Simple generation of hairless mice for in vivo imaging.

The in vivo imaging of mice makes it possible to analyze disease progress non-invasively through reporter gene expression. As the removal of hair improves the accuracy of in vivo imaging, gene-modified mice with a reporter gene are often crossed with Hos:HR-1 mutant mice homozygous for the spontaneous Hrhr mutation that exhibit a hair loss phenotype. However, it is time consuming to produce mice carrying both the reporter gene and mutant Hrhr gene by mating. In addition, there is a risk that genetic background of the gene-modified mice would be altered by mating. To resolve these issues, we established a simple method to generate hairless mice maintaining the original genetic background by CRISPR technology. First, we constructed the pX330 vector, which targets exon 3 of Hr. This DNA vector (5 ng/µl) was microinjected into the pronuclei of C57BL/6J mice. Induced Hr gene mutations were found in many founders (76.1%) and these mutations were heritable. Next, we performed in vivo imaging using these gene-modified hairless mice. As expected, luminescent objects in their body were detected by in vivo imaging. This study clearly showed that hairless mice could be simply generated by the CRISPR/Cas9 system, and this method may be useful for in vivo imaging studies with various gene-modified mice.

Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis.

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr(hr) allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr(hr) (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr(hr) gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.

SKHIN/Sprd, a new genetically defined inbred hairless mouse strain for UV-induced skin carcinogenesis studies.

Strains of mice vary in their susceptibility to ultra-violet (UV) radiation-induced skin tumors. Some strains of hairless mice (homozygous for the spontaneous Hr(hr) mutation) are particularly susceptible to these tumors. The skin tumors that develop in hairless mice resemble, both at the morphologic and molecular levels, UV-induced squamous cell carcinomas (SCC) and their precursors in human. The most commonly employed hairless mice belong to the SKH1 stock. However, these mice are outbred and their genetic background is not characterized, which makes them a poor model for genetic studies. We have developed a new inbred strain from outbred SKH1 mice that we named SKHIN/Sprd (now at generation F31). In order to characterize the genetic background of this new strain, we genotyped a cohort of mice at F30 with 92 microsatellites and 140 single nucleotide polymorphisms (SNP) evenly distributed throughout the mouse genome. We also exposed SKHIN/Sprd mice to chronic UV irradiation and showed that they are as susceptible to UV-induced skin carcinogenesis as outbred SKH1 mice. In addition, we proved that, albeit with low efficiency, inbred SKHIN/Sprd mice are suitable for transgenic production by classical pronuclear microinjection. This new inbred strain will be useful for the development of transgenic and congenic strains on a hairless inbred background as well as the establishment of syngeneic tumor cell lines. These new tools can potentially help elucidate a number of features of the cutaneous response to UV irradiation in humans, including the effect of genetic background and modifier genes.

Molecular basis for hair loss in mice carrying a novel nonsense mutation (Hrrh-R ) in the hairless gene (Hr).

Animal models carrying mutations in the hairless (Hr) gene provide a rich resource for study of hair follicle biology. A spontaneous mouse mutant with a phenotype strikingly similar to rhino mutants of Hr arose spontaneously in the mouse facility at Oak Ridge National Laboratory. Sequence analysis of Hr in these mutants uncovered a nonsense mutation in exon 12, designated as Hr(rh-R) (rhino, Oak Ridge). The mutation led to significant reduction in Hr mRNA levels, predicted to be due to nonsense-mediated decay. Histological analysis indicated dilated hair follicle infundibula at 14 days of age that rapidly became filled with cornified material. Microarray analyses revealed that expression levels of many genes involved in keratinocyte differentiation, epidermal regeneration, and wound healing were significantly upregulated before morphological detection of the phenotype, suggesting their role in onset of the Hr(rh-R) phenotype. Identification of this new Hr allele and the underlying molecular alterations allows further understanding of the role of Hr in hair follicle biology.

The hairless mouse in skin research.

