Downregulation of HNRNPA1 induced neoantigen generation via regulating alternative splicing.

BACKGROUND: Immunotherapies effectively treat human malignancies, but the low response and resistance are major obstacles. Neoantigen is an emerging target for tumor immunotherapy that can enhance anti-tumor immunity and improve immunotherapy. Aberrant alternative splicing is an important source of neoantigens. HNRNPA1, an RNA splicing factor, was found to be upregulated in the majority of tumors and play an important role in the tumor immunosuppressive microenvironment. METHODS: Whole transcriptome sequencing was performed on shHNRNPA1 SKOV3 cells and transcriptomic data of shHNRNPA1 HepG2, MCF-7M, K562, and B-LL cells were downloaded from the GEO database. Enrichment analysis was performed to elucidate the mechanisms underlying the activation of anti-tumor immunity induced by HNRNPA1 knockdown. mRNA alternative splicing was analyzed and neoantigens were predicted by JCAST v.0.3.5 and Immune epitope database. The immunogenicity of candidate neoantigens was calculated by Class I pMHC Immunogenicity and validated by the IFN-γ ELISpot assay. The effect of shHNRNPA1 on tumor growth and immune cells in vivo was evaluated by xenograft model combined with immunohistochemistry. RESULTS: HNRNPA1 was upregulated in a majority of malignancies and correlated with immunosuppressive status of the tumor immune microenvironment. Downregulation of HNRNPA1 could induce the activation of immune-related pathways and biological processes. Disruption of HNRNPA1 resulted in aberrant alternative splicing events and generation of immunogenic neoantigens. Downregulation of HNRNPA1 inhibited tumor growth and increased CD8+ T cell infiltration in vivo. CONCLUSION: Our study demonstrated that targeting HNRNPA1 could produce immunogenic neoantigens that elicit anti-tumor immunity by inducing abnormal mRNA splicing. It suggests that HNRNPA1 may be a potential target for immunotherapy.

circLIFR-007 reduces liver metastasis via promoting hnRNPA1 nuclear export and YAP phosphorylation in breast cancer.

Cancer metastasis is the major cause of death in patients with breast cancer (BC). The liver is a common site of breast cancer metastasis, and the 5-year survival rate of patients with breast cancer liver metastases (BCLMs) is only about 8.5 %. CircRNAs are involved in a variety of cancer-related pathological behaviors, and their unique structure and resistance to RNA degradation enable them to serve as ideal diagnostic biomarkers and therapeutic targets. Therefore, it is important to investigate the role and molecular mechanism of circRNAs in cancer metastasis. CircLIFR-007 was identified as a critical circular RNA in BC metastasis by circRNAs microarray and qRT-PCR experiment. Cell function assays were performed to explore the effect of circLIFR-007 in breast cancer cells. Experiments in vivo validated the function of circLIFR-007. Several molecular assays were performed to investigate the underlying mechanisms. We found that circLIFR-007 acted as a negative controller in breast cancer liver metastasis. CircLIFR-007 upregulates the phosphorylation level of YAP by exporting hnRNPA1 to promote the combination between hnRNPA1 and YAP in the cytoplasm. Overexpression of circLIFR-007 suppressed the expression of liver metastasis-related proteins, SREBF1 and SNAI1, which were regulated by transcription factor YAP. Functionally, circLIFR-007 inhibits the proliferation and metastasis of breast cancer cells both in vivo and in vitro.

Embryonic stem cell related gene regulates alternative splicing of transcription factor 3 to maintain human embryonic stem cells' self-renewal and pluripotency.

Exploring the mechanism of self-renewal and pluripotency maintenance of human embryonic stem cells (hESCs) is of great significance in basic research and clinical applications, but it has not been fully elucidated. Long non-coding RNAs (lncRNAs) have been shown to play a key role in the self-renewal and pluripotency maintenance of hESCs. We previously reported that the lncRNA ESRG, which is highly expressed in undifferentiated hESCs, can maintain the self-renewal and pluripotency of hPSCs. RNA pull-down mass spectrometry showed that ESRG could bind to other proteins, among which heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1) attracted our attention. In this study, we showed that HNRNPA1 can maintain self-renewal and pluripotency of hESCs. ESRG bound to and stabilized HNRNPA1 protein through the ubiquitin-proteasome pathway. In addition, knockdown of ESRG or HNRNPA1 resulted in alternative splicing of TCF3, which originally and primarily encoded E12, to mainly encode E47 and inhibit CDH1 expression. HNRNPA1 could rescue the biological function changes of hESCs caused by ESRG knockdown or overexpression. Our results suggest that ESRG regulates the alternative splicing of TCF3 to affect CDH1 expression and maintain hESCs self-renewal and pluripotency by binding and stabilizing HNRNPA1 protein. This study lays a good foundation for exploring the new molecular regulatory mechanism by which ESRG maintains hESCs self-renewal and pluripotency.

