Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 19 de 19
Filtrar
1.
Semina ciênc. agrar ; 43(6): 2707-2716, nov.-dez. 2022. ilus, tab
Artigo em Inglês | VETINDEX | ID: biblio-1425837

Resumo

In the present study, we investigate the effect of the presence or absence of corpus luteum (CL) at the beginning of a fixed-time artificial insemination (FTAI) protocol and to evaluate the impact of one-time use of intravaginal progesterone device (P4 device) in cows with or without CL. A total of 776 primiparous Nellore cows were subjected to FTAI approximately 45 days postpartum. In Experiment 1, 476 cows were divided into two experimental groups: with (CL-present, n=113) or without (CL-absent, n=363) CL, after ultrasound evaluation. On day 0 (D0), all cows received a new P4 device (1.0 g) and 2.0 mg estradiol benzoate (EB). Eight days later (D8), the P4 devices were withdrawn, and prostaglandin (15 mg), estradiol cypionate (0.5 mg), and eCG (300 IU) were administered i.m. All cows were inseminated 48 h after P4 device withdrawal (D10). In Experiment 2, the cows (n= 300) received (at D0) P4 devices that were previously used once in other cows with (n=109) or without CL (n=191) and 2 mg of EB. The same protocol as that used in Experiment 1 was performed from D8 onwards. In Experiment 1, the overall conception rate after FTAI was 55% (262/476). No difference was found in the conception rate between CL-present and CL-absent cows (52.2 vs. 55.5%). In Experiment 2, the conception rate obtained with P4 devices previously used in cows with CL (58.7%) was greater (P<0.05) than that obtained with P4 devices previously used in cows without CL (42.9%). Thus, this strategy resulted in a 15.8% increase in conception rate. In conclusion, the presence or absence of CL at the beginning of the FTAI protocol did not affect the conception rate in cows synchronized with the new P4 device, but the insertion of P4 devices previously used in cows with CL enhanced the conception rates in cows without CL.


No presente estudo, investigamos o efeito da presença ou ausência de corpo lúteo (CL) no início de um protocolo de inseminação artificial em tempo fixo (IATF) e avaliamos o impacto do uso único de dispositivo intravaginal de progesterona (dispositivo P4) em vacas com ou sem CL. Um total de 776 vacas Nelore primíparas, aproximadamente 45 dias pós-parto foram submetidas à IATF. No Experimento 1, após avaliação ultrassonográfica, 476 vacas foram divididas em dois grupos experimentais: com (CL-presente, n=113) ou sem (CL-ausente, n=363) CL. No dia 0 (D0), todas as vacas receberam um novo dispositivo de P4 (1,0 g) e 2.0 mg de benzoato de estradiol (BE). Após 8 dias (D8), os dispositivos P4 foram retirados e prostaglandina (15 mg), cipionato de estradiol (0,5 mg) e eCG (300 UI) foram administrados i.m. Todas as vacas foram inseminadas 48 horas após a retirada do dispositivo de P4 (D10). No Experimento 2, as vacas (n= 300) receberam (no D0) um dispositivo de P4 previamente utilizado uma única vez em outras vacas com (n=109) ou sem CL (n=191) e 2 mg de BE. O mesmo protocolo utilizado no Experimento 1 foi realizado a partir do D8. No experimento 1, a taxa geral de concepção após IATF foi de 55% (262/476). Não foi encontrada diferença na taxa de concepção entre as vacas com CL presente e CL ausente (52,2 vs. 55,5%). No Experimento 2, a taxa de concepção obtida com dispositivos P4 previamente utilizados em vacas com CL-presente (58,7%) foi maior (P<0,05) quando comparada aos dispositivos P4 previamente utilizados em vacas com CL-ausente (42,9%). Essa estratégia resultou em aumento de 15,8% na taxa de concepção. Em conclusão, a presença ou ausência de CL no início do protocolo de IATF não afetou a taxa de concepção em vacas sincronizadas com dispositivo novo de P4; e a eficácia dos dispositivos de P4 previamente utilizados em vacas com CL é maior durante seu segundo uso em vacas sem CL.


Assuntos
Animais , Bovinos , Progesterona , Reprodução , Gravidez , Corpo Lúteo
2.
Ciênc. Anim. (Impr.) ; 31(1,supl.1): 41-44, 2021. tab
Artigo em Português | VETINDEX | ID: biblio-1368978

Resumo

The objective of this work was to evaluate the effect of the association of the antioxidant resveratrol with sucrose in a vitrification protocol of ovarian tissue in cows, on the morphology of preantral follicles. Ten ovaries of cows were used, collected in local slaughterhouses, fragmented and distributed to the following treatments: fresh control (Co); toxicity (T); (T0) zero toxicity/ only with base vitrification solution (SBV), (TS) toxicity with SBV plus sucrose, (TR) toxicity with SBV plus resveratrol, (TS+R) toxicity with SBV and sucrose plus resveratrol; and for glazing (V); (VS) vitrification with SBV and sucrose, (VR) vitrification with SBV and resveratrol, (VS+R) vitrification with SBV and sucrose plus resveratrol. Preantral follicles were quantified and classified according to morphology into normal and degenerated. The mean percentages between normal and degenerated follicles did not differ (p>0.05) in the following percentages, normal 51.4% and degenerated 48.60%. In the toxicity test there was a difference (p0.05), demonstrating that the vitrification technique is efficient, but the concentration of cryoprotectants used needs to be re-evaluated. Concluding that the natural antioxidant association resveratrol to sucrose in vitrification and rewarming protocols contributes with reservations for the morphological preservation of preantral follicles in cows.


