Strain Improvement Program of Streptomyces roseosporus for Daptomycin Production.

Daptomycin is a cyclic lipopeptide antibiotic with potent activity against gram-positive bacteria. It has a calcium-dependent mechanism of action that disrupts multiple features of the bacterial membrane function. This antibiotic is highly demanded due to its effectiveness against to microorganisms resistant to other antibiotics, including vancomycin-resistant Staphylococcus aureus (VRSA) and methicillin-resistant S. aureus (MRSA). Daptomycin is produced by fermentation of Streptomyces roseosporus, currently identified as Streptomyces filamentosus. However, low fermentation yields and high production costs are reported. This chapter describes a method of strain improvement involving random mutagenesis, rational screening by bioassay, and flask fermentation. The ultimate objective is to select mutants of S. roseosporus overproducing daptomycin in order to design a more cost-effective daptomycin production.

Genome mining for drug discovery: cyclic lipopeptides related to daptomycin.

The cyclic lipopeptide antibiotics structurally related to daptomycin were first reported in the 1950s. Several have common lipopeptide initiation, elongation, and termination mechanisms. Initiation requires the use of a fatty acyl-AMP ligase (FAAL), a free-standing acyl carrier protein (ACP), and a specialized condensation (CIII) domain on the first NRPS elongation module to couple the long chain fatty acid to the first amino acid. Termination is carried out by a dimodular NRPS that contains a terminal thioesterase (Te) domain (CAT-CATTe). Lipopeptide BGCs also encode ABC transporters, apparently for export and resistance. The use of this mechanism of initiation, elongation, and termination, coupled with molecular target-agnostic resistance, has provided a unique basis for robust natural and experimental combinatorial biosynthesis to generate a large variety of structurally related compounds, some with altered or different antibacterial mechanisms of action. The FAAL, ACP, and dimodular NRPS genes were used as molecular beacons to identify phylogenetically related BGCs by BLASTp analysis of finished and draft genome sequences. These and other molecular beacons have identified: (i) known, but previously unsequenced lipopeptide BGCs in draft genomes; (ii) a new daptomycin family BGC in a draft genome of Streptomyces sedi; and (iii) novel lipopeptide BGCs in the finished genome of Streptomyces ambofaciens and the draft genome of Streptomyces zhaozhouensis.

Pleiotropic regulation of daptomycin synthesis by DptR1, a LuxR family transcriptional regulator.

Daptomycin, produced by Streptomyces roseosporus is a novel cyclic lipopeptide antibiotic for treatment of Gram-positive bacteria caused infections. While, the regulatory mechanism of daptomycin synthesis has not been fully understood. Here we reported that DptR1, a LuxR family transcriptional regulator, played a pleiotropic regulatory role on daptomycin synthesis, for the first time. Deletion or over-expressing of dptR1 decreases the daptomycin's production, increases the transcriptional levels of the core dpt genes of day 3 and decreases the transcriptional levels of the core dpt genes of day 4, sharply, which indicates the transcriptional regulation of DptR1 on daptomycin synthesis is complex and time-ordered. The transcriptional levels of dptR2 increase in dptR1 deletion mutant (DR1), but decrease in dptR1 over-expression mutant (OR1), dramatically, compared to the starting strain of Streptomyces roseosporus N3 (WT), on the 3rd day, which indicates that DptR1 represses the transcription of dptR2. While, the transcriptional levels of dptR3 both in DR1 and OR1 decrease obviously, compared to WT, on the 3rd and 4th day. Comparative analysis of promoters' activities, using xylE gene as the reporter, showed that DptR1 activated the transcription of its own gene of dptR1 and represses the transcription of the dptR3 by affecting the promoter activities. While DptR1 may affect the expression of dptR2 indirectly, not by affecting the promoter activity of dptR2. DptR1, a LuxR family transcriptional regulator, played a pleiotropic regulation role on daptomycin synthesis.

