Graves' Disease: Acquired Cause of a Moderate Increase in Hemoglobin A2 Level.

BACKGROUND: Hyperthyroidism can lead to diverse hematological disorders, such as microcytosis and a mild increase in hemoglobin A2 fraction. METHODS: This study reported a 31-year-old woman of Moroccan origin recently diagnosed with Graves' disease. Her blood tests revealed microcytosis, hypochromia, and a normal ferritin level. A phenotypic analysis of hemo-globin was performed using two techniques: capillary electrophoresis and reversed-phase high performance liquid chromatography. RESULTS: Both techniques indicated a slight increase in hemoglobin A2 level. These results initially suggested het-erozygous beta-thalassemia, eventually correlating with the concurrent presence of Graves' disease, as evidenced by the normalization of hemoglobin A2 level following treatment. CONCLUSIONS: This case highlights the importance of having clinical, biological, and therapeutic data for a relevant interpretation of a phenotypic hemoglobin study.

Molecular characterization of similar Hb Lepore Boston-Washington in four Chinese families using third generation sequencing.

Hemoglobin (Hb) Lepore is a rare deletional δß-thalassemia caused by the fusion between delta-beta genes, and cannot be identified by traditional thaltassemia gene testing technology. The aim of this study was to conduct molecular diagnosis and clinical analysis of Hb Lepore in four unrelated Chinese families using third generation sequencing. Decreased levels of mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH) and an abnormal Hb band were observed in the probands of the four families. However, no common α and ß-thalassemia variants were detected in the enrolled families using polymerase chain reaction-reverse dot blot hybridization based traditional thalassemia gene testing. Further third-generation sequencing revealed similar Hb Lepore-Boston-Washington variants in all the patients, which were resulted from partial coverage of the HBB and HBD globin genes, leading to the formation of a delta-beta fusion gene. Specific gap-PCR and Sanger sequencing confirmed that all the patients carried a similar Hb Lepore-Boston-Washington heterozygote. In addition, decreased levels of MCH and Hb A2 were observed in the proband's wife of family 2, an extremely rare variant of Hb Nanchang (GGT > AGT) (HBA2:c.46G > A) was identified by third-generation sequencing and further confirmed by Sanger sequencing. This present study was the first to report the similar Hb Lepore-Boston-Washington in Chinese population. By combining the utilization of Hb capillary electrophoresis and third-generation sequencing, the screening and diagnosis of Hb Lepore can be effectively enhanced.

Proteomic profiling of circulating ß-thalassaemia/haemoglobin E extra-cellular vesicles reveals that association with immunoglobulin induces membrane vesiculation.

Splenectomised ß-thalassaemia/haemoglobin E (HbE) patients have increased levels of circulating microparticles or medium extra-cellular vesicles (mEVs). The splenectomised mEVs play important roles in thromboembolic complications in patients since they can induce platelet activation and endothelial cell dysfunction. However, a comprehensive understanding of the mechanism of mEV generation in thalassaemia disease has still not been reached. Thalassaemic mEVs are hypothesised to be generated from cellular oxidative stress in red blood cells (RBCs) and platelets. Therefore, a proteomic analysis of mEVs from splenectomised and non-splenectomised ß-thalassaemia/HbE patients was performed by liquid chromatography with tandem mass spectrometry. A total of 171 proteins were identified among mEVs. Interestingly, 72 proteins were uniquely found in splenectomised mEVs including immunoglobulin subunits and cytoskeleton proteins. Immunoglobulin G (IgG)-bearing mEVs in splenectomised patients were significantly increased. Furthermore, complement C1q was detected in both mEVs with IgG binding and mEVs without IgG binding. Interestingly, the percentage of mEVs generated from RBCs with IgG binding was approximately 15-20 times higher than the percentage of RBCs binding with IgG. This suggested that the vesiculation of thalassaemia mEVs could be a mechanism of RBCs to eliminate membrane patches harbouring immune complex and may consequently prevent cells from phagocytosis and lysis.