Assuntos
Animais , Feminino , Bovinos , Ovário/citologia , Sacarose/uso terapêutico , Resveratrol/uso terapêutico , Folículo Ovariano/anatomia & histologia , Vitrificação
3.
R. bras. Parasitol. Vet. ; 28(4): 786-789, 2019. tab
Artigo em Inglês | VETINDEX | ID: vti-25470

Resumo

Platynosomiasis is a hepatopathy caused by Platynosomum illiciens(= P. fastosum) (Trematoda: Dicrocoelidae), which occurs mainly in domestic and wild cats in tropical and subtropical areas. The objective of this study was to verify the occurrence of P. illiciens infection in domestic cats in the city of Araguaína, Tocantins, Brazil, using necropsy and coproparasitological tests. Additionally, we aimed to evaluate the use of two different techniques to diagnose P. illiciens infection in domestic cats and verify whether this parasitism was associated with individual feline characteristics. For this, 54 cats of different ages were analyzed. The percentage of infection was 33.3% (CI = 21.1-47.5%), parasite load was 9-509, mean intensity was 151.7, and mean abundance was 50.5 trematodes per animal. The risk of infection was higher for females than for males (OR = 5.00; P = 0.017). The spontaneous sedimentation coproparasitological test demonstrated the greatest sensitivity and specificity in diagnosing P. illiciens. This study is the first to report the occurrence of P. illiciens in cats in the state of Tocantins, northern Brazil.(AU)


A platinosomose é uma hepatopatia causada por Platynosomum illiciens(= P. fastosum) (Trematoda: Dicrocoelidae), que ocorre principalmente em felinos domésticos e selvagens de áreas tropicais e subtropicais. O objetivo deste trabalho foi verificar a ocorrência de P. illiciens em gatos domésticos do município de Araguaína, Tocantins, Brasil, por meio de necrópsia e exames coproparasitológicos, bem como avaliar o uso de diferentes técnicas no diagnóstico de P. illiciens em gatos domésticos e verificar a associação da parasitose com características individuais dos felinos. O estudo foi realizado em 54 gatos com diferentes idades, machos e fêmeas. O percentual de infecção foi de 33,3% (IC= 21,1% - 47,5%), a carga parasitária observada foi de 09-509, a intensidade média de 151,7 e a abundância média de 50,5 trematódeos por animal. As fêmeas apresentaram maior chance de infecção do que os machos (OR=5,00; P=0,017). O teste coproparasitológico que demonstrou maior sensibilidade e especificidade foi o de sedimentação espontânea. O presente estudo faz o primeiro relato da ocorrência de P. illiciens em gatos no estado do Tocantins, região Norte do Brasil.(AU)


Assuntos
Animais , Gatos , Hepatopatias/epidemiologia , Trematódeos/patogenicidade
4.
Semina Ci. agr. ; 40(4): 1723-1730, jul.-ago. 2019. ilus
Artigo em Inglês | VETINDEX | ID: vti-21963

Resumo

Visceral leishmaniasis (VL) is expanding in the Brazilian territory. Dogs are considered an important urban reservoir; however, studies have demonstrated the presence of infected cats in some Brazilian states. This report aimed to describe a case of Leishmania (Leishmania) infantum infection in a two-month-old domestic feline from a Brazilian region with a high incidence of human visceral leishmaniasis. The analyzed samples were the cats blood, conjunctiva, spleen, liver, popliteal, submandibular and mesenteric lymph nodes, skin, lung and kidney. The diagnostic methods were: parasitological examination, polymerase chain reaction (PCR) and an immunoflurescence antibody test (IFAT). All tissues were positive. The title obtained using the IFAT was 1:160. The animal was negative for feline immunodeficiency virus (FIV) and feline leukemia virus (FeLV). This work addresses the first case of feline leishmaniasis in the state of Tocantins, and reveals data that may contribute to the knowledge of the disease, since it has been shown to be able to develop rapidly and fatally in kittens, with the ability to infect several tissues.(AU)