The hairless (Hr) gene encodes a transcriptional co-repressor highly expressed in the mammalian skin. In the mouse, several null and hypomorphic Hr alleles have been identified resulting in hairlessness in homozygous animals, characterized by alopecia developing after a single cycle of relatively normal hair growth. Mutations in the human ortholog have also been associated with congenital alopecia. Although a variety of hairless strains have been developed, outbred SKH1 mice are the most widely used in dermatologic research. These unpigmented and immunocompetent mice allow for ready manipulation of the skin, application of topical agents, and exposure to UVR, as well as easy visualization of the cutaneous response. Wound healing, acute photobiologic responses, and skin carcinogenesis have been extensively studied in SKH1 mice and are well characterized. In addition, tumors induced in these mice resemble, both at the morphologic and molecular levels, UVR-induced skin malignancies in man. Two limitations of the SKH1 mouse in dermatologic research are the relatively uncharacterized genetic background and its outbred status, which precludes inter-individual transplantation studies.

[The mouse hairless gene: its function in hair root and at the heart of a subtle pleiotropy]. / Le gène hairless de la souris: fonctions à la racine du poil et au coeur d'une subtile pléiotropie.

The hairless gene in mammals encodes a nuclear factor that is highly expressed in skin and appears to control hair follicle integrity and cycling. In the absence of a normal and functional Hairless (Hr) protein, the hair bulb undergoes premature apoptosis during the first catagen stage of the hair cycle. The most striking effects of the mutation are loss of hair follicles and formation of epidermal utricles and dermal cysts. The hairless gene expression appears to be widespread and temporally regulated. The gene is strongly expressed in different compartments of the brain. Hairless mRNAs were detected in cartilage, gonads, thymus and colon. In addition to alopecia, hairless mice strains show subtle defects in the development and differentiation of various tissues and organs. The Hr protein is localised in cell nuclei and functions as a transcriptional regulator. Although its role has not been resolved in molecular terms, it was demonstrated that Hr is able to interact with multiple nuclear hormone receptors. Hr seems to be a part of a large multiprotein complex capable to repress transcription by its association to chromatin remodelling factors such as histone deacetylases. Recent experimental data suggest that Hr might be involved in Hox gene regulation, cell adhesion modulation and progenitor cells identity. At least in the skin, but probably in other organs, the Hr repressor seems to be responsible for the timing of epithelial cells differentiation.

Skin morphology of the mutant hairless USP mouse.

The morphology of the skin of the mutant hairless USP mouse was studied by histological, histochemical and immunohistochemical methods and compared to the skin of BALB/c mice. Representative sections of the dorsal skin from mice of both strains aged 18 days, and 1, 3, 6, and 8 months were studied. Sections stained with hematoxylin and eosin showed cystic formations called utricles and dermal cysts in the dermis that increased in size and number during growth. Skin thickness increased significantly at 8 months. Sections stained with picrosirius and examined with polarized light, displayed different colors, suggesting different thicknesses of dermal collagen fibers (probably types I and III). Weigert, Verhoeff and resorcin-fuchsin stains revealed fibers of the elastic system. The PAS and Alcian blue methods revealed neutral and acid glycosaminoglycans in the skin ground substance of both mouse strains. Immunohistochemical staining for fibronectin and laminin did not show differences between the mutant and BALB/c mice. Mast cells stained by the Gomori method and macrophages positive for HAM 56 antibodies were observed in both mouse strains. Except for the presence of enlarged cysts in the hairless strain, no qualitative differences were found during development of the skin of BALB/c and the mutant hairless mice.

Skin morphology of the mutant hairless USP mouse

The morphology of the skin of the mutant hairless USP mouse was studied by histological, histochemical and immunohistochemical methods and compared to the skin of BALB/c mice. Representative sections of the dorsal skin from mice of both strains aged 18 days, and 1, 3, 6, and 8 months were studied. Sections stained with hematoxylin and eosin showed cystic formations called utricles and dermal cysts in the dermis that increased in size and number during growth. Skin thickness increased significantly at 8 months. Sections stained with picrosirius and examined with polarized light, displayed different colors, suggesting different thicknesses of dermal collagen fibers (probably types I and III). Weigert, Verhoeff and resorcin-fuchsin stains revealed fibers of the elastic system. The PAS and Alcian blue methods revealed neutral and acid glycosaminoglycans in the skin ground substance of both mouse strains. Immunohistochemical staining for fibronectin and laminin did not show differences between the mutant and BALB/c mice. Mast cells stained by the Gomori method and macrophages positive for HAM 56 antibodies were observed in both mouse strains. Except for the presence of enlarged cysts in the hairless strain, no qualitative differences were found during development of the skin of BALB/c and the mutant hairless mice.

