Selection and characterization of peptides mimetic to Campylobacter fetus subsp. venerealis using phage display / Seleção e caracterização de peptídeos miméticos a Campylobacter fetus subsp. venerealis usando phage display

Bovine genital campylobacteriosis (BGC) is a venereal and subclinical disease that affects the fertility of cattle herds, and it is caused by Campylobacter fetus subsp. venerealis . This study selected peptides mimetic to the BGC-causing agent from a phage library. Phage display is a technique that applies bacteriophage libraries that reveal peptides fused to the viral capsid in biological selections against target proteins. Biopannings were performed for biological selection in the phage library using rabbit hyperimmune serum and C. fetus subsp. venerealis protein extract. Five selected heptapeptides were considered mimetic to Cfv-NCTC 10354 based on the results of bioinformatics analysis and assays with hyperimmune serum and cervicovaginal mucus obtained from heifers. ALASLPL and LSYLFPP were the most reactive peptides and considered promising as possible mimetic immunogens for C. fetus subsp. venerealis.

Campilobacteriose Genital Bovina (CGB) é uma doença venérea e subclínica que causa problemas reprodutivos em rebanhos, causada por Campylobacter fetus subsp. venerealis. Este trabalho teve como objetivo selecionar peptídeos miméticos ao agente da CGB de uma biblioteca de fagos. Phage display é uma técnica que aplica bibliotecas de bacteriófagos que expõem peptídeos fusionados ao capsídeo viral em seleções biológicas contra proteínas alvo. Biopannings foram realizados para seleção biológica na biblioteca de fagos por meio de soro hiperimune de coelho e extrato proteico de C. fetus subsp. venerealis. Cinco heptapeptídeos selecionados foram considerados miméticos para Cfv-NCTC 10354 a partir de análises de bioinformática e ensaios com soro hiperimune e muco cérvico-vaginal de novilhas. ALASLPL e LSYLFPP foram os peptídeos mais reativos e considerados promissores como possíveis imunógenos miméticos para C. fetus subsp. venerealis.

Campylobacter fetus in abomasal fluid from spontaneously aborted bovine and ovine fetuses

Pregnancy losses are a major concern in livestock industry due to their economic impact on producers. Campylobacter fetus subspecies fetus (Cff) and C. fetus subspecies venerealis (Cfv) are directly related to reproductive failures in ruminants. Cff colonizes the gastrointestinal tract of a wide range of hosts leading to abortion, while Cfv is restricted to genital tract being generally associated to infertility in bovine. Considering the great economic losses related to campylobacteriosis in cattle and ovine herds, this study aims to investigate the occurrence of C. fetus, considering Cff and Cfv subspecies, in bovine and ovine spontaneously aborted fetuses in state of Rio Grande do Sul, Brazil. In this study, samples of abomasal fluid collected from 30 spontaneously aborted bovine (n = 18) and ovine (n = 12) fetuses were investigated for the detection of Campylobacter fetus throughout conventional PCR. Positive fetuses for C. fetus presence were further analyzed by molecular assays for Cff and Cfv detection, in order to determine subspecies identification. When available, samples of the main organs of the thoracic and abdominal cavities, as well as the brain, skeletal muscle, eyelid, skin, and placenta were collected for further histopathological analyses and bacterial culture, aiming to assess the presence of infection lesions and pathogens in those sites, respectively. Additionally, RT-qPCR assays were also performed for the detection of ruminant pestivirus, in order to detect bovine viral diarrhea cases. Throughout the present methodology, C. fetus was detected in the abomasal fluid samples of 2 bovine fetuses, being both identified as Cfv subspecies by PCR. Histopathological analyses demonstrated that macroscopic and microscopic changes found in the Cfv-positive animals were not either specific or directly related to Campylobacter infections. Moreover, no significant bacterial growth was observed in microbiological culture from the collected tissues, and both fetuses were negative for ruminant pestivirus. Differently, there was no detection of C. fetus in any of the analyzed ovine fetuses. Considering that abortion diagnosis rates reported in cattle and sheep industry are highly variable among the published studies, and that abortion diagnoses are commonly inconclusive due to difficulties in sampling methodology and inadequate identification of the pathogen involved, it is important to investigate the etiological causes of abortion the herds for better understanding the causes of pregnancy issues and monitoring their occurrence. In addition, the absence of pathognomonic lesions in the tissues investigated in the histopathological analyses observed in this study strongly suggests that well-known etiological agents commonly associated to abortion, such as Leptospira spp., Toxoplasma spp., Chlamydia spp. and Neospora caninum, are unlikely to be the cause of infection of the analyzed fetuses. Taking this into account, the presence of C. fetus in the abomasal fluid samples from two bovine fetuses demonstrated in the present study suggests the possible association of Cfv not only with infertility, but also with cases of bovine abortion, highlighting the importance of investigating unusual causal agents of abortions in sheep and cattle. Overall, an adequate diagnosis is essential for establishing better prevention strategies to avoid the circulation of abortion-related infectious agents in the herds.(AU)

Selection and characterization of peptides mimetic to Campylobacter fetus subsp. venerealis using phage display / Seleção e caracterização de peptídeos miméticos a Campylobacter fetus subsp. venerealis usando phage display

ABSTRACT: Bovine genital campylobacteriosis (BGC) is a venereal and subclinical disease that affects the fertility of cattle herds, and it is caused by Campylobacter fetus subsp. venerealis . This study selected peptides mimetic to the BGC-causing agent from a phage library. Phage display is a technique that applies bacteriophage libraries that reveal peptides fused to the viral capsid in biological selections against target proteins. Biopannings were performed for biological selection in the phage library using rabbit hyperimmune serum and C. fetus subsp. venerealis protein extract. Five selected heptapeptides were considered mimetic to Cfv-NCTC 10354 based on the results of bioinformatics analysis and assays with hyperimmune serum and cervicovaginal mucus obtained from heifers. ALASLPL and LSYLFPP were the most reactive peptides and considered promising as possible mimetic immunogens for C. fetus subsp. venerealis.