Adipocyte-Specific Hnrnpa1 Knockout Aggravates Obesity-Induced Metabolic Dysfunction via Upregulation of CCL2.

Heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1) is involved in lipid and glucose metabolism via mRNA processing. However, whether and how HNRNPA1 alters adipocyte function in obesity remain obscure. Here, we found that the obese state downregulated HNRNPA1 expression in white adipose tissue (WAT). The depletion of adipocyte HNRNPA1 promoted markedly increased macrophage infiltration and expression of proinflammatory and fibrosis genes in WAT of obese mice, eventually leading to exacerbated insulin sensitivity, glucose tolerance, and hepatic steatosis. Mechanistically, HNRNPA1 interacted with Ccl2 and regulated its mRNA stability. Intraperitoneal injection of CCL2-CCR2 signaling antagonist improved adipose tissue inflammation and systemic glucose homeostasis. Furthermore, HNRNPA1 expression in human WAT was negatively correlated with BMI, fat percentage, and subcutaneous fat area. Among individuals with 1-year metabolic surgery follow-up, HNRNPA1 expression was positively related to percentage of total weight loss. These findings identify adipocyte HNRNPA1 as a link between adipose tissue inflammation and systemic metabolic homeostasis, which might be a promising therapeutic target for obesity-related disorders.

hnRNP A1 dysfunction alters RNA splicing and drives neurodegeneration in multiple sclerosis (MS).

Neurodegeneration is the primary driver of disease progression in multiple sclerosis (MS) resulting in permanent disability, creating an urgent need to discover its underlying mechanisms. Herein, we establish that dysfunction of the RNA binding protein heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) results in differential of binding to RNA targets causing alternative RNA splicing, which contributes to neurodegeneration in MS and its models. Using RNAseq of MS brains, we discovered differential expression and aberrant splicing of hnRNP A1 target RNAs involved in neuronal function and RNA homeostasis. We confirmed this in vivo in experimental autoimmune encephalomyelitis employing CLIPseq specific for hnRNP A1, where hnRNP A1 differentially binds and regulates RNA, including aberrantly spliced targets identified in human samples. Additionally, dysfunctional hnRNP A1 expression in neurons caused neurite loss and identical changes in splicing, corroborating hnRNP A1 dysfunction as a cause of neurodegeneration. Collectively, these data indicate hnRNP A1 dysfunction causes altered neuronal RNA splicing, resulting in neurodegeneration in MS.

The microRNA-195-5p/hnRNP A1 axis contributes to the progression of hepatocellular carcinoma by regulating the migration of cancer cells.

Dysregulation of gene expression is critical for the progression of cancer. The augmented expression of hnRNP A1 in patients with hepatocellular carcinoma (HCC) has been related to its oncogenic functions. However, the underlying mechanisms responsible for upregulation of hnRNP A1 have not been fully elucidated. In the present study, we identified microRNA-195-5p (miR-195-5p), a miRNA downregulated in HCC, as a novel regulator governing hnRNP A1 expression. Notably, our investigations showed an inverse correlation between hnRNP A1 level, which was increased in HCC, and miR-195-5p level, which was decreased. Our findings demonstrated that hnRNP A1 significantly enhanced the migration and invasion of PLC/PRF/5 cells through its association with mRNAs regulating metastasis. MiR-195-5p also interfered with the hnRNP A1-mediated cell migration by targeting hnRNP A1. Our results underscore the significance of the miR-195-5p/hnRNP A1 axis in regulating the migratory potential of cancer cells and its role in promoting HCC by orchestrating cell migration processes.

The mechanism of UP1 binding and unfolding of human telomeric DNA G-quadruplex.