A new allele of the mouse hairless gene interferes with Hox/LacZ transgene regulation in hair follicle primordia.

A new autosomal recessive mouse mutation, causing loss of hair in homozygous mice 2-3 weeks after birth, arose spontaneously in a colony at the National Institute for Medical Research (NIMR), Mill Hill, London in early 1998. Complementation analysis confirmed that this mutation was an allele of the hairless gene (hr). The gene symbol hr(rhbm) (hairless-rhino-bald Mill Hill) was assigned to reflect the source of the colony. Here we show the molecular defect in these mutants, which is a substantial deletion at the 3'-end of the hairless gene. Morphological and immunological analysis of the new hairless mutation was performed at early postnatal stages. In an effort to address the molecular and cellular mechanisms of the hairless phenotype, we analysed developmental stages before the establishment of alopecia. Using a HoxLacZ reporter line of transgenic mice, epidermal placode formation was followed in embryos. Homozygous mutant embryos (hr(rhbmh)/hr(rhbmh)), containing the LacZ reporter under the control of a Hoxb4 gene enhancer, display sharp loss of LacZ staining in epidermal cells invaginating to form the embryonic hair follicle placode. In the light of targeted mutagenesis data involving a Hox gene in the hair development, we discuss the potential implication of the hr(rhbmh) locus in cascades of Hox gene regulation during embryogenesis.

Role of the Nh (Non-hair) mutation in the development of dermatitis and hyperproduction of IgE in DS-Nh mice.

The DS-Nh (DS Non-hair) mouse is a spontaneous hairless mutant of the DS mouse. The inheritance mode of the Nh mutation is autosomal dominant, and the Nh locus is mapped to Chromosome 11. The roles of the Nh mutation in spontaneous dermatitis and IgE hyperproduction were studied using an Nh congenic strain with a genetic background from the BALB/c mouse. In contrast to DS-Nh (Nh/+) mice, BALB/c-Nh (Nh/+) mice under conventional conditions showed a marked increase in serum IgE, without the development of dermatitis. These results suggest that IgE hyperproduction is regulated by the Nh mutation, while other genetic factor(s) are also involved in the development of dermatitis.

[Analysis of the effects of mutant hairless genes in chimeric mice]. / Analiz éffektov mutantnogo gena hairless u khimernykh myshei.

The autosomal recessive gene hairless (hr) is responsible for the complete hairlessness in mice homozygous for this gene. Hair shedding that begins at the age of 10 days is caused by an abnormal cycle of hair follicle development disturbed at the catagen stage. This results in enhanced programmed cell death (apoptosis) and ultimately leads to the complete hair follicle destruction and shedding of all hairs by the age of three weeks. To study the phenotypic expression of the hr gene in a chimeric organism, we have obtained 12 chimeric mice hr/hr <--> +/+ by means of aggregation of early embryos hr/hr and +/+. In chimeric mice, the hair shedding has begun two days later than in the hr/hr mice. By day 23 of postnatal development, hairless areas were present on the coat of chimeric mice or the latter were completely hairless depending on the percentage of the hr/hr mutant component. In four chimeras with high content of the mutant component (68-76%), the hair shedding process was similar to that in the hr/hr mice, though it was accomplished two days later. In three chimeras with 48-51% of the mutant component, alternating hairless and hair-covered bands were observed. These data suggest that the hr gene acts in epidermal cells of a hair follicle, because epidermal cell clones in embryonic skin migrate in the lateral-ventral direction coherently and without mixing. However, some chimeras displayed a pattern which was not so clear-cut: the band borders were illegible and hairs partly covered the hairless areas. In some chimeras, the uniform thinning of the coat was observed. Analysis of the effects of the hr mutant gene in chimeric mice differing in the ratio between mutant (hr/hr) and normal (+/+) components in tissues suggests that the hr gene acts in the epidermal cells of the hair follicle. The interactions between cells have an essential effect on the mode and degree of the hr gene expression, which leads to distortion of the "ectodermal" coat pattern in chimeras.