Splice Acceptor Mutation [HBB:c.93-2A > T] in a Patient with Hb S/ß0-Thalassemia.

We report a case of Hb S/ß0-thalassemia (Hb S/ß0-thal) in a patient who is a compound heterozygote for the Hb Sickle mutation (HBB:c.20A > T) and a mutation of the canonical splice acceptor sequence of IVS1 (AG > TG, HBB:c.93-2A > T). This is the fifth mutation involving the AG splice acceptor site of IVS1, all of which prevent normal splicing and cause ß0-thal.

GDF15 linked to maternal risk of nausea and vomiting during pregnancy.

GDF15, a hormone acting on the brainstem, has been implicated in the nausea and vomiting of pregnancy, including its most severe form, hyperemesis gravidarum (HG), but a full mechanistic understanding is lacking1-4. Here we report that fetal production of GDF15 and maternal sensitivity to it both contribute substantially to the risk of HG. We confirmed that higher GDF15 levels in maternal blood are associated with vomiting in pregnancy and HG. Using mass spectrometry to detect a naturally labelled GDF15 variant, we demonstrate that the vast majority of GDF15 in the maternal plasma is derived from the feto-placental unit. By studying carriers of rare and common genetic variants, we found that low levels of GDF15 in the non-pregnant state increase the risk of developing HG. Conversely, women with ß-thalassaemia, a condition in which GDF15 levels are chronically high5, report very low levels of nausea and vomiting of pregnancy. In mice, the acute food intake response to a bolus of GDF15 is influenced bi-directionally by prior levels of circulating GDF15 in a manner suggesting that this system is susceptible to desensitization. Our findings support a putative causal role for fetally derived GDF15 in the nausea and vomiting of human pregnancy, with maternal sensitivity, at least partly determined by prepregnancy exposure to the hormone, being a major influence on its severity. They also suggest mechanism-based approaches to the treatment and prevention of HG.

Clinical experience using peripheral blood parameters to analyse the mutation type of thalassemia carriers in pregnant women.

Thalassaemia is a typically monogenic disease caused by mutations or deletions in the globin gene and has a high prevalence in southern China. Prenatal screening for thalassaemia can be effective in reducing the incidence of thalassaemia. Haematologic parameters of pregnant thalassaemia carriers are diverse and potentially valuable for identifying different types of genotypes. By comparing and evaluating haematological parameters, formulas in the literature, we tried to reveal differences between pregnant women carrying different types of thalassaemia genes. The Mentzer formula (MCV/RBC) showed a strong ability to differentiate thalassaemia genotypes in pregnant women. In addition, combined with haemoglobin electrophoresis HbA2 can further distinguish the -α/αα, αTα/αα, -/αα, ß+/N and ß0/N groups. HbA2 divides them into two groups. Based on the Mentzer formula, we can further decide which type of thalassaemia to screen (α/ß and the subgroups) for genotyping. Therefore, this simpler and more cost-effective workflow has great potential for application in screening pregnant women for thalassaemia carriers.Impact StatementWhat is already known on this subject? Currently, it is known that thalassaemia gene carriers have abnormal blood indicators. Many findings describe their important values in distinguishing thalassaemia and other blood diseases. They combined different metrics as an algorithm to distinguish thalassaemia and iron deficiency anaemia. Prenatal screening is an effective method to reduce the incidence of thalassaemia. The current main method is PCR. Due to technical and financial constraints, many backward places cannot use this technology. The necessity for prenatal screening for thalassaemia has been overlooked.What the results of this study add? Among these algorithms, Mentzer formula revealed differences in haematological parameters during pregnancy between normal individuals and thalassaemia carriers. Combining the HbA2, thalassaemia carriers can be distinguished from normal individuals, including -α/αα, αTα/αα, -/αα, ß0/N and ß+/N.What are the implications of these findings for clinical practice and/or further research? We provide another tool for these hospitals that donot have Hb electrophoresis test and PCR. Then the clinical doctor can get some evidence and suggest women go to another big hospital for essential tests. It is an excellent suggestion. In the future, we will collect more specific gene types and further investigate their potential relationship using these formulas.