A leishmaniose visceral (LV) encontra-se em expansão no território brasileiro. O cão é considerado um importante reservatório urbano, no entanto, estudos tem demonstrado a presença de felinos infectados em alguns estados brasileiros. Este relato objetivou descrever um caso de infecção por Leishmania (Leishmania) infantum em um felino doméstico de dois meses proveniente de uma região brasileira com alta incidência de leishmaniose visceral humana. As amostras analisadas foram sangue, conjuntiva, baço, fígado, linfonodos poplíteo, submandibular e mesentérico, pele, pulmão e rim. Os métodos de diagnóstico utilizados foram: o exame parasitológico direto, a reação em cadeia pela polimerase (PCR) e a reação de imunofluorescência indireta (RIFI). Houve positividade de todos os tecidos e o animal apresentou elevada carga parasitária. O título obtido na RIFI foi de 1:160. O animal foi negativo para os vírus da imunodeficiência felina (FIV) e da leucemia felina (FeLV). Este trabalho aborda o primeiro caso de leishmaniose felina no estado do Tocantins e revela dados que podem contribuir para o conhecimento da doença, visto que esta mostrou-se capaz de se desenvolver de forma rápida e fatal em filhotes, podendo infectar vários tecidos.(AU)


Assuntos
Animais , Feminino , Gatos , Leishmaniose Visceral/veterinária , Leishmaniose Visceral/diagnóstico , Leishmaniose Visceral/patologia , Leishmaniose Visceral/microbiologia , Doenças Parasitárias em Animais
5.
Semina ciênc. agrar ; 40(4): 1723-1730, jul.-ago. 2019. ilus
Artigo em Inglês | VETINDEX | ID: biblio-1501435

Resumo

Visceral leishmaniasis (VL) is expanding in the Brazilian territory. Dogs are considered an important urban reservoir; however, studies have demonstrated the presence of infected cats in some Brazilian states. This report aimed to describe a case of Leishmania (Leishmania) infantum infection in a two-month-old domestic feline from a Brazilian region with a high incidence of human visceral leishmaniasis. The analyzed samples were the cat’s blood, conjunctiva, spleen, liver, popliteal, submandibular and mesenteric lymph nodes, skin, lung and kidney. The diagnostic methods were: parasitological examination, polymerase chain reaction (PCR) and an immunoflurescence antibody test (IFAT). All tissues were positive. The title obtained using the IFAT was 1:160. The animal was negative for feline immunodeficiency virus (FIV) and feline leukemia virus (FeLV). This work addresses the first case of feline leishmaniasis in the state of Tocantins, and reveals data that may contribute to the knowledge of the disease, since it has been shown to be able to develop rapidly and fatally in kittens, with the ability to infect several tissues.


A leishmaniose visceral (LV) encontra-se em expansão no território brasileiro. O cão é considerado um importante reservatório urbano, no entanto, estudos tem demonstrado a presença de felinos infectados em alguns estados brasileiros. Este relato objetivou descrever um caso de infecção por Leishmania (Leishmania) infantum em um felino doméstico de dois meses proveniente de uma região brasileira com alta incidência de leishmaniose visceral humana. As amostras analisadas foram sangue, conjuntiva, baço, fígado, linfonodos poplíteo, submandibular e mesentérico, pele, pulmão e rim. Os métodos de diagnóstico utilizados foram: o exame parasitológico direto, a reação em cadeia pela polimerase (PCR) e a reação de imunofluorescência indireta (RIFI). Houve positividade de todos os tecidos e o animal apresentou elevada carga parasitária. O título obtido na RIFI foi de 1:160. O animal foi negativo para os vírus da imunodeficiência felina (FIV) e da leucemia felina (FeLV). Este trabalho aborda o primeiro caso de leishmaniose felina no estado do Tocantins e revela dados que podem contribuir para o conhecimento da doença, visto que esta mostrou-se capaz de se desenvolver de forma rápida e fatal em filhotes, podendo infectar vários tecidos.


Assuntos
Feminino , Animais , Gatos , Doenças Parasitárias em Animais , Leishmaniose Visceral/diagnóstico , Leishmaniose Visceral/microbiologia , Leishmaniose Visceral/patologia , Leishmaniose Visceral/veterinária
6.
Ciênc. rural (Online) ; 47(3): 1-6, 2017. tab
Artigo em Inglês | VETINDEX | ID: biblio-1479890

Resumo

A direct search for parasites were used as the diagnostic test to determine the frequency of Leishmania spp. infection in dogs ( Canis lupus familiaris ) under veterinary clinical care in the city of Araguaína, Tocantins, Brazil. For this approach, lymph node cell samples were collected using needle aspiration from 649 dogs of different breeds and ages. Two hundred and sixty four (40.7%) dogs tested positive for amastigote forms of Leishmania spp. Furthermore, 202 (76.5%) dogs that tested positive showed some clinical sign of disease, while 62 (28.4%) dogs were asymptomatic. Dogs 2 years old or those that lived alongside poultry species in peri-domicile areas had a greater chance of infection (P 0.05). Our results revealed the importance of frequently monitoring leishmaniasis in dogs, and the need to train veterinary professionals who work in high-transmission areas on the clinical diagnosis of canine visceral leishmaniasis.