The Charles River "hairless" rat mutation maps to chromosome 1: allelic with fuzzy and a likely orthologue of mouse frizzy.

Recent evidence has indicated that the recessive mutation affecting hypotrichosis in the Charles River (CR) "hairless" rat does not involve the hairless gene (hr) on rat chromosome 15. To determine if this mutation might be allelic (or orthologous) with any other previously mapped hypotrichosis-generating mutation in mammals, we have produced a panel of backcross rats segregating for the CR hairless rat mutation as well as numerous other markers from throughout the rat genome. Analysis of this panel has located the CR hairless rat's hypotrichosis-generating mutation on chromosome 1, near Myl2, where only the fuzzy mutation in rat (fz) and the frizzy mutation in mouse (fr) have been previously localized. Intercrossing fz/fz and CR hairless rats produced hybrid offspring with abnormal hair, showing that these two rat mutations are allelic. We suggest that the CR hairless rat mutation and fuzzy be renamed frizzy-Charles River (fr(CR)) and frizzy-Harlan (fr(H)), respectively, to reflect their likely orthology with the mouse fr mutation.

[Establishment of segregating inbred strain of Yuyi hairless mice and its monitoring of genetic characteristics].

Using brother-sister inbreeding with forced heterozygosity to breed a new segregating inbred strain which carry mutant hairless gene. Then, genetic monitoring was conducted by the skin grafting test, coat color test and biochemical marker analysis, and its basic biological characteristics were studied with corresponding methods. The Results are that the Yuyi Hairless Mice (YYHL) with unique biological characteristics have been bred successfully and have progressed to 30th generation since 1991. Thirteen biochemical markers loci on nine chromosomes coding biochemical markers measured with electrophoresis were all homogenous. The skin grafting test showed that no dropping graft was found during 100 days after transplanting, implying the YYHL was of isohistogeneicity. Analysis of coat color genes indicated that the hair color of first generation hybrid crossed between YYHL and DBA/2 was all agouti suggesting that the coat color genes of the YYHL were homogenous. The gene type is AABBccDD. All these showed that the YYHL have been an inbred strain reaching the international standards.

The Charles River "hairless" rat mutation is distinct from the hairless mouse alleles.

The Charles River (CR) "hairless" rat is one of the autosomal recessive hypotrichotic animal models actively studied in pharmacologic and dermatologic research. Despite its widespread use, the molecular basis of this monogenic mutation remains unknown, and the skin histologic features of this phenotype have never been described. However, the designation "hairless" has been used as an extension of the hairless mouse (hr) nomenclature on the basis of the clinical absence of hairs in both phenotypes. We present a description of the histopathologic changes in heterozygous and homozygous CR hairless rat mutants during the first month of life. The postnatal homozygous rat skin was characterized by abnormal keratinization of the hair shaft and formation of a thick and dense layer of corneocytes in the lower portion of the epidermal stratum corneum. This layer prevented the improperly keratinized hair shaft from penetrating the skin surface. Starting from the latest stages of hair follicle (HF) development, obvious signs of HF degeneration were observed in homozygous skin. This process was extremely rapid, and by day 12, mainly atrophic HFs with abnormal or broken hairs were present in the skin. Therefore, the mutation in the CR rat abrogates cell proliferation in the hair matrix and affects keratinocyte differentiation in the HF and interfollicular epidermis, a phenotype that is completely distinct from hr/hr. To test whether the CR rat harbored a mutation in the hr gene, we analyzed the coding region of this gene and consensus intron splice site sequences in mutant rats and found no mutation, further supporting phenotypic evidence that the hairless phenotype in CR rats is not allelic with hairless. Finally, using intragenic polymorphisms, we were able to exclude homozygosity at the hairless locus by use of genotypic analysis. Thus, morphologic analysis of successive stages of phenotype development in the CR hairless rat, together with definitive molecular studies, indicate that this mutation may be unique among the other hypotrichotic rat mutations.

Ornithine decarboxylase transgenic mice as a model for human atrichia with papular lesions.

The hair follicle is characterized by cyclic transformations from active growth and hair fiber production through regression into a resting phase. The growth phase, known as anagen, is associated with rapid rates of cell turnover, and variations in the rate of DNA synthesis in mouse skin throughout the hair cycle are accompanied by changes in the activity of ornithine decarboxylase (ODC), a key enzyme in the synthesis of polyamines, which are actively involved in regulation of normal cell division, differentiation, and growth. Previously, a transgenic mouse was created that overexpressed ODC in the skin using a K6 promoter. The first hair cycle in neonatal transgenic mice appeared to be normal, but by the third week of postnatal life transgenic pups begin to progressively lose hair. The lower portion of the hair follicle was progressively replaced with enlarging cystic structures located in the deep dermis, and the transgenic mice exhibited excessive growth of skin mass resulting in pronounced wrinkling and folding. Interestingly, these findings bore striking resemblance to the rhino mouse phenotype and to human patients with papular atrichia, a rare congenital ectodermal disorder characterized by progressive and irreversible hair loss in early childhood. The similarities in phenotype between transgenic mice and human atrichia with papular lesions suggest that ODC transgenics may represent a useful model for studying this disorder. It appears that ODC plays a functionally important, yet still obscure role in a complex metabolic pathway that is critical in hair follicle function not only in mice, but in humans as well.

Of hairless mice and men: the genetic basis of congenital alopecia universalis/congenital atrichia.

BACKGROUND: Mouse models of human diseases help identify gene defects. OBJECTIVE: The methods of homozygosity mapping and mouse/human homology to identify genes are reviewed. The genotype/phenotype correlation in two clinical entities with mutations in the human hairless gene are discussed. METHODS: The example of the hairless mouse's contribution to our knowledge of hereditary alopecia is used, and the utility of consanguineous families for genetic studies is highlighted. RESULTS: Mutations in the human homolog of the mouse hairless gene lead to congenital alopecia universalis and atrichia with papules. CONCLUSION: A mouse model of congenital alopecia has led to understanding the molecular basis of at least one type of severe human alopecia.

The role of the hairless (hr) gene in the regulation of hair follicle catagen transformation.

Mice that carry a mutation at the hairless (hr) locus develop seemingly normal hair follicles (HF) but shed their hairs completely soon after birth. Histologically, their HFs degenerate into characteristic utriculi and dermal cysts shortly after the entry of the HF into the first regression phase (catagen), during the initiation of HF cycling. Here, we show that at least nine distinct stages of HF disintegration can be distinguished in hr/hr mice. Toward the end of HF morphogenesis (day 15 postpartum) the proximal hair bulb in hr/hr skin undergoes premature and massive apoptosis. This is associated with a dyscoordination of cell proliferation in defined HF compartments, malpositioning of the proximal inner root sheath, striking atrophy of outer root sheath, and failure of trichilemmal keratinization in the developing club hair. Rather than undergoing their normal catagen-associated involution, the hair bulb and central outer root sheath disintegrate into separate cell clusters, thus disrupting all epithelial contact with the dermal papilla. Dermal papilla fibroblasts fail to migrate upward, and break up into clusters of shrunken cells stranded in the reticular dermis as dermal cyst precursors, while the upper HF epithelium transforms into utriculi. Some dermal papilla cells, which normally never undergo apoptosis, also become TUNEL+ in hr/hr skin, and their normally high expression of a key adhesion molecule, neural cell adhesion molecule, declines. Thus, loss of a functional hr gene product (a putative zinc finger transcription factor) initiates a premature, highly dysregulated catagen, which results in the destruction of the normal HF architecture and abrogates the HF's ability to cycle. This provides new insights into the pathobiology of the hr mutation, and suggests that the normal hr gene product is a crucial element of catagen control.