Measuring Photophysiology of Attached Stage of Colacium sp. by a Cuvette-Type Fast Repetition Rate Fluorometer.

Fast repetition rate fluorometer (FRRf) is a beneficial method for measuring photosystem II (PSII) photophysiology and primary productivity. Although FRRf can measure PSII absorption cross-section (σPSII), maximum photochemical efficiency (Fv/Fm), effective photochemical efficiency (Fq'/Fm'), and non-photochemical quenching (NPQNSV) for various eukaryotic algae and cyanobacteria, almost all FRRf studies to date have focused on phytoplankton. Here, the protocol describes how to measure PSII photophysiology of an epizoic alga Colacium sp. Ehrenberg 1834 (Euglenophyta), in its attached stage (attached to zooplankton), using cuvette-type FRRf. First, we estimated the effects of substrate zooplankton (Scapholeberis mucronata O.F. Müller 1776, Cladocera, Daphniidae) on baseline fluorescence and σPSII, Fv/Fm, Fq'/Fm', and NPQNSV of planktonic Colacium sp. To validate this methodology, we recorded photophysiology measurements of attached Colacium sp. on S. mucronata and compared these results with its planktonic stage. Representative results showed how the protocol could determine the effects of calcium (Ca) and manganese (Mn) on Colacium sp. photophysiology and identify the various effects of Mn enrichment between attached and planktonic stages. Finally, we discuss the adaptability of this protocol to other periphytic algae.

Heterotrophic euglenid Rhabdomonas costata resembles its phototrophic relatives in many aspects of molecular and cell biology.

Euglenids represent a group of protists with diverse modes of feeding. To date, only a partial genomic sequence of Euglena gracilis and transcriptomes of several phototrophic and secondarily osmotrophic species are available, while primarily heterotrophic euglenids are seriously undersampled. In this work, we begin to fill this gap by presenting genomic and transcriptomic drafts of a primary osmotroph, Rhabdomonas costata. The current genomic assembly length of 100 Mbp is 14× smaller than that of E. gracilis. Despite being too fragmented for comprehensive gene prediction it provided fragments of the mitochondrial genome and comparison of the transcriptomic and genomic data revealed features of its introns, including several candidates for nonconventional types. A set of 39,456 putative R. costata proteins was predicted from the transcriptome. Annotation of the mitochondrial core metabolism provides the first data on the facultatively anaerobic mitochondrion of R. costata, which in most respects resembles the mitochondrion of E. gracilis with a certain level of streamlining. R. costata can synthetise thiamine by enzymes of heterogenous provenances and haem by a mitochondrial-cytoplasmic C4 pathway with enzymes orthologous to those found in E. gracilis. The low percentage of green algae-affiliated genes supports the ancestrally osmotrophic status of this species.

Methods of Lipid Analyses for Microalgae: Charophytes, Eustigmatophytes, and Euglenophytes.

Algae are ecologically important organisms and are widely used for basic research, with a focus on for example photosynthesis, evolution, and lipid metabolism. Many biosynthetic pathways of algal lipids have been deciphered using available genomic information. Here we describe methods for lipid analyses from three representative algae, including Archaeplastida, the SAR lineage (Stramenopiles, Alveolata, Rhizaria), and Excavata. Archaeplastida acquired their plastids by primary endosymbiosis, and the others by secondary endosymbiosis with a Rhodophyceae-type plastid in SAR and a Chlorophyceae-type plastid in Excavata (Euglenozoa). Analytical methods for these algae are described for membrane lipids and neutral lipids including triacylglycerol and wax esters.

Evolution of metabolic capabilities and molecular features of diplonemids, kinetoplastids, and euglenids.

BACKGROUND: The Euglenozoa are a protist group with an especially rich history of evolutionary diversity. They include diplonemids, representing arguably the most species-rich clade of marine planktonic eukaryotes; trypanosomatids, which are notorious parasites of medical and veterinary importance; and free-living euglenids. These different lifestyles, and particularly the transition from free-living to parasitic, likely require different metabolic capabilities. We carried out a comparative genomic analysis across euglenozoan diversity to see how changing repertoires of enzymes and structural features correspond to major changes in lifestyles. RESULTS: We find a gradual loss of genes encoding enzymes in the evolution of kinetoplastids, rather than a sudden decrease in metabolic capabilities corresponding to the origin of parasitism, while diplonemids and euglenids maintain more metabolic versatility. Distinctive characteristics of molecular machines such as kinetochores and the pre-replication complex that were previously considered specific to parasitic kinetoplastids were also identified in their free-living relatives. Therefore, we argue that they represent an ancestral rather than a derived state, as thought until the present. We also found evidence of ancient redundancy in systems such as NADPH-dependent thiol-redox. Only the genus Euglena possesses the combination of trypanothione-, glutathione-, and thioredoxin-based systems supposedly present in the euglenozoan common ancestor, while other representatives of the phylum have lost one or two of these systems. Lastly, we identified convergent losses of specific metabolic capabilities between free-living kinetoplastids and ciliates. Although this observation requires further examination, it suggests that certain eukaryotic lineages are predisposed to such convergent losses of key enzymes or whole pathways. CONCLUSIONS: The loss of metabolic capabilities might not be associated with the switch to parasitic lifestyle in kinetoplastids, and the presence of a highly divergent (or unconventional) kinetochore machinery might not be restricted to this protist group. The data derived from the transcriptomes of free-living early branching prokinetoplastids suggests that the pre-replication complex of Trypanosomatidae is a highly divergent version of the conventional machinery. Our findings shed light on trends in the evolution of metabolism in protists in general and open multiple avenues for future research.