O objetivo deste estudo foi determinar a frequência de infecção por Leishmania spp. em cães ( Canis lupus familiaris ) da cidade de Araguaína, Tocantins, submetidos à atendimento clínico-veterinário, utilizando a pesquisa direta do parasito como forma de diagnóstico. A população estudada foi de 649 cães, de diferentes raças e idades, dos quais foi coletada uma amostra de células de linfonodo através de punção aspirativa. Entre os animais com exame positivo 202 (76,5%) apresentaram algum sinal clínico da doença e 62 (28,4%) animais animais assintomáticos apresentaram exames positivos. Animais com até dois anos de idade e que conviviam com galináceos no peridomicílio apresentaram maior chance de infecção (P 0,05). Os resultados demonstram a necessidade de vigilância constante dos animais em relação a leishmaniose e denota a importância do aperfeiçoamento dos profissionais veterinários, que atuam em áreas de transmissão intensa, para o diagnóstico clínico da leishmaniose visceral canina.


Assuntos
Animais , Cães , Cães , Leishmaniose Visceral , Morbidade , Transmissão de Doença Infecciosa , Análise Citogenética , Fatores de Risco , Prevenção de Doenças
7.
Ci. Rural ; 47(3): 1-6, 2017. tab
Artigo em Inglês | VETINDEX | ID: vti-686970

Resumo

A direct search for parasites were used as the diagnostic test to determine the frequency of Leishmania spp. infection in dogs ( Canis lupus familiaris ) under veterinary clinical care in the city of Araguaína, Tocantins, Brazil. For this approach, lymph node cell samples were collected using needle aspiration from 649 dogs of different breeds and ages. Two hundred and sixty four (40.7%) dogs tested positive for amastigote forms of Leishmania spp. Furthermore, 202 (76.5%) dogs that tested positive showed some clinical sign of disease, while 62 (28.4%) dogs were asymptomatic. Dogs 2 years old or those that lived alongside poultry species in peri-domicile areas had a greater chance of infection (P 0.05). Our results revealed the importance of frequently monitoring leishmaniasis in dogs, and the need to train veterinary professionals who work in high-transmission areas on the clinical diagnosis of canine visceral leishmaniasis. (AU)


O objetivo deste estudo foi determinar a frequência de infecção por Leishmania spp. em cães ( Canis lupus familiaris ) da cidade de Araguaína, Tocantins, submetidos à atendimento clínico-veterinário, utilizando a pesquisa direta do parasito como forma de diagnóstico. A população estudada foi de 649 cães, de diferentes raças e idades, dos quais foi coletada uma amostra de células de linfonodo através de punção aspirativa. Entre os animais com exame positivo 202 (76,5%) apresentaram algum sinal clínico da doença e 62 (28,4%) animais animais assintomáticos apresentaram exames positivos. Animais com até dois anos de idade e que conviviam com galináceos no peridomicílio apresentaram maior chance de infecção (P 0,05). Os resultados demonstram a necessidade de vigilância constante dos animais em relação a leishmaniose e denota a importância do aperfeiçoamento dos profissionais veterinários, que atuam em áreas de transmissão intensa, para o diagnóstico clínico da leishmaniose visceral canina. (AU)


Assuntos
Animais , Cães , Morbidade , Leishmaniose Visceral , Cães , Transmissão de Doença Infecciosa , Análise Citogenética , Fatores de Risco , Prevenção de Doenças
8.
R. bras. Reprod. Anim. ; 40(4): 431-432, Out-Dez. 2016. tab
Artigo em Português | VETINDEX | ID: vti-24284

Resumo

This study aimed to evaluate the effect of turn and type of birth on the behavior of the concentration ofglucose in Dorper lambs grazing in Piauí semiarid. 18 lambs were used in the Dorper, born aged twenty fourhours. For the evaluation of plasma concentrations of glucose, the animals were randomly distributed in shifts(day and night) and the type of birth (single and double). Blood samples were collected at 24 hours of elapsedtime after birth, soon after placed in tubes with sodium fluoride and taken to the Clinical Pathology Laboratoryof the University Veterinary Hospital - HVU, UFPI. Analysis of variance revealed a significant effect of theinteraction shift in the types of twin births (116.64 ± 6.28) on the concentration of plasma glucose. Theconclusion of this research was that the performance of twin lambs, is due to the amount of ingested colostrumdoes not depend directly on the amount of offspring or due to their own birth order.(AU)


Assuntos
Animais , Feminino , Ovinos/embriologia , Ovinos/fisiologia , Parto , Glucose/análise , Soro
9.
Rev. bras. reprod. anim ; 40(4): 431-432, Out-Dez. 2016. tab
Artigo em Português | VETINDEX | ID: biblio-1492330

Resumo

This study aimed to evaluate the effect of turn and type of birth on the behavior of the concentration ofglucose in Dorper lambs grazing in Piauí semiarid. 18 lambs were used in the Dorper, born aged twenty fourhours. For the evaluation of plasma concentrations of glucose, the animals were randomly distributed in shifts(day and night) and the type of birth (single and double). Blood samples were collected at 24 hours of elapsedtime after birth, soon after placed in tubes with sodium fluoride and taken to the Clinical Pathology Laboratoryof the University Veterinary Hospital - HVU, UFPI. Analysis of variance revealed a significant effect of theinteraction shift in the types of twin births (116.64 ± 6.28) on the concentration of plasma glucose. Theconclusion of this research was that the performance of twin lambs, is due to the amount of ingested colostrumdoes not depend directly on the amount of offspring or due to their own birth order.