The human telomere contains multiple copies of the DNA sequence d(TTAGGG) which can fold into higher order intramolecular G-quadruplexes and regulate the maintenance of telomere length and chromosomal integrity. The nucleic acid binding protein heteronuclear ribonucleoprotein A1 (hnRNP A1) and its N-terminus proteolytic product UP1 have been shown to efficiently bind and unfold telomeric DNA G-quadruplex. However, the understanding of the molecular mechanism of the UP1 binding and unfolding telomeric G-quadruplexes is still limited. Here, we performed biochemical and biophysical characterizations of UP1 binding and unfolding of human telomeric DNA G-quadruplex d[AGGG(TTAGGG)3], and in combination of systematic site-direct mutagenesis of two tandem RNA recognition motifs (RRMs) in UP1, revealed that RRM1 is responsible for initial binding and unfolding, whereas RRM2 assists RRM1 to complete the unfolding of G-quadruplex. Isothermal titration calorimetry (ITC) and circular dichroism (CD) studies of the interactions between UP1 and DNA G-quadruplex variants indicate that the "TAG" binding motif in Loop2 of telomeric G-quadruplex is critical for UP1 recognition and G-quadruplex unfolding initiation. Together we depict a model for molecular mechanism of hnRNP A1 (UP1) binding and unfolding of the human telomeric DNA G-quadruplex.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

hnRNPA1 impedes snakehead vesiculovirus replication via competitively disrupting viral phosphoprotein-nucleoprotein interaction and degrading viral phosphoprotein.

Heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) plays an important role in regulating the replication of many viruses. However, it remains elusive whether and how hnRNPA1 regulates fish virus replication. In this study, the effects of twelve hnRNPs on the replication of snakehead vesiculovirus (SHVV) were screened. Three hnRNPs, one of which was hnRNPA1, were identified as anti-SHVV factors. Further verification showed that knockdown of hnRNPA1 promoted, while overexpression of hnRNPA1 inhibited, SHVV replication. SHVV infection reduced the expression level of hnRNPA1 and induced the nucleocytoplasmic shuttling of hnRNPA1. Besides, we found that hnRNPA1 interacted with the viral phosphoprotein (P) via its glycine-rich domain, but not with the viral nucleoprotein (N) or large protein (L). The hnRNPA1-P interaction competitively disrupted the viral P-N interaction. Moreover, we found that overexpression of hnRNPA1 enhanced the polyubiquitination of the P protein and degraded it through proteasomal and lysosomal pathways. This study will help understanding the function of hnRNPA1 in the replication of single-stranded negative-sense RNA viruses and providing a novel antiviral target against fish rhabdoviruses.

m6A-modification of cyclin D1 and c-myc IRESs in glioblastoma controls ITAF activity and resistance to mTOR inhibition.

A major mechanism conferring resistance to mTOR inhibitors is activation of a salvage pathway stimulating internal ribosome entry site (IRES)-mediated mRNA translation, driving the synthesis of proteins promoting resistance of glioblastoma (GBM). Previously, we found this pathway is stimulated by the requisite IRES-trans-acting factor (ITAF) hnRNP A1, which itself is subject to phosphorylation and methylation events regulating cyclin D1 and c-myc IRES activity. Here we describe the requirement for m6A-modification of IRES RNAs for efficient translation and resistance to mTOR inhibition. DRACH-motifs within these IRES RNAs upon m6A modification resulted in enhanced IRES activity via increased hnRNP A1-binding following mTOR inhibitor exposure. Inhibitor exposure stimulated the expression of m6A-methylosome components resulting in increased activity in GBM. Silencing of METTL3-14 complexes reduced IRES activity upon inhibitor exposure and sensitized resistant GBM lines. YTHDF3 associates with m6A-modified cyclin D1 or c-myc IRESs, regulating IRES activity, and mTOR inhibitor sensitivity in vitro and in xenograft experiments. YTHDF3 interacted directly with hnRNP A1 and together stimulated hnRNP A1-dependent nucleic acid strand annealing activity. These data demonstrate that m6A-methylation of IRES RNAs regulate GBM responses to this class of inhibitors.

Serum/glucose starvation strikingly reduces heterogeneous nuclear ribonucleoprotein A1 protein and its target, cyclin D1.

