molecular diagnosis of albinism, PAX6, SLC38A8, FRMD7, AHR, or achromatopsia from 12 centers in 9 countries (n = 523) or extracted from publicly available datasets from previously reported literature (n = 384). METHODS: Individuals with a confirmed molecular diagnosis and availability of foveal OCT scans were identified from 12 centers or from the literature between January 2011 and March 2021. A genetic diagnosis was confirmed by sequence analysis. Grading of FH was derived from OCT scans. MAIN OUTCOME MEASURES: Grade of FH, presence or absence of photoreceptor specialization (PRS+ vs. PRS-), molecular diagnosis, and visual acuity (VA). RESULTS: The most common genetic etiology for typical FH in our cohort was albinism (67.5%), followed by PAX6 (21.8%), SLC38A8 (6.8%), and FRMD7 (3.5%) variants. AHR variants were rare (0.4%). Atypical FH was seen in 67.4% of achromatopsia cases. Atypical FH in achromatopsia had significantly worse VA than typical FH (P < 0.0001). There was a significant difference in the spectrum of FH grades based on the molecular diagnosis (chi-square = 60.4, P < 0.0001). All SLC38A8 cases were PRS- (P = 0.003), whereas all FRMD7 cases were PRS+ (P < 0.0001). Analysis of albinism subtypes revealed a significant difference in the grade of FH (chi-square = 31.4, P < 0.0001) and VA (P = 0.0003) between oculocutaneous albinism (OCA) compared with ocular albinism (OA) and Hermansky-Pudlak syndrome (HPS). Ocular albinism and HPS demonstrated higher grades of FH and worse VA than OCA. There was a significant difference (P < 0.0001) in VA between FRMD7 variants compared with other diagnoses associated with FH. CONCLUSIONS: We characterized the phenotypic and genotypic spectrum of FH. Atypical FH is associated with a worse prognosis than all other forms of FH. In typical FH, our data suggest that arrested retinal development occurs earlier in SLC38A8, OA, HPS, and AHR variants and later in FRMD7 variants. The defined time period of foveal developmental arrest for OCA and PAX6 variants seems to demonstrate more variability. Our findings provide mechanistic insight into disorders associated with FH and have significant prognostic and diagnostic value.
Assuntos
Albinismo Ocular , Albinismo Oculocutâneo , Albinismo , Defeitos da Visão Cromática , Albinismo Ocular/diagnóstico , Albinismo Ocular/genética , Albinismo Oculocutâneo/diagnóstico , Albinismo Oculocutâneo/genética , Defeitos da Visão Cromática/diagnóstico , Defeitos da Visão Cromática/genética , Proteínas do Citoesqueleto , Fóvea Central/anormalidades , Humanos , Proteínas de Membrana , Transtornos da Visão/diagnósticoAssuntos
Albinismo Ocular/diagnóstico , Doenças Genéticas Ligadas ao Cromossomo X/diagnóstico , Miopia Degenerativa/diagnóstico , Albinismo Ocular/genética , Canais de Cálcio Tipo L/genética , Catarata/diagnóstico , Doenças Genéticas Ligadas ao Cromossomo X/genética , Testes Genéticos , Humanos , Masculino , Pessoa de Meia-Idade , Mutação , Nistagmo Patológico/diagnóstico , Acuidade Visual/fisiologia , Corpo Vítreo/patologiaRESUMO
AIM: The aim of this study was to detail the neurodevelopmental profile of subjects affected by ocular albinism (OA) and to collect data on GPR143 gene analysis. DESIGN: The design of the study involves a retrospective longitudinal observational case series. METHODS: We collected data on the neurodevelopmental profile of 13 children affected by OA from clinical annual assessments conducted for a period of 6 years after the first evaluation. We described visual profile, neuromotor development and neurological examination, cognitive profile, communication and language skills and behavioral characteristics. The GPR143 gene analysis was performed as well. RESULTS: Children presented a variable combination of ocular and oculomotor disorders unchanged during the follow-up, a deficit in visual acuity and in contrast sensitivity that progressively improved. Abnormalities in pattern visual evoked potential were found. No deficits were detected at neurological examination and neuromotor development except for a mild impairment in hand-eye coordination observed in five cases. A language delay was observed in five cases, two of whom had also a developmental quotient delay at 2 years evolving to a borderline/deficit cognitive level at preschool age, difficulties in adaptive behavior and autistic-like features were found. Mutations in the GPR143 gene were identified in the two patients who presented the most severe clinical phenotype. CONCLUSION: Children with OA may share, in addition to a variable combination of ocular signs and symptoms, a neurodevelopment impairment regarding mostly the cognitive, communicative, and social area, especially those with GPR143 mutation.
Assuntos
Albinismo Ocular , Albinismo Ocular/genética , Pré-Escolar , Potenciais Evocados Visuais , Proteínas do Olho/genética , Humanos , Glicoproteínas de Membrana/genética , Estudos RetrospectivosRESUMO
PURPOSE: Ocular albinism type I (OA1) is caused by mutations in the GPR143 gene. The purpose of this study was to describe the clinical and genetic findings in 13 patients from 12 unrelated Chinese pedigrees with a pathogenic variant of the GPR143 gene. METHODS: Most patients underwent clinical examination, including best-corrected visual acuity (BCVA), slit-lamp biomicroscopy, fundus examination, spectral domain optical coherence tomography, and full-field electroretinograms (ERG). A combination of molecular screening procedures, consisting of Sanger-DNA sequencing of GPR143 and targeted next-generation sequencing, was performed to identify each mutation. In silico programs were utilized to evaluate the pathogenicity of all the variants. RESULTS: The 13 patients (mean age 21.75 ± 16.63 years, range 1-54 years) all presented with congenital nystagmus, different extents of visual impairment, and severe foveal hypoplasia. Their BCVA was between 0.05 and 0.3 (decimal notation). The patients and obligate carriers exhibited different extents of mild depigmentation of the iris and fundus. We detected 11 distinct mutations in this patient cohort, including 7 novel mutations. Most (82%) were null mutations and included frameshift indel, nonsense, splicing effect, and large genomic DNA deletions, while missense mutations only accounted for 18%. CONCLUSIONS: Patients with GPR143 mutations all have congenital nystagmus, visual impairment, and foveal hypoplasia, whereas hypopigmentation in their iris and fundus is mild. They exhibit no evident genotype-phenotype correlations. GPR143 mutation screening is very important for establishing a precise diagnosis and for providing genetic counseling for patients and their families.