The effect of ferritin levels on distal femoral cartilage thickness in patients with beta thalassaemia major.

INTRODUCTION: To the best of our knowledge, the present study is the first in the literature to assess distal femoral cartilage thickness and its relationship with ferritin levels in adult patients with beta thalassaemia major (BTM). MATERIALS AND METHODS: 45 patients with BTM and 45 healthy controls were included in the study. Ferritin and haemoglobin levels of the patient and healthy groups were determined by blood analysis and distal femoral cartilage thicknesses were measured via ultrasound. Then, the patient group was divided into subgroups according to whether their ferritin levels were below or above 2500 µg/L. They were then compared among themselves and with the healthy control group using the available data. RESULTS: Distal femoral cartilage thickness values were statistically significantly lower in the BTM group compared to the healthy control group (p values < 0.001). Patients with a ferritin level below 2500 µg/L had statistically significantly higher right and left average distal femoral cartilage thickness values than the patients with a ferritin level above 2500 µg/L (p = 0.029 and p = 0.019, respectively). The right and left average distal femoral cartilage thickness values of the patient subgroup with low ferritin levels were statistically similar to the control group (p = 0.146 and p = 0.164, respectively). CONCLUSION: Our study showed that thalassaemia patients are more likely to develop osteoarthritis (OA) than the normal population and possible OA development can be prevented by keeping the ferritin levels of these patients in the optimum range.

Protein C and S levels in patients with Thalassemia intermedia.

This study was conducted to assess the level of proteins C and S in patients with thalassemia intermedia from the Thalassemia Center in Erbil, Iraq. This study aimed to evaluate protein C and S levels in patients with ß-thalassemia intermedia and correlate them to different clinical and laboratory parameters. This comprehensive descriptive case-control study was conducted in 2021. Twenty-three thalassemia intermedia patients were recruited. After the participants' demographic data were recorded, plasma levels of both proteins were measured. The acquired files were examined for the 23 patients studied, 48% of whom were female. The mean age of the patients was 16.32 years. The findings show that the proportion of protein C in males was greater than in females, while this percentage contrasts when compared with protein S (ranging between 89-99% and 85-96%, respectively). Concerning age, these two types of protein in children have more value compared to older ages. Only seven people had less than 1,000 ferritins, while the others had higher values. A decrease in proteins C and S was observed in the thalassemia intermediate compared to the control group. There was a significant relationship between the decreased protein C and S levels with splenectomy. Given the significant reduction in protein C and S levels among patients with thalassemia intermediate compared to the control group, there is an increased risk of thromboembolic events in patients with thalassemia intermediate.

Relationship between Oxidative Stress and the Blood Iron Concentration and Antioxidant Status in Major ß-thalassemia in Iraq.

Reduction or total lack of beta-globin chains caused by a congenital disease called ß-thalassemia major is one of the lives threatening diseases. Patients who suffer from ß-thalassemia need a repeated blood transfusion for survival. The repeated blood transfusion in ß-thalassemia patients may cause oxidative stress and tissue injury due to iron overload, altered antioxidant enzymes, and other essential trace element levels. The current study aimed to investigate the correlation of oxidative stress with serum trace element levels and antioxidant enzyme status in ß-thalassemia major patients. A total of 130 serum samples were obtained from ß-thalassemia major patients (n=100; 50 males and 50 females) and healthy individuals (n=30; 15 males and 15 females). Hematological parameters were measured on both groups by a comprehensive blood test that included the amount of hemoglobin Hb, packed cells volume, number of red blood cells, mean corpuscular volume ratio, mean corpuscular hemoglobin ratio, mean corpuscular hemoglobin concentration, red cell distribution width, white blood cells, and platelets counts. All of these blood parameters showed a clear decrease in thalassemia patients, except for red blood cells and platelets counts, which demonstrated a significant increase. The highest significant mean for iron in males and females were 233.768 and 219.150 µgm\dL in patients, respectively, while the mean level of iron significantly reduced in the control group (113.40 and 103.33 µgm\dL in males and females, respectively). The results indicated a significant decrease in uric acid in males and females in the patient group (41.042 and 40.582 mg\L in males and females, respectively), compared to the control group (53.866 and 43.60 mg\L in males and females, respectively). Allantoin concentration was detected by high-performance liquid chromatography technique, the results of which showed that the highest values in patients were 62.822 and 25.480 mg\L in males and females, respectively, compared to the control group 2.342 and 1.481 mg\L in males and females, respectively. Superoxide dismutase concentration decreased in patients (129.635 and 111.848 U\mL in males and females, respectively), compared to the control group (208.623 and 190.413 U\ml in males and females, respectively).