Our investigation to explore cellular alterations related to undernutrition in cancer cells revealed that the protein level of heterogenous nuclear ribonucleoprotein A1 (hnRNP A1) is drastically decreased by serum/glucose starvation. Its loss was reversible, serum/glucose starvation-specific and universal throughout cell types and species. The hnRNP A1 mRNA level and hnRNP A1 mRNA/protein stability were not altered under this condition. CCND1 mRNA, which we newly identified as the binding target of hnRNP A1, was decreased by serum/glucose starvation. Under similar conditions, CCND1 protein was reduced in vitro and in vivo, whereas hnRNP A1 mRNA level and CCND1 mRNA level revealed no correlation in most clinical samples. Functional analyses revealed that CCND1 mRNA stability is certainly dependent on hnRNP A1 protein level and that RNA recognition motif-1 (RRM1) in hnRNP A1 plays a central role in maintaining CCND1 mRNA stability and subsequent protein expression. The injection of RRM1-deleted hnRNP A1-expressing cancer cells in the mouse xenograft model did not form any tumours, and that of hnRNP A1-expressing cancer cells retained CCND1 expression at the lesion adjacent to necrosis with a slight increase in tumour volume. Furthermore, RRM1 deletion caused growth suppression with the induction of apoptosis and autophagy, whereas CCND1 restoration completely recovered it. Our results indicate that serum/glucose starvation triggers entire hnRNP A1 protein loss, and its loss may play a role in CCND1 mRNA destabilization and CCND1-mediated cellular event inhibition, i.e. growth promotion, apoptosis induction and autophagosome formation.

ß-Hydroxybutyrate alleviates cartilage senescence through hnRNP A1-mediated up-regulation of PTEN.

Senescence chondrocytes play an important role in Osteoarthritis (OA) progression. However, alleviating OA progression through senescent chondrocyte intervention still faces great challenges. ß-Hydroxybutyrate (BHB) exhibits anti-senescence effects in a variety of age-related dis-eases, but its role in osteoarthritis remains poorly understood. To explore the molecular mechanisms, gene sequencing was used to identify critical genes and potential cellular signaling pathways and male SD rats were used to generate an osteoarthritis model. Results showed that BHB attenuated the senescence of Osteoarthritis chondrocytes (OA-Chos) and alleviated OA progression. Gene ontology (GO) enrichment analysis revealed significant changes in cell cycle genes, with PTEN being the most significant differentially expressed gene. BHB up-regulated the expression of PTEN in OA-Chos, thereby alleviating chondrocyte senescence. Furthermore, BHB facilitated the expression of PTEN by binding to hnRNP A1 and inhibiting the phosphorylation of Akt. This study provided evidence that BHB mitigated chondrocyte senescence and delayed OA, and could thus be used as a novel therapeutic approach for osteoarthritis treatment.

Structure and function analysis of Sam68 and hnRNP A1 synergy in the exclusion of exon 7 from SMN2 transcripts.

Spinal muscular atrophy (SMA) is a neurodegenerative disease caused by the absence of a functional copy of the Survival of Motor Neuron 1 gene (SMN1). The nearly identical paralog, SMN2, cannot compensate for the loss of SMN1 because exon 7 is aberrantly skipped from most SMN2 transcripts, a process mediated by synergistic activities of Src-associated during mitosis, 68 kDa (Sam68/KHDRBS1) and heterogeneous nuclear ribonucleoprotein (hnRNP) A1. This results in the production of a truncated, nonfunctional protein that is rapidly degraded. Here, we present several crystal structures of Sam68 RNA-binding domain (RBD). Sam68-RBD forms stable symmetric homodimers by antiparallel association of helices α3 from two monomers. However, the details of domain organization and the dimerization interface differ significantly from previously characterized homologs. We demonstrate that Sam68 and hnRNP A1 can simultaneously bind proximal motifs within the central region of SMN2 (ex7). Furthermore, we show that the RNA-binding pockets of the two proteins are close to each other in their heterodimeric complex and identify contact residues using crosslinking-mass spectrometry. We present a model of the ternary Sam68·SMN2 (ex7)·hnRNP A1 complex that reconciles all available information on SMN1/2 splicing. Our findings have important implications for the etiology of SMA and open new avenues for the design of novel therapeutics to treat splicing diseases.

A comprehensive understanding of hnRNP A1 role in cancer: new perspectives on binding with noncoding RNA.

The heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is the most abundant and ubiquitously expressed member of the heterogeneous nuclear ribonucleoproteins family (hnRNPs). hnRNP A1 is an RNA-binding protein associated with complexes active in diverse biological processes such as RNA splicing, transactivation of gene expression, and modulation of protein translation. It is overexpressed in several cancers, where it actively promotes the expression and translation of several key proteins and regulators associated with tumorigenesis and cancer progression. Interesting recent studies have focused on the RNA-binding property of hnRNP A1 and revealed previously under-explored functions of hnRNP A1 in the processing of miRNAs, and loading non-coding RNAs into exosomes. Here, we will report the recent advancements in our knowledge of the role of hnRNP A1 in the biological processes underlying cancer proliferation and growth, with a particular focus on metabolic reprogramming.

hnRNP A1 dysfunction in oligodendrocytes contributes to the pathogenesis of multiple sclerosis.