Assuntos
Feminino , Animais , Glucose/análise , Ovinos/embriologia , Ovinos/fisiologia , Parto , Soro
10.
Semina Ci. agr. ; 36(4): 2661-2670, jul.-ago. 2015. tab
Artigo em Inglês | VETINDEX | ID: vti-30321

Resumo

The aim of this study was to evaluate the profile of antibiotic resistance in Salmonella isolated from the carcasses, livers and hearts of chickens slaughtered in the state of Tocantins, Brazil, as recommended by the Normative Instruction 70 of 2003 of the Ministry of Agriculture, Livestock and Food Supply and the National Monitoring Program Prevalence and Bacterial Resistance in Chicken. Carcasses, livers and hearts from chicken with or without pericarditis/perihepatitis were studied in 60 lots of poultry slaughtered under the Federal Inspection System in the state of Tocantins, Brazil between August 2010 and June 2011. Twenty-six indicative Salmonella sp. were isolated in 11 lots (18.33%). Different strains of Salmonella were isolated more than a kind of sample/lot. The most frequent serovar was Enteriditis (38.46%, 10/26), while the second was Mbandaka (19.23%, 5/26), both isolated from hearts, livers and carcasses. Regarding antimicrobial resistance, of 12 tested principal pharmacological agents, the samples appeared to be most sensitive to tetracyclines, but showed 100% resistance to one or more active principal agents, especially sulfamethoxazole (30 mcg) and amoxicillin/clavulanic acid (30 mcg). Although Salmonella sp. was isolated from normal carcasses, the results are within permitted levels for unfrozen products according to Brazilian legislation. However, one should...(AU)


Com o objetivo de observar os parâmetros estabelecidos pela Instrução Normativa 70 de 2003 do Ministério da Agricultura Pecuária e Abastecimento, juntamente com o Programa Nacional de Monitoramento da Prevalência e da Resistência Bacteriana em Frango, o qual prevê o monitoramento de Salmonella sp. em produtos de frangos resfriados, foram estudadas carcaças e miúdos comestíveis (fígados e coração), condenados ou não por pericardite/perihepatite, em 60 lotes de aves abatidos sob Sistema de Inspeção Federal no estado do Tocantins, entre agosto de 2010 a junho de 2011. Foram isoladas 26 amostras indicativas de Salmonella sp. em 11 lotes (18,33%), sendo mais de uma estirpe por tipo de amostra. Os sorovares de maior frequência foram o Enteriditis (38,46%; 10/26) e Mbandaka (19,23%; 5/26), ambos isolados de coração, fígado e carcaça. Quanto ao perfil de resistência aos antimicrobianos, foram testados 12 princípios farmacológicos e as amostras apresentaram-se diferenciadas em alguns aspectos do encontrado na literatura consultada, sendo a maioria sensível às tetraciclinas, porém apresentaram 100% de resistência a um ou mais principio ativo, principalmente para Sulfamethoxazole (30 mcg) e Amoxicilina/Ácido Clavulânico (30 mcg). Apesar da Salmonella sp. ter sido isolada em carcaças normais, os resultados encontram-se dentro do permitido pela legislação brasileira vigente para produtos...(AU)


Assuntos
Animais , Salmonella , Salmonelose Animal , Inspeção Sanitária , Doenças das Aves Domésticas
11.
Ciênc. anim. bras. (Impr.) ; 14(3): 366-372, jul.-set. 2013. ilus
Artigo em Português | VETINDEX | ID: biblio-1473263

Resumo

Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF-5'gcgctcaggctgccgacgcaa3' (cromóforo FAM) e BR-5'accagccattgcggtcggta3' para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10(3) bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 10(5) bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial.


This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10(3) bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.


Assuntos
Masculino , Animais , Bovinos , Análise do Sêmen/veterinária , Brucella/patogenicidade , Eletroforese Capilar/veterinária , Reação em Cadeia da Polimerase/veterinária
12.
Ci. Anim. bras. ; 14(3): 366-372, jul.-set. 2013. ilus
Artigo em Português | VETINDEX | ID: vti-32781

Resumo

Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF-5'gcgctcaggctgccgacgcaa3' (cromóforo FAM) e BR-5'accagccattgcggtcggta3' para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10(3) bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 10(5) bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial.(AU)


This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10(3) bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.(AU)


Assuntos
Animais , Masculino , Bovinos , Análise do Sêmen/veterinária , Brucella/patogenicidade , Reação em Cadeia da Polimerase/veterinária , Eletroforese Capilar/veterinária
13.
Vet. foco ; 6(2): 121-127, jan.-jun. 2009. ilus
Artigo em Português | VETINDEX | ID: biblio-1502769