A randomised double-blind placebo-controlled clinical trial of oral hydroxyurea for transfusion-dependent ß-thalassaemia.

Hydroxyurea is an antimetabolite drug that induces fetal haemoglobin in sickle cell disease. However, its clinical usefulness in ß-thalassaemia is unproven. We conducted a randomised, double-blind, placebo-controlled clinical trial to evaluate the efficacy and safety of hydroxyurea in transfusion-dependent ß-thalassaemia. Sixty patients were assigned 1:1 to oral hydroxyurea 10-20 mg/kg/day or placebo for 6 months by stratified block randomisation. Hydroxyurea treatment did not alter the blood transfusion volume overall. However, a significantly higher proportion of patients on hydroxyurea showed increases in fetal haemoglobin percentage (89% vs. 59%; p < 0.05) and reductions in erythropoietic stress as measured by soluble transferrin receptor concentration (79% vs. 40%; p < 0.05). Based on fetal haemoglobin induction (> 1.5%), 44% of patients were identified as hydroxyurea-responders. Hydroxyurea-responders, required significantly lower blood volume (77 ± SD27ml/kg) compared to hydroxyurea-non-responders (108 ± SD24ml/kg; p < 0.01) and placebo-receivers (102 ± 28ml/kg; p < 0.05). Response to hydroxyurea was significantly higher in patients with HbE ß-thalassaemia genotype (50% vs. 0%; p < 0.01) and Xmn1 polymorphism of the γ-globin gene (67% vs. 27%; p < 0.05). We conclude that oral hydroxyurea increased fetal haemoglobin percentage and reduced erythropoietic stress of ineffective erythropoiesis in patients with transfusion-dependent ß-thalassaemia. Hydroxyurea reduced the transfusion burden in approximately 40% of patients. Response to hydroxyurea was higher in patients with HbE ß-thalassaemia genotype and Xmn1 polymorphism of the γ-globin gene.

Machine learning-based approaches for identifying human blood cells harboring CRISPR-mediated fetal chromatin domain ablations.

Two common hemoglobinopathies, sickle cell disease (SCD) and ß-thalassemia, arise from genetic mutations within the ß-globin gene. In this work, we identified a 500-bp motif (Fetal Chromatin Domain, FCD) upstream of human ϒ-globin locus and showed that the removal of this motif using CRISPR technology reactivates the expression of ϒ-globin. Next, we present two different cell morphology-based machine learning approaches that can be used identify human blood cells (KU-812) that harbor CRISPR-mediated FCD genetic modifications. Three candidate models from the first approach, which uses multilayer perceptron algorithm (MLP 20-26, MLP26-18, and MLP 30-26) and flow cytometry-derived cellular data, yielded 0.83 precision, 0.80 recall, 0.82 accuracy, and 0.90 area under the ROC (receiver operating characteristic) curve when predicting the edited cells. In comparison, the candidate model from the second approach, which uses deep learning (T2D5) and DIC microscopy-derived imaging data, performed with less accuracy (0.80) and ROC AUC (0.87). We envision that equivalent machine learning-based models can complement currently available genotyping protocols for specific genetic modifications which result in morphological changes in human cells.