Oligodendrocyte (OL) damage and death are prominent features of multiple sclerosis (MS) pathology, yet mechanisms contributing to OL loss are incompletely understood. Dysfunctional RNA binding proteins (RBPs), hallmarked by nucleocytoplasmic mislocalization and altered expression, have been shown to result in cell loss in neurologic diseases, including in MS. Since we previously observed that the RBP heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) was dysfunctional in neurons in MS, we hypothesized that it might also contribute to OL pathology in MS and relevant models. We discovered that hnRNP A1 dysfunction is characteristic of OLs in MS brains. These findings were recapitulated in the experimental autoimmune encephalomyelitis (EAE) mouse model of MS, where hnRNP A1 dysfunction was characteristic of OLs, including oligodendrocyte precursor cells and mature OLs in which hnRNP A1 dysfunction correlated with demyelination. We also found that hnRNP A1 dysfunction was induced by IFNγ, indicating that inflammation influences hnRNP A1 function. To fully understand the effects of hnRNP A1 dysfunction on OLs, we performed siRNA knockdown of hnRNP A1, followed by RNA sequencing. RNA sequencing detected over 4000 differentially expressed transcripts revealing alterations to RNA metabolism, cell morphology, and programmed cell death pathways. We confirmed that hnRNP A1 knockdown was detrimental to OLs and induced apoptosis and necroptosis. Together, these data demonstrate a critical role for hnRNP A1 in proper OL functioning and survival and suggest a potential mechanism of OL damage and death in MS that involves hnRNP A1 dysfunction.

A splicing silencer in SMN2 intron 6 is critical in spinal muscular atrophy.

Spinal muscular atrophy (SMA) is a fatal neuromuscular disease caused by homozygous deletions or mutations of the SMN1 gene. SMN2 is a paralogous gene of SMN1 and a modifying gene of SMA. A better understanding of how SMN2 exon 7 splicing is regulated helps discover new therapeutic targets for SMA therapy. Based on an antisense walk method to map exonic and intronic splicing silencers (ESSs and ISSs) in SMN2 exon 7 and the proximal regions of its flanking introns, we identified one ISS (ISS6-KH) at upstream of the branch point site in intron 6. By using mutagenesis-coupled RT-PCR with SMN1/2 minigenes, immunochromatography, overexpression and siRNA-knockdown, we found this ISS consists of a bipartite hnRNP A1 binding cis-element and a poly-U sequence located between the proximal hnRNP A1 binding site (UAGCUA) and the branch site. Both HuR and hnRNP C1 proteins promote exon 7 skipping through the poly-U stretch. Mutations or deletions of these motifs lead to efficient SMN2 exon 7 inclusion comparable to SMN1 gene. Furthermore, we identified an optimal antisense oligonucleotide that binds the intron six ISS and causes striking exon 7 inclusion in the SMN2 gene in patient fibroblasts and SMA mouse model. Our findings demonstrate that this novel ISS plays an important role in SMN2 exon 7 skipping and highlight a new therapeutic target for SMA therapy.

Position-dependent effects of hnRNP A1/A2 in SMN1/2 exon7 splicing.

Heterogeneous nuclear ribonucleoprotein A1 and A2 (hnRNP A1/2) is a ubiquitously expressed RNA binding protein known to bind intronic or exonic splicing silencer. Binding of hnRNP A1/2 to survival of motor neuron gene (SMN1/2) exon 7 and flanking sequences strongly inhibits the inclusion of exon 7, which causes spinal muscular atrophy, a common genetic disorder. However, the role of hnRNP A1/2 on the side away from exon 7 is unclear. Here using antisense oligonucleotides, we fished an intronic splicing enhancer (ISE) near the 3'-splice site (SS) of intron 7 of SMN1/2. Mutagenesis identified the efficient motif of the ISE as "UAGUAGG", coupled with RNA pull down and protein overexpression, we proved that hnRNP A1/2 binding to the ISE promotes the inclusion of SMN1/2 exon 7. Using MS2-tethering array and "UAGGGU" motif walking, we further uncovered that effects of hnRNP A1/2 on SMN1/2 exon 7 splicing are position-dependent: exon 7 inclusion is inhibited when hnRNP A1/2 binds proximal to the 5'SS of intron 7, promoted when its binds proximal to the 3'SS. These data provide new insights into the splicing regulatory mechanism of SMN1/2.

Clinical heterogeneity in a family with flail arm syndrome and review of hnRNPA1-related spectrum.

OBJECTIVE: Flail arm syndrome (FAS) is one of the atypical subtypes of amyotrophic lateral sclerosis (ALS). Mutations in hnRNPA1 encoding heterogeneous nuclear ribonucleoprotein (hnRNP) A1 are a rare genetic cause of ALS. Herein, marked clinical heterogeneity of FAS in a pedigree with a known hnRNPA1 variant was described to raise early awareness of the ALS variant. Furtherly, a literature review of the hnRNPA1-related spectrum was made to summarize the clinical and genetic characteristics. METHODS: Detailed clinical evaluation, muscle pathology, and whole-exome sequencing were performed. The sequence and co-segregation of the mutation among the family members were confirmed by Sanger sequencing. RESULTS: The great clinical variability was found in a FAS pedigree. Muscle pathology revealed a cluster distribution of angulated or rounded atrophic fibers, accompanied by significant multi-nucleus aggregation. Immunohistochemical staining showed that mutant hnRNPA1 proteins accumulated in muscle fiber cytoplasm. Exome sequencing identified a documented variant in hnRNPA1 gene c.1018C > T (p.P340S), which co-segregated with disease in the family. Besides, highly phenotypic heterogeneity was also found in other hnRNPA1-related diseases. INTERPRETATION: We described a Chinese pedigree with hnRNPA1-related FAS, which showed significant clinical variability among the intrafamilial members. FAS is a relatively milder variant of ALS, due to the highly heterogeneous clinical spectrum, early observation is of paramount importance. In addition, the highly phenotypic heterogeneity and molecular genetic mechanism of the hnRNPA1-related spectrum are still beyond fully understood. Further, the detailed molecular mechanism underlying the clinical diversity is warranted to be explored.

Optimization of Bifunctional Antisense Oligonucleotides for Regulation of Mutually Exclusive Alternative Splicing of PKM Gene.

Oligonucleotide tools, as modulators of alternative splicing, have been extensively studied, giving a rise to new therapeutic approaches. In this article, we report detailed research on the optimization of bifunctional antisense oligonucleotides (BASOs), which are targeted towards interactions with hnRNP A1 protein. We performed a binding screening assay, Kd determination, and UV melting experiments to select sequences that can be used as a high potency binding platform for hnRNP A1. Newly designed BASOs were applied to regulate the mutually exclusive alternative splicing of the PKM gene. Our studies demonstrate that at least three repetitions of regulatory sequence are necessary to increase expression of the PKM1 isoform. On the other hand, PKM2 expression can be inhibited by a lower number of regulatory sequences. Importantly, a novel branched type of BASOs was developed, which significantly increased the efficiency of splicing modulation. Herein, we provide new insights into BASOs design and show, for the first time, the possibility to regulate mutually exclusive alternative splicing via BASOs.

AMPK-related protein kinase ARK5 regulates subcellular localization of RNA-binding protein hnRNP A1 during hypertonic stress.

The heterogeneous nuclear ribonucleoprotein hnRNP A1 is a nucleocytoplasmic-shuttling RNA-binding protein that plays an important role in nucleic acid metabolism and gene expression regulation. The function of hnRNP A1 is determined in part by its specific location within the cell. Although some work has been done to elucidate the signaling pathways that regulate the cellular localization of hnRNP A1, the precise mechanism(s), including physiological and pathophysiological conditions that alter hnRNP A1 localization, are not known. We previously conducted an unbiased RNAi-based kinome-wide screen to identify kinases that regulate hnRNP A1 localization during hypertonic stress. One of the hits from this screen is AMPK-related protein kinase 5 (ARK5). Here, we validate ARK5 as the kinase responsible for controlling hnRNP A1 subcellular localization in response to hypertonic stress. We find using immunoprecipitation and in vitro kinase assay methods that ARK5 directly interacts with and phosphorylates hnRNP A1 on serine residues within the F-peptide region. We further show that the M9 motif of hnRNP A1 is essential for the ARK5-hnRNP A1 interaction and subsequent phosphorylation. In addition, the silencing of ARK5 increases the expression of antiapoptotic protein Bcl-xL and consequently delays caspase activation during hypertonic stress. Our results indicate that ARK5 phosphorylates hnRNP A1 and regulates its subcellular localization during hypertonic stress.