Resumo

O bem-estar animal está difundido em todas as criações de animais incluindo as etapas de abate, onde se tem o “abate humanitário” que compreende desde o embarque dos animais na propriedade até a operação de sangria. Para se determinar se essas condições estão sendo aplicadas, pode-se avaliar a presença e classificação das contusões nas carcaças, pois estas podem indicar a ocorrência de problemas relacionados ao bem-estar animal. Desta forma, o presente trabalho objetivou avaliar as contusões em um grupo de animais abatidos em um frigorífico do Estado do Pará, verificando sua localização e classificação e relacionando-as com o bem-estar dos animais abatidos e a etapa do processo onde ocorreu o problema. De um total de 800 animais abatidos ao dia, foram selecionados, aleatoriamente, 400 animais divididos em dois grupos, sendo 200 machos e 200 fêmeas. Após a esfola dos animais, as contusões observadas foram registradas quanto à localização e classificadas de acordo com o tempo de aparecimento e grau da contusão. Foi observado que, dos 400 animais, 66% apresentaram contusões, sendo as fêmeas mais acometidas. A maior prevalência foi observada nos quartos, tanto nos machos como nas fêmeas, sendo que os quartos traseiros foram mais acometidos que os dianteiros. Quanto à extensão das lesões, não foram observadas lesões de grau III (que atingissem o tecido ósseo) e, segundo o tempo de aparecimento das contusões, todas foram classificadas como novas, apresentando coloração vermelho escuro e/ ou aspecto hemorrágico


Animal welfare is widespread in all the animal husbandry including the steps of slaughter, where it has the “humanitarian slaughter” that extends from the shipment of animals in the property until the operation of bleeding. To determine whether these conditions are being applied it is possible to assess the presence and contusions on the classification of carcasses because they may indicate the occurrence of problems related to animal welfare. Thus the present study aimed to evaluate the injuries found in a group of animals cattle slaughtered in an abattoir of the State of Pará – Brazil, described its location and classification as well as the relationship with the animal welfare and the stage of the phase in which the lesions occurred during the killing process. Of a total of 800 animals slaughtered a day, were selected at random, 400 animals divided into two groups with 200 males and 200 females. After the skinning of the animals observed injuries were recorded on location and classified according to the time of onset and degree of contusion. It was observed that of 400 animals, 66% had injuries, were the most frequent in both female cattle. As the extent of the injuries were not observed injuries at grade III and the second time of appearance of injuries, all were classified as new, displaying dark red in colour and / or appearance bleeding


Assuntos
Animais , Bem-Estar do Animal
14.
Vet. Foco ; 6(2): 121-127, jan.-jun. 2009. ilus
Artigo em Português | VETINDEX | ID: vti-3358

Resumo

O bem-estar animal está difundido em todas as criações de animais incluindo as etapas de abate, onde se tem o “abate humanitário” que compreende desde o embarque dos animais na propriedade até a operação de sangria. Para se determinar se essas condições estão sendo aplicadas, pode-se avaliar a presença e classificação das contusões nas carcaças, pois estas podem indicar a ocorrência de problemas relacionados ao bem-estar animal. Desta forma, o presente trabalho objetivou avaliar as contusões em um grupo de animais abatidos em um frigorífico do Estado do Pará, verificando sua localização e classificação e relacionando-as com o bem-estar dos animais abatidos e a etapa do processo onde ocorreu o problema. De um total de 800 animais abatidos ao dia, foram selecionados, aleatoriamente, 400 animais divididos em dois grupos, sendo 200 machos e 200 fêmeas. Após a esfola dos animais, as contusões observadas foram registradas quanto à localização e classificadas de acordo com o tempo de aparecimento e grau da contusão. Foi observado que, dos 400 animais, 66% apresentaram contusões, sendo as fêmeas mais acometidas. A maior prevalência foi observada nos quartos, tanto nos machos como nas fêmeas, sendo que os quartos traseiros foram mais acometidos que os dianteiros. Quanto à extensão das lesões, não foram observadas lesões de grau III (que atingissem o tecido ósseo) e, segundo o tempo de aparecimento das contusões, todas foram classificadas como novas, apresentando coloração vermelho escuro e/ ou aspecto hemorrágico(AU)


Animal welfare is widespread in all the animal husbandry including the steps of slaughter, where it has the “humanitarian slaughter” that extends from the shipment of animals in the property until the operation of bleeding. To determine whether these conditions are being applied it is possible to assess the presence and contusions on the classification of carcasses because they may indicate the occurrence of problems related to animal welfare. Thus the present study aimed to evaluate the injuries found in a group of animals cattle slaughtered in an abattoir of the State of Pará Brazil, described its location and classification as well as the relationship with the animal welfare and the stage of the phase in which the lesions occurred during the killing process. Of a total of 800 animals slaughtered a day, were selected at random, 400 animals divided into two groups with 200 males and 200 females. After the skinning of the animals observed injuries were recorded on location and classified according to the time of onset and degree of contusion. It was observed that of 400 animals, 66% had injuries, were the most frequent in both female cattle. As the extent of the injuries were not observed injuries at grade III and the second time of appearance of injuries, all were classified as new, displaying dark red in colour and / or appearance bleeding(AU)


Assuntos
Animais , Bem-Estar do Animal
15.
Braz. j. vet. res. anim. sci ; 43(3): 394-399, 2006. ilus, graf
Artigo em Português | VETINDEX | ID: vti-5715