Primary HBB gene mutation severity and long-term outcomes in a global cohort of ß-thalassaemia.

In ß-thalassaemia, the severity of inherited ß-globin gene mutations determines the severity of the clinical phenotype at presentation and subsequent transfusion requirements. However, data on associated long-term outcomes remain limited. We analysed data from 2109 ß-thalassaemia patients with available genotypes in a global database. Genotype severity was grouped as ß0 /ß0 , ß0 /ß+ , ß+ /ß+ , ß0 /ß++ , ß+ /ß++ , and ß++ /ß++ . Patients were followed from birth until death or loss to follow-up. The median follow-up time was 34·1 years. Mortality and multiple morbidity outcomes were analyzed through five different stratification models of genotype severity groups. Interestingly, ß0 and ß+ mutations showed similar risk profiles. Upon adjustment for demographics and receipt of conventional therapy, patients with ß0 /ß0 , ß0 /ß+ , or ß+ /ß+ had a 2·104-increased risk of death [95% confidence interval (CI): 1·176-3·763, P = 0·011] and 2·956-increased odds of multiple morbidity (95% CI: 2·310-3·784, P < 0·001) compared to patients in lower genotype severity groups. Cumulative survival estimates by age 65 years were 36·8% for this subgroup compared with 90·2% for patients in lower genotype severity groups (P < 0·001). Our study identified mortality and morbidity risk estimates across various genotype severity groups in patients with ß-thalassaemia and suggests inclusion of both ß+ and ß0 mutations in strata of greatest severity.

Iron parameters in pregnant women with beta-thalassaemia minor combined with iron deficiency anaemia compared to pregnant women with iron deficiency anaemia alone demonstrate the safety of iron supplementation in beta-thalassaemia minor during pregnancy.

In patients with beta-thalassaemia intermedia or major, hepcidin induces iron overload by continuously promoting iron absorption. There have been no studies in pregnant women with beta-thalassaemia minor combined with iron deficiency anaemia (IDA), examining whether hepcidin is inhibited by GDF15, as may occur in patients with beta-thalassaemia intermedia or major, or whether the iron metabolism characteristics and the effect of iron supplementation are consistent with simple IDA in pregnancy. We compared and analysed routine blood parameters, iron metabolism parameters, the GDF15 levels, and the hepcidin levels among four groups, namely the beta-thalassaemia (ß) + IDA, ß, IDA, and normal groups. In addition, the ß + IDA and IDA groups received iron supplementation for four weeks. We found no statistically significant correlation between hepcidin and GDF15 in any group, but a positive correlation was observed between hepcidin and ferritin. After iron supplementation, the routine blood parameters and iron metabolism parameters in the ß + IDA group were improved, and the hepcidin content was significantly increased. These results suggest that in pregnant women with beta-thalassaemia minor, hepcidin functions normally to maintain iron homeostasis, and that iron supplementation is effective and safe.

Betibeglogene Autotemcel Gene Therapy for Non-ß0/ß0 Genotype ß-Thalassemia.