Spatial and temporal variations in composition of algae assemblages with environmental variables in an urban stream (Ankara, Turkey).

Phytoplankton and epipelon assemblages form the main constituents, and they are producers in aquatic ecosystems, such as streams and rivers. This study was carried out between May 2008 and April 2009 to determine the impacts of polluted water on species variations, compositions, and community metrics in phytoplankton and epipelon at six stations on Ankara Stream. A total of 231 taxa were recorded during the study period, with 131 Bacillariophyta, 3 Charophyta, 41 Chlorophyta, 30 Cyanobacteria, 25 Euglenophyta, and 1 Ochrophyta. Heterogeneity of the stream stations was determined by the use of hierarchical cluster analysis (HCA). Community metrics were compared by using non-parametric tests, while canonical correspondence analysis (CCA) was used for the relationships between environmental variables and species. Variations in water quality and species composition along the stream flow revealed a significant spatial heterogeneity (p < 0.05). However, the upper stations of the stream were represented by unpolluted water quality with low nutrients and conductivity, and the mid- and downstream stations were characterized by high concentrations of ammonia (up to 60 mg L-1) and o-phosphate (up to 25 mg/L), with low concentrations of dissolved oxygen (< 1 mg L-1). The results, clearly supported by indicator taxa, showed that various domestic and industrial discharges affected the increase in pollution and the spatial heterogeneity. The findings obtained in this study will contribute to future improvements in Ankara Stream watershed studies.

Response of Anaerobic Protozoa to Oxygen Tension in Anaerobic System.

The effect of oxygen on anaerobic protozoa was studied in anaerobic batch reactors inoculated with sludge and protozoa cultures. Among the protozoa genera, Metopus, Brachonella, Plagiopyla, Trepomonas, and Vanella were more sensitive to oxygen compared to other genera. Protozoa genera Menoidium, Rhynchomonas, Cyclidium, Spathidium, and Amoeba were found to survive under aerobic conditions, and the growth rate was slightly higher or similar to anaerobic condition. O2 tension resulted in the loss of free and endosymbiotic methanogens in anaerobic system, while methanogens were observed inside the protozoan cysts. Survival of anaerobic protozoa declined considerably when the O2 tension exceeded 1% atm. sat. and showed chemosensory behavior in response to O2 exposure. Superoxide dismutase activity was detected in survived protozoa cells under O2 tension. Facultative anaerobic protozoa with SOD activity can provide a mechanism to overcome possible occurrence of oxygen toxicity in the treatment of wastewater in anaerobic reactor.

Intrageneric Variability Between the Chloroplast Genomes of Trachelomonas grandis and Trachelomonas volvocina and Phylogenomic Analysis of Phototrophic Euglenoids.

The latest studies of chloroplast genomes of phototrophic euglenoids yielded different results according to intrageneric variability such as cluster arrangement or diversity of introns. Although the genera Euglena and Monomorphina in those studies show high syntenic arrangements at the intrageneric level, the two investigated Eutreptiella species comprise low synteny. Furthermore Trachelomonas volvocina show low synteny to the chloroplast genomes of the sister genera Monomorphina aenigmatica, M. parapyrum, Cryptoglena skujae, Euglenaria anabaena, Strombomonas acuminata, all of which were highly syntenic. Consequently, this study aims at the analysis of the cpGenome of Trachelomonas grandis and a comparative examination of T. volvocina to investigate whether the cpGenomes are of such resemblance as could be expected for a genus within the Euglenaceae. Although these analyses resulted in almost identical gene content to other Euglenaceae, the chloroplast genome showed significant novelties: In the rRNA operon, we detected group II introns, not yet found in any other cpGenome of Euglenaceae and a substantially heterogeneous cluster arrangement in the genus Trachelomonas. The phylogenomic analysis with 84 genes of 19 phototrophic euglenoids and 18 cpGenome sequences from Chlorophyta and Streptophyta resulted in a well-supported cpGenome phylogeny, which is in accordance to former phylogenetic analyses.