Resumo

Este estudo pretendeu avaliar o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Leptospira pomona em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com Leptospira pomona em escalas que variavam de 10(elevado a 0) a 10(elevado a 7) bactérias/ml e submetidas à extração de DNA pelo método de fenol/clorofórmio. Após a reação de PCR, a visualização dos fragmentos foi realizada em três tipos de eletroforese: agarose 2% sob luz UV, acrilamida 8% corado com prata e eletroforese capilar fluorescente. A detecção de DNA de Leptospira pomona em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10(elevado a 2 )bactérias/ml. Nos métodos de eletroforese em agarose 2%, observou-se limite de detecção de 10(elevado a 4 )bactérias/ml e em gel de poliacrilamida 8% o limite de detecção foi de 10(elevado a 2 )bactérias/ml. A eletroforese capilar demonstrou ser uma alternativa eficaz e rápida na detecção de DNA de Leptospira em sêmen bovino podendo ser uma valiosa ferramenta para controle de qualidade do sêmen produzido em centrais de inseminação artificial dada a facilidade de automação desse processo.(AU)


This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Leptospira pomonadiagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with Leptospira pomona 10(involution 0) to 10(involution 7 ) bacteria/ml) and DNA was extracted by phenol/chloroform protocol. DNA fragments visualization was done by three electrophoresis methods: under UV light in 2 % agarose gel, silver staining 8% polyacrylamide gel and fluorescent capillary electrophoresis. The detection limit of capillary electrophoresis for Leptospira pomona was 10(involution 2) bacteria/ml. Under UV light, in 2 % agarose gel, the detection limit was of 10(involution 4) bacteria/ml while for silver stained 8 % polyacrylamide gel it was 10(involution 2) bacteria/ml. PCR with fluorescent capillary electrophoresis is an efficient andrapid diagnostic test for DNA detection of Leptospira in bovine semen and this can be an important tool for herd and semen sanitary controlin artificial insemination centers.(AU)


Assuntos
Animais , Masculino , Bovinos , Leptospira/isolamento & purificação , Eletroforese Capilar/métodos , Reação em Cadeia da Polimerase/métodos , Sêmen/fisiologia , Bovinos
16.
Semina ciênc. agrar ; 36(4): 2661-2670, 2015. tab
Artigo em Inglês | VETINDEX | ID: biblio-1500062

Resumo

The aim of this study was to evaluate the profile of antibiotic resistance in Salmonella isolated from the carcasses, livers and hearts of chickens slaughtered in the state of Tocantins, Brazil, as recommended by the Normative Instruction 70 of 2003 of the Ministry of Agriculture, Livestock and Food Supply and the National Monitoring Program Prevalence and Bacterial Resistance in Chicken. Carcasses, livers and hearts from chicken with or without pericarditis/perihepatitis were studied in 60 lots of poultry slaughtered under the Federal Inspection System in the state of Tocantins, Brazil between August 2010 and June 2011. Twenty-six indicative Salmonella sp. were isolated in 11 lots (18.33%). Different strains of Salmonella were isolated more than a kind of sample/lot. The most frequent serovar was Enteriditis (38.46%, 10/26), while the second was Mbandaka (19.23%, 5/26), both isolated from hearts, livers and carcasses. Regarding antimicrobial resistance, of 12 tested principal pharmacological agents, the samples appeared to be most sensitive to tetracyclines, but showed 100% resistance to one or more active principal agents, especially sulfamethoxazole (30 mcg) and amoxicillin/clavulanic acid (30 mcg). Although Salmonella sp. was isolated from normal carcasses, the results are within permitted levels for unfrozen products according to Brazilian legislation. However, one should...


Com o objetivo de observar os parâmetros estabelecidos pela Instrução Normativa 70 de 2003 do Ministério da Agricultura Pecuária e Abastecimento, juntamente com o Programa Nacional de Monitoramento da Prevalência e da Resistência Bacteriana em Frango, o qual prevê o monitoramento de Salmonella sp. em produtos de frangos resfriados, foram estudadas carcaças e miúdos comestíveis (fígados e coração), condenados ou não por pericardite/perihepatite, em 60 lotes de aves abatidos sob Sistema de Inspeção Federal no estado do Tocantins, entre agosto de 2010 a junho de 2011. Foram isoladas 26 amostras indicativas de Salmonella sp. em 11 lotes (18,33%), sendo mais de uma estirpe por tipo de amostra. Os sorovares de maior frequência foram o Enteriditis (38,46%; 10/26) e Mbandaka (19,23%; 5/26), ambos isolados de coração, fígado e carcaça. Quanto ao perfil de resistência aos antimicrobianos, foram testados 12 princípios farmacológicos e as amostras apresentaram-se diferenciadas em alguns aspectos do encontrado na literatura consultada, sendo a maioria sensível às tetraciclinas, porém apresentaram 100% de resistência a um ou mais principio ativo, principalmente para Sulfamethoxazole (30 mcg) e Amoxicilina/Ácido Clavulânico (30 mcg). Apesar da Salmonella sp. ter sido isolada em carcaças normais, os resultados encontram-se dentro do permitido pela legislação brasileira vigente para produtos...