RESUMO: Campilobacteriose Genital Bovina (CGB) é uma doença venérea e subclínica que causa problemas reprodutivos em rebanhos, causada por Campylobacter fetus subsp. venerealis. Este trabalho teve como objetivo selecionar peptídeos miméticos ao agente da CGB de uma biblioteca de fagos. Phage display é uma técnica que aplica bibliotecas de bacteriófagos que expõem peptídeos fusionados ao capsídeo viral em seleções biológicas contra proteínas alvo. Biopannings foram realizados para seleção biológica na biblioteca de fagos por meio de soro hiperimune de coelho e extrato proteico de C. fetus subsp. venerealis. Cinco heptapeptídeos selecionados foram considerados miméticos para Cfv-NCTC 10354 a partir de análises de bioinformática e ensaios com soro hiperimune e muco cérvico-vaginal de novilhas. ALASLPL e LSYLFPP foram os peptídeos mais reativos e considerados promissores como possíveis imunógenos miméticos para C. fetus subsp. venerealis.

Selection and characterization of peptides mimetic to Campylobacter fetus subsp. venerealis using phage display / Seleção e caracterização de peptídeos miméticos a Campylobacter fetus subsp. venerealis usando phage display

Bovine genital campylobacteriosis (BGC) is a venereal and subclinical disease that affects the fertility of cattle herds, and it is caused by Campylobacter fetus subsp. venerealis . This study selected peptides mimetic to the BGC-causing agent from a phage library. Phage display is a technique that applies bacteriophage libraries that reveal peptides fused to the viral capsid in biological selections against target proteins. Biopannings were performed for biological selection in the phage library using rabbit hyperimmune serum and C. fetus subsp. venerealis protein extract. Five selected heptapeptides were considered mimetic to Cfv-NCTC 10354 based on the results of bioinformatics analysis and assays with hyperimmune serum and cervicovaginal mucus obtained from heifers. ALASLPL and LSYLFPP were the most reactive peptides and considered promising as possible mimetic immunogens for C. fetus subsp. venerealis.(AU)

Campilobacteriose Genital Bovina (CGB) é uma doença venérea e subclínica que causa problemas reprodutivos em rebanhos, causada por Campylobacter fetus subsp. venerealis. Este trabalho teve como objetivo selecionar peptídeos miméticos ao agente da CGB de uma biblioteca de fagos. Phage display é uma técnica que aplica bibliotecas de bacteriófagos que expõem peptídeos fusionados ao capsídeo viral em seleções biológicas contra proteínas alvo. Biopannings foram realizados para seleção biológica na biblioteca de fagos por meio de soro hiperimune de coelho e extrato proteico de C. fetus subsp. venerealis. Cinco heptapeptídeos selecionados foram considerados miméticos para Cfv-NCTC 10354 a partir de análises de bioinformática e ensaios com soro hiperimune e muco cérvico-vaginal de novilhas. ALASLPL e LSYLFPP foram os peptídeos mais reativos e considerados promissores como possíveis imunógenos miméticos para C. fetus subsp. venerealis.(AU)

Chemotactic behavior of Campylobacter fetus subspecies towards cervical mucus, bovine placenta and selected substances and ion

Abstract The chemotaxis of C. fetus subsp. venerealis and C. fetus subsp. fetus was determined in the presence of bovine cervical mucus and bovine placental extract. Some reported substances and ion in those materials, such amino acids, ferrous iron, hormones, sugars and organic acids were also investigated. Bovine cervical mucus, bovine placenta extracts and some substances and ion of these materials namely L-fucose, L- aspartate, L-glutamate, L-serine, ferrous iron, fumarate, pyruvate and succinate were chemoattractants. The chemottraction was significantly larger in higher concentrations of the tested substances and ion and significant differences among tested strains were also observed. Meso-erythritol and hormones bovine placental lactogen, 17β-estradiol, and progesterone did not elicit chemotactical response. In conclusion, this chemotactic behavior may guide the C. fetus navigation in the bovine host's genital tract and be an important cofactor of tissue tropism for this bacterium.

Chemotactic behavior of Campylobacter fetus subspecies towards cervical mucus, bovine placenta and selected substances and ion

The chemotaxis of C. fetus subsp. venerealis and C. fetus subsp. fetus was determined in the presence of bovine cervical mucus and bovine placental extract. Some reported substances and ion in those materials, such amino acids, ferrous iron, hormones, sugars and organic acids were also investigated. Bovine cervical mucus, bovine placenta extracts and some substances and ion of these materials namely L–fucose, Laspartate, L–glutamate, L–serine, ferrous iron, fumarate, pyruvate and succinate were chemoattractants. The chemottraction was significantly larger in higher concentrations of the tested substances and ion and significant differences among tested strains were also observed. Meso-erythritol and hormones bovine placental lactogen, 17β-estradiol, and progesterone did not elicit chemotactical response. In conclusion, this chemotactic behavior may guide the C. fetus navigation in the bovine host's genital tract and be an important cofactor of tissue tropism for this bacterium.(AU)