The role of the zinc finger protein ZC3H32 in bloodstream-form Trypanosoma brucei.

Kinetoplastids rely heavily on post-transcriptional mechanisms for control of gene expression, with regulation of mRNA processing, translation and degradation by RNA-binding proteins. ZC3H32 is a cytosolic mRNA-binding protein with three non-canonical CCCH zinc finger domains. It is much more abundant in bloodstream-form Trypanosoma brucei than in procyclic forms. Tethering of ZC3H32 to a reporter mRNA suppressed translation and resulted in mRNA degradation, and deletion analysis suggested that this activity was present in both the N- and C-terminal domains, but not the central zinc finger-containing domain. Tandem affinity purification, however, revealed no interaction partners that might account for this activity. RNASeq analyses did not yield any evidence for sequence-specific binding or regulation of specific mRNAs. The presence of ZC3H32 homologues in monogenetic and free-living Euglenids also argues against a role in developmental regulation, although its function may have diverged in evolution. T. brucei ZC3H32 might be implicated in basal mRNA metabolism, with this role perhaps being taken over by another protein in procyclic forms.

Evolutionary History of the Enzymes Involved in the Calvin-Benson Cycle in Euglenids.

Euglenids are an ancient lineage that may have existed as early as 2 billion years ago. A mere 65 years ago, Melvin Calvin and Andrew A. Benson performed experiments on Euglena gracilis and elucidated the series of reactions by which carbon was fixed and reduced during photosynthesis. However, the evolutionary history of this pathway (Calvin-Benson cycle) in euglenids was more complex than Calvin and Benson could have imagined. The chloroplast present today in euglenophytes arose from a secondary endosymbiosis between a phagotrophic euglenid and a prasinophyte green alga. A long period of evolutionary time existed before this secondary endosymbiotic event took place, which allowed for other endosymbiotic events or gene transfers to occur prior to the establishment of the green chloroplast. This research revealed the evolutionary history of the major enzymes of the Calvin-Benson cycle throughout the euglenid lineage and showed that the majority of genes for Calvin-Benson cycle enzymes shared an ancestry with red algae and/or chromophytes suggesting they may have been transferred to the nucleus prior to the acquisition of the green chloroplast.

Transcriptomic study reveals widespread spliced leader trans-splicing, short 5'-UTRs and potential complex carbon fixation mechanisms in the euglenoid Alga Eutreptiella sp.

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×10(6) original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga's transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5'- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.

When, how and why glycolysis became compartmentalised in the Kinetoplastea. A new look at an ancient organelle.

A characteristic, well-studied feature of the pathogenic protists belonging to the family Trypanosomatidae is the compartmentalisation of the major part of the glycolytic pathway in peroxisome-like organelles, hence designated glycosomes. Such organelles containing glycolytic enzymes appear to be present in all members of the Kinetoplastea studied, and have recently also been detected in a representative of the Diplonemida, but they are absent from the Euglenida. Glycosomes therefore probably originated in a free-living, common ancestor of the Kinetoplastea and Diplonemida. The initial sequestering of glycolytic enzymes inside peroxisomes may have been the result of a minor mistargeting of proteins, as generally observed in eukaryotic cells, followed by preservation and its further expansion due to the selective advantage of this specific form of metabolic compartmentalisation. This selective advantage may have been a largely increased metabolic flexibility, allowing the organisms to adapt more readily and efficiently to different environmental conditions. Further evolution of glycosomes involved, in different taxonomic lineages, the acquisition of additional enzymes and pathways - often participating in core metabolic processes - as well as the loss of others. The acquisitions may have been promoted by the sharing of cofactors and crucial metabolites between different pathways, thus coupling different redox processes and catabolic and anabolic pathways within the organelle. A notable loss from the Trypanosomatidae concerned a major part of the typical peroxisomal H(2)O(2)-linked metabolism. We propose that the compartmentalisation of major parts of the enzyme repertoire involved in energy, carbohydrate and lipid metabolism has contributed to the multiple development of parasitism, and its elaboration to complicated life cycles involving consecutive different hosts, in the protists of the Kinetoplastea clade.

Physiological parameters of gravitaxis in the flagellate Euglena gracilis obtained during a parabolic flight campaign.

