Characterization of Leiurus abdullahbayrami (Scorpiones: Buthidae) venom: peptide profile, cytotoxicity and antimicrobial activity

Background Scorpion venoms are rich bioactive peptide libraries that offer promising molecules that may lead to the discovery and development of new drugs.Leiurus abdullahbayrami produces one of the most potent venoms among Turkish scorpions that provokes severe symptoms in envenomated victims.Methods In the present study, the peptide profile of the venom was investigated by electrophoretic methods, size-exclusion and reversed-phase chromatography and mass spectroscopy. Cytotoxic and antimicrobial effects were evaluated on a breast cancer cell line (MCF-7) and various bacterial and fungal species.Results Proteins make up approximately half of the dry weight of L. abdullahbayrami crude venom. Microfluidic capillary electrophoresis indicated the presence of 6 to 7 kDa peptides and proved to be a highly practical peptidomics tool with better resolution when compared to conventional polyacrylamide gel electrophoresis. Mass spectroscopy analysis helped us to identify 45 unique peptide masses between 1 to 7 kDa with a bimodal mass distribution peaking between molecular weights of 1 to 2 kDa (29%) and 3 to 4 kDa (31%). L. abdullahbayrami crude venom had a proliferative effect on MCF-7 cells, which may be explained by the high concentration of polyamines as well as potassium and calcium ions in the arachnid venoms. Antimicrobial effect was stronger on gram-negative bacteria.Conclusions This work represents the first peptidomic characterization of L. abdullahbayrami venom. Considering the molecular weight-function relationship of previously identified venom peptides, future bioactivity studies may lead to the discovery of novel potassium and chloride ion channel inhibitors as well as new antimicrobial peptides fromL. abdullahbayrami venom.(AU)

Characterization of Leiurus abdullahbayrami (Scorpiones: Buthidae) venom: peptide profile, cytotoxicity and antimicrobial activity

Background Scorpion venoms are rich bioactive peptide libraries that offer promising molecules that may lead to the discovery and development of new drugs.Leiurus abdullahbayrami produces one of the most potent venoms among Turkish scorpions that provokes severe symptoms in envenomated victims.Methods In the present study, the peptide profile of the venom was investigated by electrophoretic methods, size-exclusion and reversed-phase chromatography and mass spectroscopy. Cytotoxic and antimicrobial effects were evaluated on a breast cancer cell line (MCF-7) and various bacterial and fungal species.Results Proteins make up approximately half of the dry weight of L. abdullahbayrami crude venom. Microfluidic capillary electrophoresis indicated the presence of 6 to 7 kDa peptides and proved to be a highly practical peptidomics tool with better resolution when compared to conventional polyacrylamide gel electrophoresis. Mass spectroscopy analysis helped us to identify 45 unique peptide masses between 1 to 7 kDa with a bimodal mass distribution peaking between molecular weights of 1 to 2 kDa (29%) and 3 to 4 kDa (31%). L. abdullahbayrami crude venom had a proliferative effect on MCF-7 cells, which may be explained by the high concentration of polyamines as well as potassium and calcium ions in the arachnid venoms. Antimicrobial effect was stronger on gram-negative bacteria.Conclusions This work represents the first peptidomic characterization of L. abdullahbayrami venom. Considering the molecular weight-function relationship of previously identified venom peptides, future bioactivity studies may lead to the discovery of novel potassium and chloride ion channel inhibitors as well as new antimicrobial peptides fromL. abdullahbayrami venom.

Characterization of Leiurus abdullahbayrami (Scorpiones: Buthidae) venom: peptide profile, cytotoxicity and antimicrobial activity