Maintenance of strains of Campylobacter jejuni in laboratories after use of cryoprotectors and pre-treatment of stress / Manutenção de cepas de Campylobacter jejuni em laboratório após uso de crioprotetores e pré-tratamento de estresse

This study evaluated the feasibility and the production of transcripts of sodB, p19, ciaB and dnaJ genes in strains of Campylobacter jejuni ATCC 33291, NCTC 11351, and 2383 IAL stored in whole UHT milk and or neopepton + 12% glycerol, submitted or not to pre-treatments at 4°C or 10°C for 30 minutes. The analyzes were performed immediately after freezing in liquid nitrogen (day 0) and after maintenance for 30, 60, and 90 days at -20ºC. The viability was evaluated by the traditional culture method and the production of transcripts by the RT-PCR technique. The quantification was only possible on the first day of analysis (day 0) and presented a mean of 3.0 x 107 CFU, and in the other periods of storage the strains presented confluent growth, not allowing their enumeration. The results indicated that whole UHT milk was more adequate for cryopreservation than the use of neopepton + 12% glycerol. The use of pre-treatments combined with the use of UHT milk as a cryoprotective medium stabilized the cells in order to transcribe the ciaB, dnaJ, sodBand p19 genes in the strains maintained under -20 ° for 30 to 60 days, indicating that they are more suitable methods for the maintenance of strains in the laboratory.

Este estudo avaliou a viabilidade e a produção de transcritos dos genes sodB, p19, ciaB e dnaJ em cepas de Campylobacter jejuni ATCC 33291, NCTC 11351 e 2383 IAL armazenadas em leite integral UHT e / ou neopeptona + 12% glicerol, submetidas ou não a pré-tratamentos a 4°C ou 10°C durante 30 minutos. As análises foram realizadas imediatamente após o congelamento em nitrogênio líquido (dia 0) e após a manutenção por 30, 60 e 90 dias à -20ºC. A viabilidade foi avaliada pelo método tradicional de cultura e a produção de transcritos, pela técnica de RT-PCR. A quantificação só foi possível no primeiro dia de análise (dia 0) e apresentou uma média de 3,0 x 107 UFC, e nos demais períodos de armazenamento as cepas apresentaram crescimento confluente, não permitindo sua enumeração. Os resultados indicaram que o leite integral UHT foi mais adequado para criopreservação em relação ao uso de neopeptona + 12% glicerol. A utilização de pré-tratamentos combinados com o uso de leite UHT como meio crioprotetor estabilizou as células para transcrever os genes ciaB, dnaJ, sodB e p19 nas cepas mantidas abaixo de -20° por 30 a 60 dias, indicando que são métodos mais adequados para a manutenção de cepas em laboratório.

Maintenance of strains of Campylobacter jejuni in laboratories after use of cryoprotectors and pre-treatment of stress / Manutenção de cepas de Campylobacter jejuni em laboratório após uso de crioprotetores e pré-tratamento de estresse

This study evaluated the feasibility and the production of transcripts of sodB, p19, ciaB and dnaJ genes in strains of Campylobacter jejuni ATCC 33291, NCTC 11351, and 2383 IAL stored in whole UHT milk and or neopepton + 12% glycerol, submitted or not to pre-treatments at 4°C or 10°C for 30 minutes. The analyzes were performed immediately after freezing in liquid nitrogen (day 0) and after maintenance for 30, 60, and 90 days at -20ºC. The viability was evaluated by the traditional culture method and the production of transcripts by the RT-PCR technique. The quantification was only possible on the first day of analysis (day 0) and presented a mean of 3.0 x 107 CFU, and in the other periods of storage the strains presented confluent growth, not allowing their enumeration. The results indicated that whole UHT milk was more adequate for cryopreservation than the use of neopepton + 12% glycerol. The use of pre-treatments combined with the use of UHT milk as a cryoprotective medium stabilized the cells in order to transcribe the ciaB, dnaJ, sodBand p19 genes in the strains maintained under -20 ° for 30 to 60 days, indicating that they are more suitable methods for the maintenance of strains in the laboratory.(AU)

Este estudo avaliou a viabilidade e a produção de transcritos dos genes sodB, p19, ciaB e dnaJ em cepas de Campylobacter jejuni ATCC 33291, NCTC 11351 e 2383 IAL armazenadas em leite integral UHT e / ou neopeptona + 12% glicerol, submetidas ou não a pré-tratamentos a 4°C ou 10°C durante 30 minutos. As análises foram realizadas imediatamente após o congelamento em nitrogênio líquido (dia 0) e após a manutenção por 30, 60 e 90 dias à -20ºC. A viabilidade foi avaliada pelo método tradicional de cultura e a produção de transcritos, pela técnica de RT-PCR. A quantificação só foi possível no primeiro dia de análise (dia 0) e apresentou uma média de 3,0 x 107 UFC, e nos demais períodos de armazenamento as cepas apresentaram crescimento confluente, não permitindo sua enumeração. Os resultados indicaram que o leite integral UHT foi mais adequado para criopreservação em relação ao uso de neopeptona + 12% glicerol. A utilização de pré-tratamentos combinados com o uso de leite UHT como meio crioprotetor estabilizou as células para transcrever os genes ciaB, dnaJ, sodB e p19 nas cepas mantidas abaixo de -20° por 30 a 60 dias, indicando que são métodos mais adequados para a manutenção de cepas em laboratório.(AU)

Detecção de Campylobacter jejuni em produtos de frango utilizando separação imunomagnética / Detection of Campylobacter jejuni in chicken products using immunomagnetic separation