The unicellular freshwater flagellate Euglena gracilis and its close relative Astasia longa show a pronounced negative gravitaxis. Previous experiments revealed that gravitaxis is most likely mediated by an active physiological mechanism in which changes of the internal calcium concentration and the membrane potential play an important role. In a recent parabolic flight experiment on board an aircraft (ESA 29th parabolic flight campaign), changes of graviorientation, membrane potential and the cytosolic calcium concentration upon changes of the acceleration (between 1 x g(n), 1.8 x g(n), microgravity) were monitored by image analysis and photometric methods using Oxonol VI (membrane potential) and Calcium Crimson (cytosolic calcium concentration). The parabolic flight maneuvers performed by the aircraft resulted in transient phases of 1.8 x g(n) (about 20 s), microgravity (about 22 s) followed by 1.8 x g(n) (about 20 s). A transient increase in the intracellular calcium concentration was detected from lower to higher accelerations (1 x g(n) to 1.8 x g(n) or microgravity to 1.8 x g(n)). Oxonol VI-labeled cells showed a signal, which indicates a depolarization during the transition from 1 x g(n) to 1.8 x g(n), a weak repolarization in microgravity followed by a rapid repolarization in the subsequent 1 x g(n) phase. The results show good coincidence with observations of recent terrestrial and space experiments.

Physiological characterization of gravitaxis in Euglena gracilis and Astasia longa studied on sounding rocket flights.

Euglena gracilis is a photosynthetic, unicellular flagellate found in eutrophic freshwater habitats. The organisms control their vertical position in the water column using gravi- and phototaxis. Recent experiments demonstrated that negative gravitaxis cannot be explained by passive buoyancy but by an active physiological mechanism. During space experiments, the threshold of gravitaxis was determined to be between 0.08 and 0.12 x g. A strong correlation between the applied acceleration and the intracellular cAMP and Ca2+ was observed. The results support the hypothesis, that the cell body of Euglena, which is denser than the surrounding medium exerts a pressure onto the lower membrane and activates mechanosensitive Ca2+ channels. Changes in the membrane potential and the cAMP concentration are most likely subsequent elements in a signal transduction chain, which results in reorientation strokes of the flagellum.

Calcium is involved in the gravitactic orientation in colorless flagellates.

The colorless flagellate Astasia longa shows a pronounced negative gravitaxis. The calcium fluorescence indicator Calcium Crimson was used to detect changes of the intracellular calcium concentration during gravitactical orientation. Astasia shows an increase of the fluorescence after a lag phase of about 10 s, a maximum after about 30 s and a decrease to the basic level within 60 s during gravitactic reorientation. The observed change in fluorescence corresponds to an almost doubling of the initial free calcium concentration. The influence of inhibitors, known to impair gravitaxis, on the calcium concentration of Astasia longa was tested. Addition of caffeine, an inhibitor of phosphodiesterase, increases, while addition of gadolinium, an inhibitor of mechanosensitive ion channels decreases the fluorescence signal. While gravitactic stimulation of caffeine-treated cells resulted in a kinetics of fluorescence intensity changes comparable to control cells the addition of gadolinium inhibited any calcium concentration change. Dynamic fluorescence imaging was used during a sounding rocket experiment (MAXUS 3 campaign). Different accelerations interrupted by microgravity intervals were applied to Astasia cells. The cells show an increase in the calcium signal upon acceleration and a decrease during the microgravity state. The results strongly reemphasize the working model of gravitaxis which is based on the activation of mechano-sensitive ion channels as one of the primary events in signal perception.

The Glu-modification of alpha-tubulin in the feeding apparatus of the primitive flagellate Entosiphon sulcatum is only apparent after detergent treatment.

Using specific monoclonal antibodies, we investigated the distribution of post-translational modified Tyr- and Glu-tubulins during interphase of the primitive flagellate Entosiphon sulcatum. Immunofluorescence studies of simultaneously permeabilized and fixed cells revealed that microtubular structures comprising Ca(2+)-labile subpellicular and flagellar MTs and Ca(2+)-stable MTs in the siphon complex (feeding organelle) reacted surprisingly unorthodox with antibodies against Tyr- and Glu-tubulin: Unexpectedly, the siphon complex consisting of Ca(2+)-stable MTs appeared exclusively Tyr-positive, whereas the Ca(2+)-labile subpellicular and flagellar MTs reacted with the Glu- as well as with the Tyr-antibody. That the siphon MTs were indeed Ca(2+)-stable and all other MTs had become solubilized, was verified by EM-observation. This surprising result contrasting considerably with the permanent nature of the siphon complex, was reconsidered after preceding lysis and extraction procedures. Depending on the type of detergent used and on extraction times applied, the MTs of the siphon complex now always showed also Glu-positivity, indicating the presence of detyrosinated alpha-tubulin as a biochemical marker of stabilized MTs. Since saponin, irrespective of subsequent extraction times, always produced a Glu-positive reaction and ultrastructural analysis never gave compelling evidence for a drastic MAP-removal, we conclude that the Glu-epitope became freely accessible due to conformational changes in the tubulin polymeres.