Background Scorpion venoms are rich bioactive peptide libraries that offer promising molecules that may lead to the discovery and development of new drugs.Leiurus abdullahbayrami produces one of the most potent venoms among Turkish scorpions that provokes severe symptoms in envenomated victims.Methods In the present study, the peptide profile of the venom was investigated by electrophoretic methods, size-exclusion and reversed-phase chromatography and mass spectroscopy. Cytotoxic and antimicrobial effects were evaluated on a breast cancer cell line (MCF-7) and various bacterial and fungal species.Results Proteins make up approximately half of the dry weight of L. abdullahbayrami crude venom. Microfluidic capillary electrophoresis indicated the presence of 6 to 7 kDa peptides and proved to be a highly practical peptidomics tool with better resolution when compared to conventional polyacrylamide gel electrophoresis. Mass spectroscopy analysis helped us to identify 45 unique peptide masses between 1 to 7 kDa with a bimodal mass distribution peaking between molecular weights of 1 to 2 kDa (29%) and 3 to 4 kDa (31%). L. abdullahbayrami crude venom had a proliferative effect on MCF-7 cells, which may be explained by the high concentration of polyamines as well as potassium and calcium ions in the arachnid venoms. Antimicrobial effect was stronger on gram-negative bacteria.Conclusions This work represents the first peptidomic characterization of L. abdullahbayrami venom. Considering the molecular weight-function relationship of previously identified venom peptides, future bioactivity studies may lead to the discovery of novel potassium and chloride ion channel inhibitors as well as new antimicrobial peptides fromL. abdullahbayrami venom.(AU)

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no sêmen / Fluorescent PCR associated with capillary electrophoresis as a diagnostic tool of bacteria in semen

Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF-5'gcgctcaggctgccgacgcaa3' (cromóforo FAM) e BR-5'accagccattgcggtcggta3' para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10(3) bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 10(5) bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial.

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10(3) bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no sêmen / Fluorescent PCR associated with capillary electrophoresis as a diagnostic tool of bacteria in semen

Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF-5'gcgctcaggctgccgacgcaa3' (cromóforo FAM) e BR-5'accagccattgcggtcggta3' para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10(3) bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 10(5) bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial.(AU)

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10(3) bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.(AU)

PCR Multiplex fluorescente para detecção de bactérias em sêmen bovino / Fluorescent Multiplex PCR for detection of bacteria in semen bovine

Este estudo teve como objetivo avaliar o limiar de detecção da técnica de PCR multiplex fluorescente aliada a eletroforese capilar na detecção de agentes infecciosos em amostras de sêmen experimentalmente contaminadas com concentrações decrescentes das bactérias Brucella abortus, Leptospira interrogans sorovar pomona, Campylobacter fetus e Haemophilus somnus. Amostras de sêmen bovino foram experimentalmente contaminadas com concentrações decrescentes de bactérias obtidas através de diluições seriadas na base 10 de modo a obter-se amostras contendo desde 1 vez até 10-7 bactérias/mL a partir da concentração inicial de Leptospira pomona, Brucella abortus, Campylobacter fetus e Haemophilus somnus. As diluições foram efetuadas individualmente para cada bactéria, bem como nas diferentes concentrações necessárias para a padronização do teste de multiplex PCR. As extrações de DNA de todas as soluções contendo espermatozóides e bactérias analisadas no presente estudo foram realizadas segundo protocolo descrito por Heinemann et al. (2000). Os produtos de PCR multiplex foram avaliados por eletroforese em gel de poliacrilamida 8% e separação eletroforética por sistema capilar em equipamento automático de análise de fragmentos de DNA MegaBace. Observou-se a amplificação de fragmentos de 193pb, 330pb, 400pb e 415pb a partir do DNA de B. abortus, L. pomona, H. somnus, C. fetus, respectivamente. Na análise por eletroforese capilar de produtos da PCR multiplex do DNA para detecção simultânea dos quatro patógenos observou-se a sinal de positividade até a diluição de 10-3 bactérias/mL vezes da concentração inicial da solução estoque de cada bactéria. A técnica de PCR multiplex aliada à eletroforese capilar foi usada pela primeira vez para o diagnóstico direto de quatro bactérias patogênicas no sêmen, demonstrando ser um método rápido na detecção de bactérias causadoras de doenças reprodutivas.(AU)

This study aimed to evaluate the threshold of detection of fluorescent multiplex PCR coupled with capillary electrophoresis for detection of infectious agents in semen samples from experimentally infected with decreasing concentrations of the bacteria Brucella abortus, Leptospira interrogans serovar pomona, Campylobacter fetus and Haemophilus somnus. Samples of bovine semen were experimentally infected with decreasing concentrations of bacteria obtained from serial dilutions in the base 10 so as to obtain samples containing a long time until 10-7 bacteria/mL from the initial concentration of Lepstospira pomona, Brucella abortus, Haemophilus somnus and Campylobacter fetus. The dilutions were made individually for each bacterium, as well as in different concentrations needed to standardize the multiplex PCR test. DNA extractions of all solutions containing sperm and bacteria analyzed in this study were performed according to protocol described by Heinemann et al. (2000). The multiplex PCR products were analyzed by electrophoresis on 8% polyacrylamide gel and capillary electrophoretic separation system for automated equipment in the analysis of DNA fragments MegaBACE. We observed amplification of fragments of 193pb, 330pb, 415pb and 400bp from the DNA of B. abortus, L. pomona, H. somnus, C. fetus respectively. The analysis by capillary electrophoresis of multiplex PCR products of DNA for simultaneous detection of the four pathogens was observed by detecting the dilution of 10-3 bacteria / mL times the initial concentration of the stock solution of each bacterium. The multiplex PCR coupled with capillary electrophoresis was first used for the direct diagnosis of four pathogenic bacteria in semen, proving to be a rapid method to detect bacteria that cause reproductive disorders.(AU)

Metodologia analítica para determinação de resíduos de tetraciclinas em leite: uma revisão / Analytical methodology for determination of tetracyclines residues in milk: a review

As tetraciclinas são um grupo de antimicrobianos amplamente utilizados no tratamento e prevenção de doenças infecciosas em gado leiteiro no Brasil, porém, o uso incorreto e o não cumprimento do período de carência podem resultar em resíduos destes medicamentos no leite. A presença de resíduos no leite pode causar o desenvolvimento de reações alérgicas nos consumidores desses produtos, resistência em bactérias e prejuízos na produção de produtos lácteos fermentados. Com a finalidade de fornecer informações a respeito dos métodos empregados na determinação de tetraciclinas em leite, foi realizada uma revisão das metodologias analíticas relatadas na literatura científica. Neste estudo foram abordadas as metodologias cromatográficas e de eletroforese capilar, que são comumente utilizadas. (AU)

Detecção de Leptospira pomona em sêmen bovino por eletroforese capilar fluorescente / Detection of Leptospira pomona in bovine semen by fluorescent capillary eletrophoresis

Este estudo pretendeu avaliar o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Leptospira pomona em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com Leptospira pomona em escalas que variavam de 10(elevado a 0) a 10(elevado a 7) bactérias/ml e submetidas à extração de DNA pelo método de fenol/clorofórmio. Após a reação de PCR, a visualização dos fragmentos foi realizada em três tipos de eletroforese: agarose 2% sob luz UV, acrilamida 8% corado com prata e eletroforese capilar fluorescente. A detecção de DNA de Leptospira pomona em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10(elevado a 2 )bactérias/ml. Nos métodos de eletroforese em agarose 2%, observou-se limite de detecção de 10(elevado a 4 )bactérias/ml e em gel de poliacrilamida 8% o limite de detecção foi de 10(elevado a 2 )bactérias/ml. A eletroforese capilar demonstrou ser uma alternativa eficaz e rápida na detecção de DNA de Leptospira em sêmen bovino podendo ser uma valiosa ferramenta para controle de qualidade do sêmen produzido em centrais de inseminação artificial dada a facilidade de automação desse processo.(AU)

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Leptospira pomonadiagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with Leptospira pomona 10(involution 0) to 10(involution 7 ) bacteria/ml) and DNA was extracted by phenol/chloroform protocol. DNA fragments visualization was done by three electrophoresis methods: under UV light in 2 % agarose gel, silver staining 8% polyacrylamide gel and fluorescent capillary electrophoresis. The detection limit of capillary electrophoresis for Leptospira pomona was 10(involution 2) bacteria/ml. Under UV light, in 2 % agarose gel, the detection limit was of 10(involution 4) bacteria/ml while for silver stained 8 % polyacrylamide gel it was 10(involution 2) bacteria/ml. PCR with fluorescent capillary electrophoresis is an efficient andrapid diagnostic test for DNA detection of Leptospira in bovine semen and this can be an important tool for herd and semen sanitary controlin artificial insemination centers.(AU)