Campylobacter jejuni é o principal causador de gastroenterite bacteriana aguda, e a carne de frango tem se mostrado uma importante fonte de transmissão. Este microrganismo é de difícil isolamento e os métodos convencionais muitas vezes não são eficientes, podendo levar a resultados errôneos. O objetivo deste trabalho foi desenvolver e testar a técnica de separação imunomagnética (IMS) na detecção de C. jejuni em produtos de frango. Micropartículas magnéticas ligadas a anticorpos policlonais anti-C. jejuni foram utilizadas para concentrar C. jejuni antes da semeadura em ágar. O protocolo foi comparado com o método convencional. C. jejuni foi recuperado do alimento experimentalmente contaminado por ambos os métodos, entretanto, quando foi usada a IMS, a presença de microrganismos contaminantes nos meios de cultura foi menor. C. jejuni foi isolado de 7% das amostras de alimento naturalmente contaminadas, usando IMS, e de 3% pelo método convencional. C. coli foi isolado de uma amostra pelo método convencional, mas não foi detectado pelo protocolo com IMS. A técnica de IMS pode ser usada para isolamento de C. jejuni de alimentos, oferecendo a vantagem de detectar em amostras o microrganismo cujo isolamento não é obtido por meio do método convencional.(AU)

Campylobacter jejuni is the main cause of acute bacterial gastroenteritis and chicken meat has shown to be an important source of infection. This microorganism is difficult to isolate and the conventional methods are often inefficient and may lead to erroneous results. This study aimed at developing and testing the technique of immunomagnetic separation (IMS) in the detection of C. jejuni in chicken products. Microparticles magnetically connected anti-C. jejuni polyclonal antibodies were used to concentrate C. jejuni before agar seeding. The protocol was compared with the conventional method. C. jejuni was recovered from experimentally contaminated food for both methods, however, when the IMS was used, the presence of contaminating microorganisms in the means of culture was smaller. C. jejuni was isolated from 7% of samples of food naturally contaminated, using IMS, and 3% by conventional method. C. coli was isolated from a sample by conventional method, but it was not detected by protocol with IMS. The IMS technique can be used for isolation of C. jejuni in food, offering the advantage of detecting the microorganism in samples from which the isolation is not obtained with the use of the conventional method.(AU)

Detecção de Campylobacter jejuni em produtos de frango utilizando separação imunomagnética / Detection of Campylobacter jejuni in chicken products using immunomagnetic separation

Campylobacter jejuni é o principal causador de gastroenterite bacteriana aguda, e a carne de frango tem se mostrado uma importante fonte de transmissão. Este microrganismo é de difícil isolamento e os métodos convencionais muitas vezes não são eficientes, podendo levar a resultados errôneos. O objetivo deste trabalho foi desenvolver e testar a técnica de separação imunomagnética (IMS) na detecção de C. jejuni em produtos de frango. Micropartículas magnéticas ligadas a anticorpos policlonais anti-C. jejuni foram utilizadas para concentrar C. jejuni antes da semeadura em ágar. O protocolo foi comparado com o método convencional. C. jejuni foi recuperado do alimento experimentalmente contaminado por ambos os métodos, entretanto, quando foi usada a IMS, a presença de microrganismos contaminantes nos meios de cultura foi menor. C. jejuni foi isolado de 7% das amostras de alimento naturalmente contaminadas, usando IMS, e de 3% pelo método convencional. C. coli foi isolado de uma amostra pelo método convencional, mas não foi detectado pelo protocolo com IMS. A técnica de IMS pode ser usada para isolamento de C. jejuni de alimentos, oferecendo a vantagem de detectar em amostras o microrganismo cujo isolamento não é obtido por meio do método convencional.(AU)

Campylobacter jejuni is the main cause of acute bacterial gastroenteritis and chicken meat has shown to be an important source of infection. This microorganism is difficult to isolate and the conventional methods are often inefficient and may lead to erroneous results. This study aimed at developing and testing the technique of immunomagnetic separation (IMS) in the detection of C. jejuni in chicken products. Microparticles magnetically connected anti-C. jejuni polyclonal antibodies were used to concentrate C. jejuni before agar seeding. The protocol was compared with the conventional method. C. jejuni was recovered from experimentally contaminated food for both methods, however, when the IMS was used, the presence of contaminating microorganisms in the means of culture was smaller. C. jejuni was isolated from 7% of samples of food naturally contaminated, using IMS, and 3% by conventional method. C. coli was isolated from a sample by conventional method, but it was not detected by protocol with IMS. The IMS technique can be used for isolation of C. jejuni in food, offering the advantage of detecting the microorganism in samples from which the isolation is not obtained with the use of the conventional method.(AU)

Campylobacter jejuni and Campylobacter coli originated from chicken carcasses modulate their transcriptome to translate virulence genes in human cells / Campylobacter jejuni e Campylobacter coli originadas de carcaças de frango modulam seu transcriptoma para traduzir genes de virulência em células humanas

The aim was to determine the spread of genetically similar profiles of Campylobacter in chicken carcasses and evaluate their ability to produce transcripts for ciaB, dnaJ, p19 and sodB genes, before and after cultivation in Caco-2 cells. The strains used were isolated from 420 samples of chicken carcasses chilled and frozen ready for marketing. The species were identified by PCR-multiplex, the phylogeny was determined by RAPD-PCR and the presence of transcripts was performed by RT-PCR. We identified 74 (17.6%) of Campylobacter strains, being 55 (74.3%) C. jejuni and 19 (25.7%) C. coli. The phylogenetic relationship demonstrated heterogeneity between isolates of the same species, with absence of clones, indicating the high level of diversity of circulating genotypes. The gene transcription showed conflicting results before and after the culture in Caco-2 cell, so that before cultivation isolates showed greater capacity to transcribe genes related to survival and after the interaction with human cells, the strains showed higher potential to transcribe genes associated with virulence. The result of this study contributes to the understanding of how these seemingly fragile microorganisms are the most prevalent bacterial agents in human gastroenteritis.(AU)

O objetivo foi determinar a disseminação de perfis geneticamente semelhantes de Campylobacter em carcaças de frango e avaliar sua capacidade de produzir transcritos para os genes ciaB, dnaJ, p19 e sodB, antes e após o cultivo em células Caco-2. As cepas utilizadas foram isoladas de 420 amostras de carcaças de frango resfriadas e congeladas prontas para comercialização. As espécies foram identificadas por PCR-multiplex, a filogenia foi determinada por RAPD-PCR e a presença de transcritos foi realizada por RT-PCR. Identificamos 74 (17,6%) das cepas de Campylobacter, sendo 55 (74,3%) C. jejuni e 19 (25,7%) C. coli. A relação filogenética demonstrou heterogeneidade entre isolados da mesma espécie, com ausência de clones, indicando o alto nível de diversidade dos genótipos circulantes. A transcrição gênica mostrou resultados conflitantes antes e após a cultura em células Caco-2, de modo que, antes do cultivo, os isolados apresentaram maior capacidade de transcrever genes relacionados à sobrevivência e após a interação com células humanas, as linhagens apresentaram maior potencial para transcrever genes associados à virulência. O resultado deste estudo contribui para a compreensão de como esses microrganismos aparentemente frágeis são os agentes bacterianos mais prevalentes na gastroenterite humana.(AU)

Campylobacter jejuni and Campylobacter coli originated from chicken carcasses modulate their transcriptome to translate virulence genes in human cells / Campylobacter jejuni e Campylobacter coli originadas de carcaças de frango modulam seu transcriptoma para traduzir genes de virulência em células humanas

The aim was to determine the spread of genetically similar profiles of Campylobacter in chicken carcasses and evaluate their ability to produce transcripts for ciaB, dnaJ, p19 and sodB genes, before and after cultivation in Caco-2 cells. The strains used were isolated from 420 samples of chicken carcasses chilled and frozen ready for marketing. The species were identified by PCR-multiplex, the phylogeny was determined by RAPD-PCR and the presence of transcripts was performed by RT-PCR. We identified 74 (17.6%) of Campylobacter strains, being 55 (74.3%) C. jejuni and 19 (25.7%) C. coli. The phylogenetic relationship demonstrated heterogeneity between isolates of the same species, with absence of clones, indicating the high level of diversity of circulating genotypes. The gene transcription showed conflicting results before and after the culture in Caco-2 cell, so that before cultivation isolates showed greater capacity to transcribe genes related to survival and after the interaction with human cells, the strains showed higher potential to transcribe genes associated with virulence. The result of this study contributes to the understanding of how these seemingly fragile microorganisms are the most prevalent bacterial agents in human gastroenteritis.(AU)

O objetivo foi determinar a disseminação de perfis geneticamente semelhantes de Campylobacter em carcaças de frango e avaliar sua capacidade de produzir transcritos para os genes ciaB, dnaJ, p19 e sodB, antes e após o cultivo em células Caco-2. As cepas utilizadas foram isoladas de 420 amostras de carcaças de frango resfriadas e congeladas prontas para comercialização. As espécies foram identificadas por PCR-multiplex, a filogenia foi determinada por RAPD-PCR e a presença de transcritos foi realizada por RT-PCR. Identificamos 74 (17,6%) das cepas de Campylobacter, sendo 55 (74,3%) C. jejuni e 19 (25,7%) C. coli. A relação filogenética demonstrou heterogeneidade entre isolados da mesma espécie, com ausência de clones, indicando o alto nível de diversidade dos genótipos circulantes. A transcrição gênica mostrou resultados conflitantes antes e após a cultura em células Caco-2, de modo que, antes do cultivo, os isolados apresentaram maior capacidade de transcrever genes relacionados à sobrevivência e após a interação com células humanas, as linhagens apresentaram maior potencial para transcrever genes associados à virulência. O resultado deste estudo contribui para a compreensão de como esses microrganismos aparentemente frágeis são os agentes bacterianos mais prevalentes na gastroenterite humana.(AU)

Campylobacter jejuni and Campylobacter coli originated from chicken carcasses modulate their transcriptome to translate virulence genes in human cells

ABSTRACT: The aim was to determine the spread of genetically similar profiles of Campylobacter in chicken carcasses and evaluate their ability to produce transcripts for ciaB, dnaJ, p19 and sodB genes, before and after cultivation in Caco-2 cells. The strains used were isolated from 420 samples of chicken carcasses chilled and frozen ready for marketing. The species were identified by PCR-multiplex, the phylogeny was determined by RAPD-PCR and the presence of transcripts was performed by RT-PCR. We identified 74 (17.6%) of Campylobacter strains, being 55 (74.3%) C. jejuni and 19 (25.7%) C. coli. The phylogenetic relationship demonstrated heterogeneity between isolates of the same species, with absence of clones, indicating the high level of diversity of circulating genotypes. The gene transcription showed conflicting results before and after the culture in Caco-2 cell, so that before cultivation isolates showed greater capacity to transcribe genes related to survival and after the interaction with human cells, the strains showed higher potential to transcribe genes associated with virulence. The result of this study contributes to the understanding of how these seemingly fragile microorganisms are the most prevalent bacterial agents in human gastroenteritis.

RESUMO: O objetivo foi determinar a disseminação de perfis geneticamente semelhantes de Campylobacter em carcaças de frango e avaliar sua capacidade de produzir transcritos para os genes ciaB, dnaJ, p19 e sodB, antes e após o cultivo em células Caco-2. As cepas utilizadas foram isoladas de 420 amostras de carcaças de frango resfriadas e congeladas prontas para comercialização. As espécies foram identificadas por PCR-multiplex, a filogenia foi determinada por RAPD-PCR e a presença de transcritos foi realizada por RT-PCR. Identificamos 74 (17,6%) das cepas de Campylobacter, sendo 55 (74,3%) C. jejuni e 19 (25,7%) C. coli. A relação filogenética demonstrou heterogeneidade entre isolados da mesma espécie, com ausência de clones, indicando o alto nível de diversidade dos genótipos circulantes. A transcrição gênica mostrou resultados conflitantes antes e após a cultura em células Caco-2, de modo que, antes do cultivo, os isolados apresentaram maior capacidade de transcrever genes relacionados à sobrevivência e após a interação com células humanas, as linhagens apresentaram maior potencial para transcrever genes associados à virulência. O resultado deste estudo contribui para a compreensão de como esses microrganismos aparentemente frágeis são os agentes bacterianos mais prevalentes na gastroenterite humana.

Prevalence of Campylobacter fetus subsp. venerealis in dairy cows from Brejo Paraibano, Brazil

Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil.Materials, Methods & Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction was used for laboratory diagnosis using the oligonucleotides VENSF1 (5’CTTAGCAGTTTGCGATATTGCCATT3’) and VENS2 (5’GCTTTTGAGATAACAATAAGAGCTT3’) for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years.[...]

Prevalence of Campylobacter fetus subsp. venerealis in dairy cows from Brejo Paraibano, Brazil

Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil.Materials, Methods & Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction was used for laboratory diagnosis using the oligonucleotides VENSF1 (5CTTAGCAGTTTGCGATATTGCCATT3) and VENS2 (5GCTTTTGAGATAACAATAAGAGCTT3) for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years.[...](AU)

Occurrence of Campylobacter fetus subsp. venerealis and Tritrichomonas foetus dna in bulls from Alagoas State, Brazil / Ocorrência de dna de Campylobacter fetus subsp. venerealis e Tritrichomonas foetus em touros no Estado de Alagoas, Brasil

The aim of the present study is to diagnose the occurrence of infections caused by Campylobacter fetus subsp. venerealis and Tritrichomonas foetus in reproducer bulls from Alagoas State breeders, Brazil. The total of 162 preputial smegma samples were collected from nelore bulls from ten rural properties in the East, Agreste and Sertão mesoregions. The samples were subjected to the Polymerase Chain Reaction (PCR) technique in order to assess C. fetus subsp. venerealis and Tritrichomonas foetus DNA and cultivated in Modified Diamond Medium (DMM) for Tritrichomonas foetus isolation. Four point nine percent (4.9% - 8/162) of the evaluated bulls were infected with C. fetus subsp. venerealis and 3.0% (5/162) of the sample were infected with T. foetus, which was not isolated in any of the assessed animals. Based on our results, there was C. fetus subsp. venerealis and T. foetus DNA in bulls from Alagoas State, Brazil. Accordingly, it is necessary performing laboratory examinations in animals living in properties breeding animals for reproduction purpose in order to monitor and control such infections.(AU)

Objetivou-se com esta pesquisa diagnosticar a ocorrência das infecções por Campylobacter fetus subsp. venerealis e Tritrichomonas foetus em touros, provenientes de propriedades localizadas no estado de Alagoas, Brasil. Foram coletadas 162 amostras de esmegma prepucial de touros da raça nelore, procedentes de dez propriedades rurais das mesorregiões Leste, Agreste e Sertão. Para a pesquisa de DNA de C. fetus subsp. venerealis e Tritrichomonas foetus as amostras foram submetidas à técnica Reação em Cadeia da Polimerase (PCR) e para isolamento de Tritrichomonas foetus foram cultivadas em Meio Diamond Modificado (DMM). Observou-se a ocorrência da infecção por C. fetus subsp. venerealis em 4,9% (8/162) dos touros analisados e 3,0% (5/162) para T. foetus. Não foi isolado T. foetus em nenhuma das amostras analisadas. Os resultados deste estudo confirmam a ocorrência de DNA de C. fetus subsp. venerealis e T. foetus em touros no estado de Alagoas, Brasil. Desta forma, constata-se a necessidade da realização de exames laboratoriais em propriedades de bovinos destinadas à reprodução para um monitoramento e controle dessas infecções.(AU)

Ocorrência de ovinos portadores da infecção por Campylobacter spp. no estado de Pernambuco / Occurrence of sheep carrier of infection with Campylobacter spp. in the state of Pernambuco, Brazil

Objetivou-se com este estudo determinar a ocorrência e os fatores de risco associados à infecção por Campylobacter spp. em criações de ovinos no estado de Pernambuco, Brasil. Foram coletadas 421 amostras fecais de ovinos procedentes de 20 rebanhos para o isolamento de Campylobacter spp. As espécies Campylobacter fetus subsp. fetus e Campylobacter jejuni foram identificadas por Reação em Cadeia da Polimerase (PCR). Para análise dos fatores de risco foi realizada uma análise univariada e posteriormente regressão logística a partir de questionário com perguntas objetivas sobre o manejo higiênico-sanitário e reprodutivo. A ocorrência para Campylobacter spp. foi de 4,5% (19/421; I.C. 2,8% - 7,1%). Das 19 amostras positivas no cultivo, oito (1,9%; I.C. 0,9% - 3,9%) foram classificadas como C. fetus subsp. fetus e sete (1,7%; I.C. 0,7% - 3,6%) como C. jejuni, com co-infecção em quatro amostras (0,95%). O número de focos identificados foi de 35,0% (7/20) das criações de ovinos que apresentavam pelo menos um animal positivo. Na análise de regressão logística não foi identificada nenhuma das variáveis como fator de risco. Este é o primeiro registro da infecção por Campylobacter spp. em rebanhos ovinos no Nordeste do Brasil, concluindo-se que a infecção ocorre nesses rebanhos. Dessa forma, se faz necessário à implementação de medidas de controle e prevenção, para impedir a propagação do agente entre as criações, evitando prejuízos para ovinocultura e riscos para saúde pública, uma vez que a campilobacteriose é considerada uma zoonose emergente.(AU)

The objective of this study was to determine the occurrence and risk factors associated with Campylobacter spp. infection in sheep in the State of Pernambuco, Brazil. A total of 421 fecal samples were collected from 20 herds for the isolation of Campylobacter spp. The species Campylobacter fetus and Campylobacter jejuni were identified by Polymerase Chain Reaction (PCR). To analyze the risk factors, logistic regression was conducted through a questionnaire about the hygienic-sanitary and reproductive management. The occurrence of Campylobacter spp. was 4.5% (19/421; C.I. 2.8 to 7.1%). Of the 19 positive samples isolated, eight (1.9% CI 0.9 to 3.9%) were classified as C. fetus subsp. fetus and seven (1.7% CI 0.7 to 3.5%) as C. jejuni, with co-infection in four samples (0.95%). The number of identified focuses was 35.0% (7/20) of the sheep herds that had at least one positive animal. The logistic regression analysis did not identify any of the variables as a risk factor. This appears to be the first report of infection with Campylobacter spp. in sheep herds in northeastern Brazil. Thus it is necessary to implement measures for control and prevention avoid damage to sheep production and risk to public health, since campylobacteriosis is considered an emerging zoonosis.(AU)

Ocorrência de ovinos portadores da infecção por Campylobacter spp. no estado de Pernambuco / Occurrence of sheep carrier of infection with Campylobacter spp. in the state of Pernambuco, Brazil

Objetivou-se com este estudo determinar a ocorrência e os fatores de risco associados à infecção por Campylobacter spp. em criações de ovinos no estado de Pernambuco, Brasil. Foram coletadas 421 amostras fecais de ovinos procedentes de 20 rebanhos para o isolamento de Campylobacter spp. As espécies Campylobacter fetus subsp. fetus e Campylobacter jejuni foram identificadas por Reação em Cadeia da Polimerase (PCR). Para análise dos fatores de risco foi realizada uma análise univariada e posteriormente regressão logística a partir de questionário com perguntas objetivas sobre o manejo higiênico-sanitário e reprodutivo. A ocorrência para Campylobacter spp. foi de 4,5% (19/421; I.C. 2,8% - 7,1%). Das 19 amostras positivas no cultivo, oito (1,9%; I.C. 0,9% - 3,9%) foram classificadas como C. fetus subsp. fetus e sete (1,7%; I.C. 0,7% - 3,6%) como C. jejuni, com co-infecção em quatro amostras (0,95%). O número de focos identificados foi de 35,0% (7/20) das criações de ovinos que apresentavam pelo menos um animal positivo. Na análise de regressão logística não foi identificada nenhuma das variáveis como fator de risco. Este é o primeiro registro da infecção por Campylobacter spp. em rebanhos ovinos no Nordeste do Brasil, concluindo-se que a infecção ocorre nesses rebanhos. Dessa forma, se faz necessário à implementação de medidas de controle e prevenção, para impedir a propagação do agente entre as criações, evitando prejuízos para ovinocultura e riscos para saúde pública, uma vez que a campilobacteriose é considerada uma zoonose emergente.(AU)

The objective of this study was to determine the occurrence and risk factors associated with Campylobacter spp. infection in sheep in the State of Pernambuco, Brazil. A total of 421 fecal samples were collected from 20 herds for the isolation of Campylobacter spp. The species Campylobacter fetus and Campylobacter jejuni were identified by Polymerase Chain Reaction (PCR). To analyze the risk factors, logistic regression was conducted through a questionnaire about the hygienic-sanitary and reproductive management. The occurrence of Campylobacter spp. was 4.5% (19/421; C.I. 2.8 to 7.1%). Of the 19 positive samples isolated, eight (1.9% CI 0.9 to 3.9%) were classified as C. fetus subsp. fetus and seven (1.7% CI 0.7 to 3.5%) as C. jejuni, with co-infection in four samples (0.95%). The number of identified focuses was 35.0% (7/20) of the sheep herds that had at least one positive animal. The logistic regression analysis did not identify any of the variables as a risk factor. This appears to be the first report of infection with Campylobacter spp. in sheep herds in northeastern Brazil. Thus it is necessary to implement measures for control and prevention avoid damage to sheep production and risk to public health, since campylobacteriosis is considered an emerging zoonosis.(AU)

Ocorrência de ovinos portadores da infecção por Campylobacter spp. no estado de Pernambuco

ABSTRACT: The objective of this study was to determine the occurrence and risk factors associated with Campylobacter spp. infection in sheep in the State of Pernambuco, Brazil. A total of 421 fecal samples were collected from 20 herds for the isolation of Campylobacter spp. The species Campylobacter fetus and Campylobacter jejuni were identified by Polymerase Chain Reaction (PCR). To analyze the risk factors, logistic regression was conducted through a questionnaire about the hygienic-sanitary and reproductive management. The occurrence of Campylobacter spp. was 4.5% (19/421; C.I. 2.8 to 7.1%). Of the 19 positive samples isolated, eight (1.9% CI 0.9 to 3.9%) were classified as C. fetus subsp. fetus and seven (1.7% CI 0.7 to 3.5%) as C. jejuni, with co-infection in four samples (0.95%). The number of identified focuses was 35.0% (7/20) of the sheep herds that had at least one positive animal. The logistic regression analysis did not identify any of the variables as a risk factor. This appears to be the first report of infection with Campylobacter spp. in sheep herds in northeastern Brazil. Thus it is necessary to implement measures for control and prevention avoid damage to sheep production and risk to public health, since campylobacteriosis is considered an emerging zoonosis.

RESUMO: Objetivou-se com este estudo determinar a ocorrência e os fatores de risco associados à infecção por Campylobacter spp. em criações de ovinos no estado de Pernambuco, Brasil. Foram coletadas 421 amostras fecais de ovinos procedentes de 20 rebanhos para o isolamento de Campylobacter spp. As espécies Campylobacter fetus subsp. fetus e Campylobacter jejuni foram identificadas por Reação em Cadeia da Polimerase (PCR). Para análise dos fatores de risco foi realizada uma análise univariada e posteriormente regressão logística a partir de questionário com perguntas objetivas sobre o manejo higiênico-sanitário e reprodutivo. A ocorrência para Campylobacter spp. foi de 4,5% (19/421; I.C. 2,8% - 7,1%). Das 19 amostras positivas no cultivo, oito (1,9%; I.C. 0,9% - 3,9%) foram classificadas como C. fetus subsp. fetus e sete (1,7%; I.C. 0,7% - 3,6%) como C. jejuni, com co-infecção em quatro amostras (0,95%). O número de focos identificados foi de 35,0% (7/20) das criações de ovinos que apresentavam pelo menos um animal positivo. Na análise de regressão logística não foi identificada nenhuma das variáveis como fator de risco. Este é o primeiro registro da infecção por Campylobacter spp. em rebanhos ovinos no Nordeste do Brasil, concluindo-se que a infecção ocorre nesses rebanhos. Dessa forma, se faz necessário à implementação de medidas de controle e prevenção, para impedir a propagação do agente entre as criações, evitando prejuízos para ovinocultura e riscos para saúde pública, uma vez que a campilobacteriose é considerada uma zoonose emergente.

Ocorrência da infecção por Campylobacter fetus subsp. venerealis e Tritrichomonas foetus em búfalos no estado de Pernambuco, Brasil / Infection occurrence of Campylobacter fetus subsp. venerealis and Tritrichomonas foetus in buffaloes in the state of Pernambuco, Brazil

Objetivou-se com estudo determinar a ocorrência da infecção por Campylobacter fetus subsp. venerealis e Tritrichomonas foetus em búfalos no estado de Pernambuco, Brasil. Foram coletadas 133 amostras biológicas (muco cervicovaginal e raspado prepucial) de animais, procedentes de oito propriedades, de diferentes regiões do estado. O material biológico coletado foi transferido para solução salina tamponada (PBS) e, posteriormente, inoculado em meios de transporte específicos, Lander para diagnóstico de C. fetus subsp. venerealis e Diamond para T. foetus. Para o diagnóstico das infecções por Campylobacter fetus subsp. venerealis e Tritrichomonas foetus, as amostras foram submetidas à reação em cadeia da polimerase (PCR) e cultivadas em meio ágar Columbia acrescido de antibiótico e Diamond, respectivamente. Para pesquisa de C. fetus subsp. venerealis, observou-se uma ocorrência de 1,8% (2/113) de animais positivos no exame microbiológico com confirmação pela PCR. Em relação à procedência, observou-se que 100% das amostras positivas pertenciam a dois machos do mesmo rebanho. Nenhum animal foi positivo na pesquisa de T. foetus. Este é o primeiro registro da infecção por C. fetus subsp. venerealis em búfalos no Brasil. Apesar da baixa ocorrência, recomenda-se adoção de medidas de controle, com o intuito de se evitar a disseminação do agente para outros rebanhos.(AU)

The objective this study was to determine the occurrence of infection with Campylobacter fetus subsp. venerealis and Tritrichomonas foetus in buffaloes in the State of Pernambuco, Brazil. Biological samples were collected (cervico vaginal mucus and shaved prepucial) of 113 animals, coming from 8 properties in different regions of the state. The biological material collected was transferred into phosphate buffered saline (PBS) and inoculated in the specific transport, Lander for diagnosis of C. fetus subsp. venerealis and Diamond for T. fetus subsequently. For the diagnosis of infection by Campylobacter fetus subsp. venrealis and Tritrichomonas foetus the samples were submitted to Polymerase Chain Reaction (PCR) grown in Columbia agar plus antibiotics and Diamond, respectively. There was an occurrence of 1.8% (2/113) of positive animals in the microbiological examination with confirmation by PCR, for C. fetus subsp. venerealis. We observed that 100% of positive samples were from two (2) males from the same herd. No animals were positive for T. foetus. This is the first report of infection with C. fetus subsp. venerealis in buffaloes in Brazil. Despite rare occurrence, control measures are recommended in order to prevent the spread of the agent to other herds.(AU)