Pleiotropic regulation of daptomycin synthesis by DptR1, a LuxR family transcriptional regulator.

Daptomycin, produced by Streptomyces roseosporus is a novel cyclic lipopeptide antibiotic for treatment of Gram-positive bacteria caused infections. While, the regulatory mechanism of daptomycin synthesis has not been fully understood. Here we reported that DptR1, a LuxR family transcriptional regulator, played a pleiotropic regulatory role on daptomycin synthesis, for the first time. Deletion or over-expressing of dptR1 decreases the daptomycin's production, increases the transcriptional levels of the core dpt genes of day 3 and decreases the transcriptional levels of the core dpt genes of day 4, sharply, which indicates the transcriptional regulation of DptR1 on daptomycin synthesis is complex and time-ordered. The transcriptional levels of dptR2 increase in dptR1 deletion mutant (DR1), but decrease in dptR1 over-expression mutant (OR1), dramatically, compared to the starting strain of Streptomyces roseosporus N3 (WT), on the 3rd day, which indicates that DptR1 represses the transcription of dptR2. While, the transcriptional levels of dptR3 both in DR1 and OR1 decrease obviously, compared to WT, on the 3rd and 4th day. Comparative analysis of promoters' activities, using xylE gene as the reporter, shows that DptR1 activated the transcription of its own gene of dptR1 and represses the transcription of the dptR3 by affecting the promoter activities. While DptR1 may affect the expression of dptR2 indirectly, not by affecting the promoter activity of dptR2. DptR1, a LuxR family transcriptional regulator, played a pleiotropic regulation role on daptomycin synthesis.

BldD, a master developmental repressor, activates antibiotic production in two Streptomyces species.

BldD generally functions as a repressor controlling morphological development of Streptomyces. In this work, evidences that BldD also activates antibiotic production are provided. In Streptomyces roseosporus (which produces daptomycin widely used for treatment of human infections), deletion of bldD notably reduced daptomycin production, but enhanced sporulation. BldD stimulated daptomycin production by directly activating transcription of dpt structural genes and dptR3 (which encodes an indirect activator of daptomycin production), and repressed its own gene. BldD-binding sites on promoter regions of dptE, dptR3, and bldD were all found to contain BldD box-like sequences, facilitating prediction of new BldD targets. Two Streptomyces global regulatory genes, adpA and afsR, were confirmed to be directly activated by BldD. The protein AfsR was shown to act as an activator of daptomycin production, but a repressor of development. BldD directly represses nine key developmental genes. In Streptomyces avermitilis (which produces effective anthelmintic agents avermectins), BldD homolog (BldDsav) directly activates avermectin production through ave structural genes and cluster-situated activator gene aveR. This is the first report that BldD activates antibiotic biosynthesis both directly and via a cascade mechanism. BldD homologs are widely distributed among Streptomyces, our findings suggest that BldD may activate antibiotic production in other Streptomyces species.

Heterologous Expression of Daptomycin Biosynthetic Gene Cluster Via Streptomyces Artificial Chromosome Vector System.

The heterologous expression of the Streptomyces natural product (NP) biosynthetic gene cluster (BGC) has become an attractive strategy for the activation, titer improvement, and refactoring of valuable and cryptic NP BGCs. Previously, a Streptomyces artificial chromosomal vector system, pSBAC, was applied successfully to the precise cloning of large-sized polyketide BGCs, including immunosuppressant tautomycetin and antibiotic pikromycin, which led to stable and comparable production in several heterologous hosts. To further validate the pSBAC system as a generally applicable heterologous expression system, the daptomycin BGC of S. roseosporus was cloned and expressed heterologously in a model Streptomyces cell factory. A 65-kb daptomycin BGC, which belongs to a non-ribosomal polypeptide synthetase (NRPS) family, was cloned precisely into the pSBAC which resulted in 28.9 mg/l of daptomycin and its derivatives in S. coelicolor M511(a daptomycin non-producing heterologous host). These results suggest that a pSBAC-driven heterologous expression strategy is an ideal approach for producing low and inconsistent Streptomyces NRPS-family NPs, such as daptomycin, which are produced low and inconsistent in native host.

Mechanistic studies on the effect of membrane lipid acyl chain composition on daptomycin pore formation.

Daptomycin is a lipopeptide antibiotic that binds and permeabilizes the cell membranes of Gram-positive bacteria. Membrane permeabilization requires both calcium and phosphatidylglycerol (PG) in the target membrane, and it correlates with the formation of an oligomer that likely comprises eight subunits, which are evenly distributed between the two membrane leaflets. In both bacterial cells and model membranes, changes in the fatty acyl composition of the membrane phospholipids can prevent permeabilization. We here used liposomes to study the effect of phospholipids containing oleoyl and other fatty acyl residues on daptomycin activity, and made the following observations: (1) Oleic acid residues inhibited permeabilization when part not only of PG, but also of other phospholipids (PC or cardiolipin). (2) When included in an otherwise daptomycin-susceptible lipid mixture, even 10% of dioleoyl lipid (DOPC) can strongly inhibit permeabilization. (3) The inhibitory effect of fatty acyl residues appears to correlate more with their chain length than with unsaturation. (4) Under all conditions tested, permeabilization coincided with octamer formation, whereas tetramers were observed on membranes that were not permeabilized. Overall, our findings further support the notion that the octamer is indeed the functional transmembrane pore, and that fatty acyl residues may prevent pore formation by preventing the alignment of tetramers across the two membrane leaflets.

Transposon-based identification of a negative regulator for the antibiotic hyper-production in Streptomyces.

Production of secondary metabolites in Streptomyces is regulated by a complex regulatory network precisely, elaborately, and hierarchically. One of the main reasons for the low yields of some high-value secondary metabolites is the repressed expression of their biosynthetic gene clusters, supposedly by some gene cluster out-situated negative regulators. Identification of these repressors and removal of the inhibitory effects based on the regulatory mechanisms will be an effective way to improve their yields. For proof of the concept, using an antibiotic daptomycin from Streptomyces roseosporus, we introduced Himar1-based random mutagenesis combined with a reporter-guided screening strategy to identify a transcriptional regulator PhaR, whose loss-of-function deletion led to about 2.68-fold increase of the gene cluster expression and approximately 6.14-fold or 43% increased daptomycin production in the flask fermentation or in the fed-batch fermentation, respectively. Further study showed that PhaR negatively regulates the expression of daptomycin biosynthetic gene cluster by direct binding to its promoter (dptEp). Moreover, phaR expression gradually drops down during fermentation, and PhaR is positively auto-regulated by directly binding to its own promoter, which results in positive feedback regulation to persistently reduce phaR expression. Meanwhile, the declining PhaR protein remove its repressive effects during daptomycin production. All these results support that our strategy would be a powerful method for genetic screening and rational engineering for the yield improvement of antibiotics, and could be potentially used widely in other Streptomyces species.

Regulatory and biosynthetic effects of the bkd gene clusters on the production of daptomycin and its analogs A21978C1-3.

Daptomycin is a cyclic lipopeptide antibiotic produced by Streptomyces roseosporus in an acidic peptide complex A21978C. In this complex, A21978C1-3 is most abundant and contains branched-chain fatty acyl groups, while daptomycin has a straight decanoic acyl group. The branched-chain α-keto acid dehydrogenase complex (BCDH complex), encoded by bkd gene clusters in Streptomyces, is responsible for the early step of converting branched-chain amino acids into branched-chain fatty acids. In a daptomycin industrial producer S. roseosporus L30, two alleles of bkd gene clusters, bkdA1B1C1/bkdA2B2C2, and a regulatory gene bkdR located upstream of bkdA2B2C2 are identified. We show that BkdR positively regulated bkdA2B2C2 expression and was negatively auto-regulated, but is not directly involved in regulation of daptomycin gene cluster expression. However, BkdR is required for both daptomycin and A21978C1-3 production. Furthermore, deletion of bkdA2B2C2 only led to partial reduction of A21978C1-3 production, while the ΔbkdA1B1C1 mutant shows very weak production of A21978C1-3, and the double bkd mutant has a similar production profile as the single ΔbkdA1B1C1 mutant, suggesting that bkdA1B1C1 gene cluster plays a dominant role in branched-chain fatty acid biosynthesis. So we reveal a unique regulatory function of BkdR and genetic engineered a bkd null strain for daptomycin production with reduced impurities.

Synthetic biology, genome mining, and combinatorial biosynthesis of NRPS-derived antibiotics: a perspective.

Combinatorial biosynthesis of novel secondary metabolites derived from nonribosomal peptide synthetases (NRPSs) has been in slow development for about a quarter of a century. Progress has been hampered by the complexity of the giant multimodular multienzymes. More recently, advances have been made on understanding the chemical and structural biology of these complex megaenzymes, and on learning the design rules for engineering functional hybrid enzymes. In this perspective, I address what has been learned about successful engineering of complex lipopeptides related to daptomycin, and discuss how synthetic biology and microbial genome mining can converge to broaden the scope and enhance the speed and robustness of combinatorial biosynthesis of NRPS-derived natural products for drug discovery.

Negative regulation of daptomycin production by DepR2, an ArsR-family transcriptional factor.

Daptomycin, a lipopeptide antibiotic potently active against Gram-positive bacterial pathogens, is produced by Streptomyces roseosporus, but the transcriptional regulation on its biosynthesis is not fully understood. Here, we report that DepR2, an ArsR-family transcriptional regulator isolated previously by DNA-affinity purification, interacts directly with dptEp, the major promoter of the daptomycin gene cluster. DepR2 binds to an imperfect palindromic sequence at the very upstream of dptEp. Meanwhile, higher dptEp activities were consistently observed in the ΔdepR2 mutant, correlating with a nearly 2.5-fold increased production of daptomycin and three structurally related secondary metabolites A21978C1-3. Thus, our data suggest that the ArsR-family transcriptional regulator DepR2 negatively regulates production of daptomycin by directly repressing the expression of its gene cluster in S. roseosporus. To the best of our knowledge, this is the first report to show the involvement of an ArsR-family regulator in the direct regulation of secondary metabolite biosynthesis in Streptomyces.

wblA, a pleiotropic regulatory gene modulating morphogenesis and daptomycin production in Streptomyces roseosporus.

AIMS: The wblA gene, encoding a homologue of the WhiB family protein, was identified in the sequenced genome of daptomycin producer Streptomyces roseosporus. To explore the function of wblA, we construct wblA disruption strains, complemented strains and overexpression strains to test whether it can affect the production of secondary metabolites and morphogenesis. METHODS AND RESULTS: We constructed disruption strains by homologous recombination in S. roseosporus. The disruption mutant of wblA could block aerial mycelium sporulation and enhance the production of daptomycin by 51%. In contrast, overexpression of wblA resulted in significantly decreased the yield of daptomycin. In agreement with it, the transcription of key daptomycin regulatory genes atrA, dptR2 and dptR3 and structural gene dptE remarkably increased in the wblA disruption mutant. CONCLUSIONS: wblA plays a key role in control of daptomycin biosynthesis and is essential for sporulation. The disruption of wblA could accumulate the transcription level of some key genes involving in daptomycin biosynthesis. SIGNIFICANCE AND IMPACT OF THE STUDY: Daptomycin is an important antibiotic with potent activity against a variety of Gram-positive pathogens. This study demonstrates that valuable improvement in the yield of daptomycin can be achieved through modulating the expression of wblA transcription regulator.

Optimization of the Biosynthesis Conditions of Daptomycin by the Biostatistical Methodology.

Response surface methodology (RSM) was employed to optimize medium components including oxygen vector of n-dodecane of a mutant strain GC-63 of Streptomyces roseosporus NRRL 11379. The two-level Plackett-Burman design (PB factorial design) with fourteen variables including oxygen vector was used to screen the most significant factors affecting antibiotic production. Then, the RSM based on center composite design was used to identify the optimum levels of the significant variables to generate optimal response. Glucose, soybean meal, asparagine and n-dodecane were screened to significantly influence the daptomycin production. The medium composition optimized with response surface methodology was (g/L): glucose, 9.46; soluble starch, 25; dextrin, 12.5; yeast extract, 12.5; soybean meal, 21.34; peptone, 25; casein, 5; asparagine, 2.68; K2SO4, 6; (NH4)2Fe(SO4)2, 2; MgSO4, 1; CaCO3, 5; MnCl2, 0.5; n-dodecane, 7.47 % (v/v). The maximum daptomycin concentration reached 979.36 mg/L which was nearly 2.2-fold higher compared to that in the basal medium, with predicted optimal concentrations in a 7.5-L fermentor.

Improvement of daptomycin production via increased resistance to decanoic acid in Streptomyces roseosporus.

Daptomycin, a cyclic anionic lipopeptide compound produced by Streptomyces roseosporus, is used to treat skin infections caused by multi-drug resistant gram-positive pathogens. The biosynthesis of daptomycin is initiated by the condensation of decanoic acid (DA, a 10-carbon unit fatty acid) and the N-terminal l-tryptophan. So, the addition of DA to the fermentation medium is essential for increasing daptomycin production. However, increasing of DA concentration in the fermentation medium was not possible due to the high toxicity of DA. The previous studies reported that the cell growth of S. roseosporus was halted from 1 mM DA. In order to improve daptomycin production with increasing DA concentration in the medium, the DA-resistant S. roseosporus was developed via a sequential-adaptation method. The DA-resistant strain (DAR) showed complete resistance to 1 mM DA, and the daptomycin production was increased 1.4-fold (40.5 ± 0.7 mg/L) compared with the wild-type (28.5 ± 0.8 mg/L) at 1 mM DA. Additionally, the initial step of the daptomycin biosynthesis was enhanced by the overexpression of dptE and dptF in DAR. The dptEF overexpression DAR showed 3.9-fold (156.3 ± 8.2 mg/L) increase in the daptomycin production compared with DAR (40.1 ± 2.6 mg/L) at 1 mM DA.

Biosynthetic engineering of nonribosomal peptide synthetases.

From the evolutionary melting pot of natural product synthetase genes, microorganisms elicit antibiotics, communication tools, and iron scavengers. Chemical biologists manipulate these genes to recreate similarly diverse and potent biological activities not on evolutionary time scales but within months. Enzyme engineering has progressed considerably in recent years and offers new screening, modelling, and design tools for natural product designers. Here, recent advances in enzyme engineering and their application to nonribosomal peptide synthetases are reviewed. Among the nonribosomal peptides that have been subjected to biosynthetic engineering are the antibiotics daptomycin, calcium-dependent antibiotic, and gramicidin S. With these peptides, incorporation of unnatural building blocks and modulation of bioactivities via various structural modifications have been successfully demonstrated. Natural product engineering on the biosynthetic level is not a reliable method yet. However, progress in the understanding and manipulation of biosynthetic pathways may enable the routine production of optimized peptide drugs in the near future. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.

DepR1, a TetR Family Transcriptional Regulator, Positively Regulates Daptomycin Production in an Industrial Producer, Streptomyces roseosporus SW0702.

Daptomycin is a potent cyclic lipopeptide antibiotic. It is widely used against various Gram-positive bacterial pathogens. Historically, a poor understanding of the transcriptional regulation of daptomycin biosynthesis has limited the options for targeted genetic engineering toward titer improvement. Here, we isolated a TetR family transcriptional regulator, DepR1, from the industrial producer Streptomyces roseosporus SW0702 using a biotinylated dptE promoter (dptEp) as a probe. The direct interaction between DepR1 and dptEp then was confirmed by electrophoretic mobility shift assays and DNase I footprinting assays. The deletion of depR1 led to a reduction in dptEp activity and the cessation of daptomycin production. The ΔdepR1 mutant produced less red pigment and failed to sporulate on R5 medium. This suggests that DepR1 plays a positive role in the control of morphological differentiation. Moreover, DepR1 was positively autoregulated by directly binding to its own promoter. This might account for the positive feedback regulation of daptomycin production. Based on these positive effects, genetic engineering by overexpression of depR1 raised daptomycin production and shortened the fermentation period both in flask and in fermentor.

Genome engineering and direct cloning of antibiotic gene clusters via phage ϕBT1 integrase-mediated site-specific recombination in Streptomyces.

Several strategies have been used to clone large DNA fragments directly from bacterial genome. Most of these approaches are based on different site-specific recombination systems consisting of a specialized recombinase and its target sites. In this study, a novel strategy based on phage ϕBT1 integrase-mediated site-specific recombination was developed, and used for simultaneous Streptomyces genome engineering and cloning of antibiotic gene clusters. This method has been proved successful for the cloning of actinorhodin gene cluster from Streptomyces coelicolor M145, napsamycin gene cluster and daptomycin gene cluster from Streptomyces roseosporus NRRL 15998 at a frequency higher than 80%. Furthermore, the system could be used to increase the titer of antibiotics as we demonstrated with actinorhodin and daptomycin, and it will be broadly applicable in many Streptomyces.

A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus.

Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus.

DptR2, a DeoR-type auto-regulator, is required for daptomycin production in Streptomyces roseosporus.

Daptomycin, a novel cyclic lipopeptide antibiotic against Gram-positive bacteria, is produced by Streptomyces roseosporus. Though its biosynthetic mechanism, structural shuffling and fermentation optimization have been extensively studied, little is understood about its production regulation at the transcriptional levels. Here we reported that dptR2, encoding a DeoR-type regulator located close to the daptomycin biosynthesis gene cluster in S. roseosporus SW0702, is required for daptomycin production, but not for the expression of daptomycin gene cluster, suggesting that DptR2 was not a pathway-specific regulator. Furthermore, EMSA and qRT-PCR analysis suggested that DptR2 was positively auto-regulated by binding to its own promoter. Meanwhile, the binding sites on the dptR2 promoter were determined by a DNase I footprinting assay, and the essentiality of the inverted complementary sequences in the protected region for DptR2 binding was assessed. Our results for the first time reported the regulation of daptomycin production at the transcriptional level in S. roseosporus.

Genome shuffling of Streptomyces roseosporus for improving daptomycin production.

In this work, enhancement of daptomycin production by genome shuffling in Streptomyces roseosporus was conducted. Ultraviolet and NTG were used as mutagenizing agents to improve the volumetric productivity of the wild-type strain. Eight strains with enhanced daptomycin production were screened out as the starting population for genome shuffling. Daptomycin's production increased steadily with each round of genome shuffling. After the fourth round of fusion, a high-production strain (582 mg/L), named F4, was selected as a potential industrial production strain and its heredity stability was stable. Moreover, comparative analysis of the non-ribosomal peptide synthetase (NRPS) genes at the transcript level between the wild and the mutant was studied by RT-PCR in order to explore mechanism of genome shuffling. The transcript levels of NRPS genes dptA, dptBC, and dptD in the mutant were approximately 6.5 to 7 times higher than those in the wild. In summary, it is suggested that this strategy for increasing the daptomycin production in S. roseosporus by genome shuffling may provide an alternative approach to enhance the metabolite production in other Streptomyces.