BACKGROUND: Betibeglogene autotemcel (beti-cel) gene therapy for transfusion-dependent ß-thalassemia contains autologous CD34+ hematopoietic stem cells and progenitor cells transduced with the BB305 lentiviral vector encoding the ß-globin (ßA-T87Q) gene. METHODS: In this open-label, phase 3 study, we evaluated the efficacy and safety of beti-cel in adult and pediatric patients with transfusion-dependent ß-thalassemia and a non-ß0/ß0 genotype. Patients underwent myeloablation with busulfan (with doses adjusted on the basis of pharmacokinetic analysis) and received beti-cel intravenously. The primary end point was transfusion independence (i.e., a weighted average hemoglobin level of ≥9 g per deciliter without red-cell transfusions for ≥12 months). RESULTS: A total of 23 patients were enrolled and received treatment, with a median follow-up of 29.5 months (range, 13.0 to 48.2). Transfusion independence occurred in 20 of 22 patients who could be evaluated (91%), including 6 of 7 patients (86%) who were younger than 12 years of age. The average hemoglobin level during transfusion independence was 11.7 g per deciliter (range, 9.5 to 12.8). Twelve months after beti-cel infusion, the median level of gene therapy-derived adult hemoglobin (HbA) with a T87Q amino acid substitution (HbAT87Q) was 8.7 g per deciliter (range, 5.2 to 10.6) in patients who had transfusion independence. The safety profile of beti-cel was consistent with that of busulfan-based myeloablation. Four patients had at least one adverse event that was considered by the investigators to be related or possibly related to beti-cel; all events were nonserious except for thrombocytopenia (in 1 patient). No cases of cancer were observed. CONCLUSIONS: Treatment with beti-cel resulted in a sustained HbAT87Q level and a total hemoglobin level that was high enough to enable transfusion independence in most patients with a non-ß0/ß0 genotype, including those younger than 12 years of age. (Funded by Bluebird Bio; HGB-207 ClinicalTrials.gov number, NCT02906202.).

Borderline HbA2 levels: Dilemma in diagnosis of beta-thalassemia carriers.

There is inconsistency in the exact definition of diagnostic levels of HbA2 for ß thalassemia trait. While many laboratories consider HbA2 ≥4.0 % diagnostic, still others consider HbA2 ≥3.3 % or HbA2 ≥3.5 % as the cut-off for establishing ß thalassemia carrier diagnosis. This is because, over the years, studies have described ß thalassemia carriers showing HbA2 levels that lie above the normal range of HbA2 but below the typical carrier range of ß thalassemia. These, "borderline HbA2 levels", though not detrimental to health, are significant in ß thalassemia carrier diagnosis because they can lead to misinterpretation of results. In this review, we have evaluated the prevalence of borderline HbA2 levels and discussed the causes of borderline HbA2 values. We have also compiled an extensive catalogue of ß globin gene defects associated with borderline HbA2 levels and have discussed strategies to avoid misdiagnosing borderline HbA2 ß thalassemia carriers. Our analysis of studies that have delineated the cause of borderline HbA2 levels in different populations shows that 35.4 % [626/1766] of all individuals with borderline HbA2 levels carry a molecular defect. Among the positive samples, 17 % [299/1766] show ß globin gene defects, 7.7 % [137/1766] show α thalassemia defects, 2.7 % [49/1766] show KLF1 gene mutations, 2.3 % [41/1766] show the co-inheritance of ß and α thalassemia, 2.0 % [37/1766] show the co-inheritance of ß and δ thalassemia and 1.8 % [32/1766] show α globin gene triplication. It appears that a comprehensive molecular work up of the ß globin gene is the only definite method to detect borderline HbA2 ß thalassemia carriers, especially in populations with a high prevalence of the disease. The presence of associated genetic or acquired determinants may subsequently be assessed to identify the cause of borderline HbA2.

The Post-Storage Performance of RBCs from Beta-Thalassemia Trait Donors Is Related to Their Storability Profile.

Blood donors with beta-thalassemia traits (ßThal+) have proven to be good "storers", since their stored RBCs are resistant to lysis and resilient against oxidative/proteotoxic stress. To examine the performance of these RBCs post-storage, stored ßThal+ and control RBCs were reconstituted in plasma donated from transfusion-dependent beta-thalassemic patients and healthy controls, and incubated for 24 h at body temperature. Several physiological parameters, including hemolysis, were evaluated. Moreover, labeled fresh/stored RBCs from the two groups were transfused in mice to assess 24 h recovery. All hemolysis metrics were better in the group of heterozygotes and distinguished them against controls in the plasma environment. The reconstituted ßThal+ samples also presented higher proteasome activity and fewer procoagulant extracellular vesicles. Transfusion to mice demonstrated that ßThal+ RBCs present a marginal trend for higher recovery, regardless of the recipient's immune background and the RBC storage age. According to correlation analysis, several of these advantageous post-storage characteristics are related to storage phenotypes, like the cytoskeleton composition, low cellular fragility, and enhanced membrane proteostasis that characterize stored ßThal+ RBCs. Overall, it seems that the intrinsic physiology of ßThal+ RBCs benefits them in conditions mimicking a recipient environment, and in the circulation of animal models; findings that warrant validation in clinical trials.

Comparison of Two Alternative Procedures to Obtain Packed Red Blood Cells for ß-Thalassemia Major Transfusion Therapy.

ß-thalassemia major (ßTM) patients require frequent blood transfusions, with consequences that span from allogenic reactions to iron overload. To minimize these effects, ßTM patients periodically receive leucodepleted packed red blood cells (P-RBCs) stored for maximum 14 days. The aim of this study was to compare two alternative routine procedures to prepare the optimal P-RBCs product, in order to identify differences in their content that may somehow affect patients' health and quality of life (QoL). In method 1, blood was leucodepleted and then separated to obtain P-RBCs, while in method 2 blood was separated and leucodepleted after removal of plasma and buffycoat. Forty blood donors were enrolled in two independent centers; couples of phenotypically matched whole blood units were pooled, divided in two identical bags and processed in parallel following the two methods. Biochemical properties, electrolytes and metabolic composition were tested after 2, 7 and 14 days of storage. Units prepared with both methods were confirmed to have all the requirements necessary for ßTM transfusion therapy. Nevertheless, RBCs count and Hb content were found to be higher in method-1, while P-RBCs obtained with method 2 contained less K+, iron and storage lesions markers. Based on these results, both methods should be tested in a clinical perspective study to determine a possible reduction of transfusion-related complications, improving the QoL of ßTM patients, which often need transfusions for the entire lifespan.

Application of Bayesian Decision Tree in Hematology Research: Differential Diagnosis of ß-Thalassemia Trait from Iron Deficiency Anemia.

OBJECTIVE: Several discriminating techniques have been proposed to discriminate between ß-thalassemia trait (ßTT) and iron deficiency anemia (IDA). These discrimination techniques are essential clinically, but they are challenging and typically difficult. This study is the first application of the Bayesian tree-based method for differential diagnosis of ßTT from IDA. METHOD: This cross-sectional study included 907 patients with ages over 18 years old and a mean (±SD) age of 25 ± 16.1 with either ßTT or IDA. Hematological parameters were measured using a Sysmex KX-21 automated hematology analyzer. Bayesian Logit Treed (BLTREED) and Classification and Regression Trees (CART) were implemented to discriminate ßTT from IDA based on the hematological parameters. RESULTS: This study proposes an automatic detection model of beta-thalassemia carriers based on a Bayesian tree-based method. The BLTREED model and CART showed that mean corpuscular volume (MCV) was the main predictor in diagnostic discrimination. According to the test dataset, CART indicated higher sensitivity and negative predictive value than BLTREED for differential diagnosis of ßTT from IDA. However, the CART algorithm had a high false-positive rate. Overall, the BLTREED model showed better performance concerning the area under the curve (AUC). CONCLUSIONS: The BLTREED model showed excellent diagnostic accuracy for differentiating ßTT from IDA. In addition, understanding tree-based methods are easy and do not need statistical experience. Thus, it can help physicians in making the right clinical decision. So, the proposed model could support medical decisions in the differential diagnosis of ßTT from IDA to avoid much more expensive, time-consuming laboratory tests, especially in countries with limited recourses or poor health services.

Five novel globin gene mutations identified in five Chinese families by next-generation sequencing.

BACKGROUND: Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α-thalassemia and two novel cases of ß-thalassemia caused by five different mutations in the globin gene. METHODS: Next-generation sequencing (NGS) was used to identify novel α- and ß-thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. RESULTS: NGS revealed five novel cases of α- and ß-thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α-globin mRNA were analyzed. CONCLUSION: Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.