Assuntos
Animais , Doenças das Aves Domésticas , Inspeção Sanitária , Salmonella , Salmonelose Animal
17.
Semina Ci. agr. ; 40(4): 1723-1730, 2019.
Artigo em Inglês | VETINDEX | ID: vti-762998

Resumo

Visceral leishmaniasis (VL) is expanding in the Brazilian territory. Dogs are considered an important urban reservoir; however, studies have demonstrated the presence of infected cats in some Brazilian states. This report aimed to describe a case of Leishmania (Leishmania) infantum infection in a two-month-old domestic feline from a Brazilian region with a high incidence of human visceral leishmaniasis. The analyzed samples were the cat’s blood, conjunctiva, spleen, liver, popliteal, submandibular and mesenteric lymph nodes, skin, lung and kidney. The diagnostic methods were: parasitological examination, polymerase chain reaction (PCR) and an immunoflurescence antibody test (IFAT). All tissues were positive. The title obtained using the IFAT was 1:160. The animal was negative for feline immunodeficiency virus (FIV) and feline leukemia virus (FeLV). This work addresses the first case of feline leishmaniasis in the state of Tocantins, and reveals data that may contribute to the knowledge of the disease, since it has been shown to be able to develop rapidly and fatally in kittens, with the ability to infect several tissues.


A leishmaniose visceral (LV) encontra-se em expansão no território brasileiro. O cão é considerado um importante reservatório urbano, no entanto, estudos tem demonstrado a presença de felinos infectados em alguns estados brasileiros. Este relato objetivou descrever um caso de infecção por Leishmania (Leishmania) infantum em um felino doméstico de dois meses proveniente de uma região brasileira com alta incidência de leishmaniose visceral humana. As amostras analisadas foram sangue, conjuntiva, baço, fígado, linfonodos poplíteo, submandibular e mesentérico, pele, pulmão e rim. Os métodos de diagnóstico utilizados foram: o exame parasitológico direto, a reação em cadeia pela polimerase (PCR) e a reação de imunofluorescência indireta (RIFI). Houve positividade de todos os tecidos e o animal apresentou elevada carga parasitária. O título obtido na RIFI foi de 1:160. O animal foi negativo para os vírus da imunodeficiência felina (FIV) e da leucemia felina (FeLV). Este trabalho aborda o primeiro caso de leishmaniose felina no estado do Tocantins e revela dados que podem contribuir para o conhecimento da doença, visto que esta mostrou-se capaz de se desenvolver de forma rápida e fatal em filhotes, podendo infectar vários tecidos.

18.
Semina Ci. agr. ; 40(4): 1723-1730, 2019.
Artigo em Inglês | VETINDEX | ID: vti-762429

Resumo

Visceral leishmaniasis (VL) is expanding in the Brazilian territory. Dogs are considered an important urban reservoir; however, studies have demonstrated the presence of infected cats in some Brazilian states. This report aimed to describe a case of Leishmania (Leishmania) infantum infection in a two-month-old domestic feline from a Brazilian region with a high incidence of human visceral leishmaniasis. The analyzed samples were the cat’s blood, conjunctiva, spleen, liver, popliteal, submandibular and mesenteric lymph nodes, skin, lung and kidney. The diagnostic methods were: parasitological examination, polymerase chain reaction (PCR) and an immunoflurescence antibody test (IFAT). All tissues were positive. The title obtained using the IFAT was 1:160. The animal was negative for feline immunodeficiency virus (FIV) and feline leukemia virus (FeLV). This work addresses the first case of feline leishmaniasis in the state of Tocantins, and reveals data that may contribute to the knowledge of the disease, since it has been shown to be able to develop rapidly and fatally in kittens, with the ability to infect several tissues.


A leishmaniose visceral (LV) encontra-se em expansão no território brasileiro. O cão é considerado um importante reservatório urbano, no entanto, estudos tem demonstrado a presença de felinos infectados em alguns estados brasileiros. Este relato objetivou descrever um caso de infecção por Leishmania (Leishmania) infantum em um felino doméstico de dois meses proveniente de uma região brasileira com alta incidência de leishmaniose visceral humana. As amostras analisadas foram sangue, conjuntiva, baço, fígado, linfonodos poplíteo, submandibular e mesentérico, pele, pulmão e rim. Os métodos de diagnóstico utilizados foram: o exame parasitológico direto, a reação em cadeia pela polimerase (PCR) e a reação de imunofluorescência indireta (RIFI). Houve positividade de todos os tecidos e o animal apresentou elevada carga parasitária. O título obtido na RIFI foi de 1:160. O animal foi negativo para os vírus da imunodeficiência felina (FIV) e da leucemia felina (FeLV). Este trabalho aborda o primeiro caso de leishmaniose felina no estado do Tocantins e revela dados que podem contribuir para o conhecimento da doença, visto que esta mostrou-se capaz de se desenvolver de forma rápida e fatal em filhotes, podendo infectar vários tecidos.

19.
Jaboticabal; s.n; 2005. 64 p.
Tese em Português | VETTESES | ID: vtt-12181

Resumo

pt

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA