Aborto em bovinos e bubalinos: causas específicas e inespecíficas / Abortion in cattle and buffaloes: specific and non-specific causes

O aborto é caracterizado como a expulsão do feto sem viabilidade para fora do ambiente uterino da progenitora durante o período que vai do 42° dia a o 260° dia. São descritos diversos fatores infecciosos e não infecciosos como etiologia para o aborto. Dentre os infecciosos, destacam-se as infecções por bactérias, vírus, protozoários e fungos. Enquanto as causas não infecciosas englobam falhas de manejo nutricional, intoxicações e medicamentos que ocasionalmente podem levar à morte fetal. Essa mortalidade fetal é causa importante de perdas reprodutivas na cadeia produtiva de animais domésticos, especialmente bovinos e bubalinos. Ambas as espécies participam da produtividade econômica no Brasil e compartilham de diversas doenças que são causas de aborto. Nesse contexto, o objetivo desta revisão foi reunir e discorrer sobre as principais informações concernentes às possíveis etiologias do aborto, sejam elas de origem infecciosa ou não infecciosas nas espécies bovinas e bubalinas no Brasil.

Abortion is characterized as the expulsion of the non-viable fetus outside the mother's uterine environment during the period between the 42nd day to the 260th day. Several infectious and non-infectious factors are described as etiology for miscarriage. Among the infectious, infections by bacteria, viruses, protozoa, and fungi stand out, while non-infectious causes include failures in nutritional management, poisoning, and medications that occasionally can lead to fetal death. This fetal mortality is an important cause of reproductive losses in the production chain of domestic animals, especially cattle and buffaloes. Both species participate in economic productivity in Brazil and share several diseases that are causes of abortion. In this context, this review aimed to gather and discuss the main information concerning the possible etiologies of abortion, whether of infectious or non-infectious origin in bovine and buffalo species in Brazil.

Chronic prostatitis in a dog infected with a smooth strain of Brucella spp

Dogs may be occasionally infected by smooth strains of Brucella spp. The infection is usually associated with the ingestion of contaminated material from parturition or abortion, or other tissues from infected farm animals, particularly cattle and pigs. A 6-year-old, male mixed breed dog from a rural area was admitted at a veterinary clinic for clinical examination. The dog had bilateral perineal hernia with dysuria and dyschezia, as well as small firm testicles with scrotal adhesions. Serological tests, including buffered plate antigen, serum agglutination test, and 2-mercaptoethanol test, were positive for smooth Brucella spp. strains, whereas a rapid slide agglutination test was negative for B. canis. Blood and prostate tissue samples yielded no bacterial isolates. Histopathology demonstrated interstitial lymphoplasmacytic and histiocytic infiltration of the prostate gland, with fibrosis and occasional disruption of glandular architecture. Immunohistochemistry demonstrated abundant Brucella spp. antigens in the cytoplasm of macrophages. This report supports the notion that not only B. canis, but also smooth Brucella spp. must be considered in the differential diagnosis of prostatitis in dogs.(AU)

Chronic prostatitis in a dog infected with a smooth strain of Brucella spp

Dogs may be occasionally infected by smooth strains of Brucella spp. The infection is usually associated with the ingestion of contaminated material from parturition or abortion, or other tissues from infected farm animals, particularly cattle and pigs. A 6-year-old, male mixed breed dog from a rural area was admitted at a veterinary clinic for clinical examination. The dog had bilateral perineal hernia with dysuria and dyschezia, as well as small firm testicles with scrotal adhesions. Serological tests, including buffered plate antigen, serum agglutination test, and 2-mercaptoethanol test, were positive for smooth Brucella spp. strains, whereas a rapid slide agglutination test was negative for B. canis. Blood and prostate tissue samples yielded no bacterial isolates. Histopathology demonstrated interstitial lymphoplasmacytic and histiocytic infiltration of the prostate gland, with fibrosis and occasional disruption of glandular architecture. Immunohistochemistry demonstrated abundant Brucella spp. antigens in the cytoplasm of macrophages. This report supports the notion that not only B. canis, but also smooth Brucella spp. must be considered in the differential diagnosis of prostatitis in dogs.

Epidemiological study of swine brucellosis in household farms in Federal District of Brazil / Estudo epidemiológico de brucelose em suínos em criatórios de subsistência do Distrito Federal, Brasil

Brucellosis is caused by 10 species of Brucella sp. and is responsible for huge economic losses. There are no specific prophylactic measures present for household pigs, which can be also reservoirs, in the brazilian National Program for the Control and Eradication of Animal Brucellosis and Tuberculosis. Therefore, we conducted a cross-sectional study of blood serum samples from 1793 household pigs from 823 farms in Federal District of Brazil. Serum samples were collected between August and October in 2011, 2012, and 2014 by the veterinarians under the Secretary of Agriculture. The Rose Bengal plate test (RBPT) was used for screening for antibodies against smooth Brucella sp. Positive results were confirmed by the slow agglutination test (SAT) and 2-mercaptoethanol test (2-ME). Among the 1793 samples screened with RBPT, 125 were positive for antibodies against smooth Brucella sp.; 46 (32%) of these samples showed agglutination in SAT, but only one (0.8%) sample was considered positive by 2-ME. The animal with the positive blood serum was traced back in a household farm whose owner had supplemented feeds with cow milk whey. For preventing swine brucellosis, it is necessary to prevent the cross-infection either by the consumption of contaminated cow milk or by direct contact with infected animals. The government policy should enhance the sanitary education for encouraging household farmers to employ prophylactic measures and ensure biosecurity. The present study results indicate that swine brucellosis risk in household farms occurs in a low prevalence rate in pigs from the Federal District of Brazil.

A brucelose, enfermidade causada por 10 espécies de Brucella sp, pode afetar várias espécies de animais. A doença é responsável por perdas econômicas em diversos setores, inclusive na suinocultura. Não existem medidas profiláticas específicas para suínos no Programa Nacional de Controle e Erradicação da Brucelose Animal e Tuberculose-PNCEBT. Foi realizado um estudo transversal durante o período de agosto a outubro em 2011, 2012 e 2014 para o estudo de soroprevalência. Os analistas veterinários da Secretaria de Agricultura coletaram sangue de 1793 suínos de 823 criatórios no Distrito Federal. O teste Rosa de Bengala (RBPT) foi utilizado como triagem para a pesquisa de anticorpos contra Brucella sp. Os resultados positivos foram confirmados pelo teste de aglutinação lenta (SAT) e teste de 2-mercaptoetanol (2-ME) em série. Das 1793 amostras testadas pelo RBPT, 125 foram reagentes; sendo que 32% (46) destas amostras apresentaram aglutinação no SAT, mas apenas uma (0,8%) amostra foi confirmada positiva pelo teste 2-ME. O animal positivo foi rastreado em uma chácara de subsistência cujo dono tinha hábito de fornecer soro de leite de vaca aos suínos. Para prevenira brucelose suína, é necessário evitar a infecção cruzada pelo consumo de leite de vaca contaminado ou pelo contato direto com animais infectados. A política do governo deve melhorar a educação sanitária para incentivar a agricultura familiar a empregar medidas profiláticas e garantir a biossegurança. Os resultados do presente estudo indicam que o risco de brucelosesuína é baixo entre os criatórios de suínos do Distrito Federal.

Epidemiological study of swine brucellosis in household farms in Federal District of Brazil / Estudo epidemiológico de brucelose em suínos em criatórios de subsistência do Distrito Federal, Brasil

Brucellosis is caused by 10 species of Brucella sp. and is responsible for huge economic losses. There are no specific prophylactic measures present for household pigs, which can be also reservoirs, in the brazilian National Program for the Control and Eradication of Animal Brucellosis and Tuberculosis. Therefore, we conducted a cross-sectional study of blood serum samples from 1793 household pigs from 823 farms in Federal District of Brazil. Serum samples were collected between August and October in 2011, 2012, and 2014 by the veterinarians under the Secretary of Agriculture. The Rose Bengal plate test (RBPT) was used for screening for antibodies against smooth Brucella sp. Positive results were confirmed by the slow agglutination test (SAT) and 2-mercaptoethanol test (2-ME). Among the 1793 samples screened with RBPT, 125 were positive for antibodies against smooth Brucella sp.; 46 (32%) of these samples showed agglutination in SAT, but only one (0.8%) sample was considered positive by 2-ME. The animal with the positive blood serum was traced back in a household farm whose owner had supplemented feeds with cow milk whey. For preventing swine brucellosis, it is necessary to prevent the cross-infection either by the consumption of contaminated cow milk or by direct contact with infected animals. The government policy should enhance the sanitary education for encouraging household farmers to employ prophylactic measures and ensure biosecurity. The present study results indicate that swine brucellosis risk in household farms occurs in a low prevalence rate in pigs from the Federal District of Brazil.(AU)

A brucelose, enfermidade causada por 10 espécies de Brucella sp, pode afetar várias espécies de animais. A doença é responsável por perdas econômicas em diversos setores, inclusive na suinocultura. Não existem medidas profiláticas específicas para suínos no Programa Nacional de Controle e Erradicação da Brucelose Animal e Tuberculose-PNCEBT. Foi realizado um estudo transversal durante o período de agosto a outubro em 2011, 2012 e 2014 para o estudo de soroprevalência. Os analistas veterinários da Secretaria de Agricultura coletaram sangue de 1793 suínos de 823 criatórios no Distrito Federal. O teste Rosa de Bengala (RBPT) foi utilizado como triagem para a pesquisa de anticorpos contra Brucella sp. Os resultados positivos foram confirmados pelo teste de aglutinação lenta (SAT) e teste de 2-mercaptoetanol (2-ME) em série. Das 1793 amostras testadas pelo RBPT, 125 foram reagentes; sendo que 32% (46) destas amostras apresentaram aglutinação no SAT, mas apenas uma (0,8%) amostra foi confirmada positiva pelo teste 2-ME. O animal positivo foi rastreado em uma chácara de subsistência cujo dono tinha hábito de fornecer soro de leite de vaca aos suínos. Para prevenira brucelose suína, é necessário evitar a infecção cruzada pelo consumo de leite de vaca contaminado ou pelo contato direto com animais infectados. A política do governo deve melhorar a educação sanitária para incentivar a agricultura familiar a empregar medidas profiláticas e garantir a biossegurança. Os resultados do presente estudo indicam que o risco de brucelosesuína é baixo entre os criatórios de suínos do Distrito Federal.(AU)

Validation of the multiplex PCR for identification of Brucella spp / Validação da técnica de PCR multiplex para identificação de Brucella spp

A multiplex PCR technique for detection of Brucella spp. in samples of bacterial suspension was validated as a complementary tool in the diagnosis of the disease. This technique allows the characterization of the agent without performing biochemical tests, which greatly reduces the time for a final diagnosis, and provides more security for the analyst by reducing the time of exposure to microorganisms. The validation was performed in accordance with the Manual of Diagnostic Tests from OIE (2008) and following the requirements present in the ABNT NBR ISO/IEC 17025:2005. The mPCR validated in this study identified the different species of Brucella ( Brucella abortus , B. suis , B. ovis e B. melitensis ) of bacterial suspension obtained from the slaughterhouse samples, as well as distinguished the biovars (1, 2 e 4; 3b, 5, 6 e 9) of B. abortus in grouped form and differentiated the field strains from vaccine strains, as a quick, useful and less expensive technique in diagnosis of brucellosis in Brazil.(AU)

Validou-se neste trabalho uma técnica de PCR Multiplex (mPCR) para detecção de Brucella spp. em amostras de suspensão bacteriana, como ferramenta complementar no diagnóstico da doença. Esta técnica possibilita a caracterização do agente sem que seja necessária a realização de testes bioquímicos, o que diminui consideravelmente o tempo para o diagnóstico final, além de oferecer mais segurança ao analista ao diminuir o tempo de exposição ao agente infecioso. A validação foi realizada de acordo com o Manual de Testes de Diagnósticos da OIE (2008), seguindo as exigências presentes na norma de qualidade da ABNT NBR ISO/IEC 17025:2005. A mPCR validada neste trabalho identificou as diferentes espécies de Brucella ( Brucella abortus , B. suis , B. ovis e B. melitensis ) em suspensão bacteriana, obtidas a partir de amostras de frigorífico. Além disso, discriminou os biovares (1, 2 e 4; 3b, 5, 6 e 9) de B. abortus , de forma agrupada, e diferenciou cepa vacinal de cepa de campo, sendo esta uma técnica rápida, útil e de menor custo para o auxílio no diagnóstico de brucelose no Brasil.(AU)

Brucella ovis REO 198 natural and experimental infection in Santa Inês rams from Brazil / Infecção natural e experimental de Brucella ovis REO 198 em carneiros Santa Inês do Brazil

B. ovis pathogenicity was evaluated in experimentally inoculated and naturally infected rams. Ten animals were submitted to simultaneous conjunctival and intrapreputial inoculation with 2x109 CFU/ mL of B. ovis REO 198. After that, animals underwent physical examination and blood samples were collected for serology every week. Positive serology results started to be observed in the 3rd week, with fluctuations in titers. Clinical changes began in the 5th week after inoculation and were associated with positive serology in the acute phase of the disease. Presence of B. ovis in semen and urine culture was intermittent. Three non-inoculated animals showed natural infection. B. ovis was shed twice in semen of one serology-negative animal. The study underscored the pathogenic characteristics of B. ovis REO 198 in Santa Inês rams, as well as the importance of animals as potential sources of infection.(AU)

Patogenicidade da B. ovis foi avaliada em carneiros inoculados experimentalmente e naturalmente infectados. Dez animais foram submetidos à inoculação conjuntival e intrapreputial simultânea com 2x109 UFC/mL de B. ovis REO 198. Depois disso, os animais foram submetidos ao exame físico e amostras de sangue foram coletadas para sorologia a cada semana. Sorologia positiva começou a ser observada na terceira semana, com flutuações nas titulações. As alterações clínicas começaram na quinta semana após a inoculação e foram associadas com sorologia positiva na fase aguda da doença. A presença de B. ovis em sêmen e cultura de urina foi intermitente. Três animais não inoculados apresentaram infecção natural. B. ovis foi eliminada duas vezes em sêmen de animal com sorologia negativa. O estudo destacou as características patogênicas de B. ovis REO 198 em carneiros Santa Inês, bem como a importância dos animais como potenciais fontes de infecção.(AU)

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no sêmen / Fluorescent PCR associated with capillary electrophoresis as a diagnostic tool of bacteria in semen

Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF-5'gcgctcaggctgccgacgcaa3' (cromóforo FAM) e BR-5'accagccattgcggtcggta3' para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10(3) bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 10(5) bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial.

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10(3) bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no sêmen / Fluorescent PCR associated with capillary electrophoresis as a diagnostic tool of bacteria in semen

Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF-5'gcgctcaggctgccgacgcaa3' (cromóforo FAM) e BR-5'accagccattgcggtcggta3' para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10(3) bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 10(5) bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial.(AU)

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10(3) bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.(AU)

Comparison of infection by Brucella spp. in free-ranging and captive wild animals from São Paulo State, Brazil

The aim of the current study was to evaluate the infection rate by Brucella spp. in wild and in captive animals. Serum samples from 121 animals (94 free-ranging and 27 captive) of different mammal species were evaluated. Sera were submitted to rose Bengal test (RBT) for screening and serum agglutination tests (SAT) and 2-mercaptoethanol test (2-ME) for confirmatory results. Nine animals (five free-ranging and four captive) tested positive in RBT, but negative in the confirmatory tests. Several domestic animal diseases that have control programs are not focused on wild reservoirs, such as brucellosis in Brazil. The study of new reservoirs in wildlife is essential to prevent emerging diseases.(AU)

Evidência molecular de Brucella sp. em Ozotoceros bezoarticus (veado campeiro) do Pantanal sul-mato-grossense / Molecular evidence of Brucella sp. in deer (Ozotoceros bezoarticus) of the southern Pantanal

A presença de Brucella spp. entre animais silvestres pode influenciar a taxa de reprodução destes hospedeiros, além de atuarem como fonte de infecção natural para os animais domésticos e humanos. O objetivo deste estudo foi identificar a presença de Brucella spp. em 44 amostras de sangue de veado campeiro (Ozotoceros bezoarticus) do Pantanal do Sul-Mato-Grossense, utilizando a técnica de PCR. Observou-se que 20,4 por cento (9/44) das amostras foram positivas. A sequência consenso de nucleotídeo obtida no sequenciamento do isolado de veado campeiro apresentou 514 pb e 95 por cento de identidade com virB5 de B. abortus (best hits acesso nr AF226278, e-value 0.0), já na análise filogenética a amostra de Brucella isolada de veado campeiro apresentou-se muito próximo de B. suis. A alta porcentagem de amostras positivas sugere que a brucelose pode ser um problema entre os veados campeiros na área estudada e que estes animais podem representar riscos para outros animais domésticos e silvestres.(AU)

The presence of Brucella spp. in wild animals can influence their reproduction rate and may be a source of infection for domestic animals and humans. The objective of this study was to identify the presence of Brucella spp. in 44 blood samples from the deer Ozotoceros bezoarticus in the southern Pantanal of Sul-Mato-Grossense, using the PCR technique. It was seen that 20.4 percent (9/44) of the samples were positive. The consensus sequence was obtained by sequencing these samples, which then showed 514 pb and 95 percent of identity with gene virB5 of B. abortus (best hits accession nr AF226278, e-value 0.0). The phylogenetic analysis of the sample isolated from deer revealed the Brucella to be very close to B. suis. The high percentage of positive samples suggests that brucellosis may be a concern in deer within the studied area, and that these animals may poses a risk for other domestic and wild ones.(AU)

Brucella ovis REO 198 natural and experimental infection in Santa Inês rams from Brazil / Infecção natural e experimental de Brucella ovis REO 198 em carneiros Santa Inês do Brazil

B. ovis pathogenicity was evaluated in experimentally inoculated and naturally infected rams. Ten animals were submitted to simultaneous conjunctival and intrapreputial inoculation with 2x109 CFU/ mL of B. ovis REO 198. After that, animals underwent physical examination and blood samples were collected for serology every week. Positive serology results started to be observed in the 3rd week, with fluctuations in titers. Clinical changes began in the 5th week after inoculation and were associated with positive serology in the acute phase of the disease. Presence of B. ovis in semen and urine culture was intermittent. Three non-inoculated animals showed natural infection. B. ovis was shed twice in semen of one serology-negative animal. The study underscored the pathogenic characteristics of B. ovis REO 198 in Santa Inês rams, as well as the importance of animals as potential sources of infection.

Patogenicidade da B. ovis foi avaliada em carneiros inoculados experimentalmente e naturalmente infectados. Dez animais foram submetidos à inoculação conjuntival e intrapreputial simultânea com 2x109 UFC/mL de B. ovis REO 198. Depois disso, os animais foram submetidos ao exame físico e amostras de sangue foram coletadas para sorologia a cada semana. Sorologia positiva começou a ser observada na terceira semana, com flutuações nas titulações. As alterações clínicas começaram na quinta semana após a inoculação e foram associadas com sorologia positiva na fase aguda da doença. A presença de B. ovis em sêmen e cultura de urina foi intermitente. Três animais não inoculados apresentaram infecção natural. B. ovis foi eliminada duas vezes em sêmen de animal com sorologia negativa. O estudo destacou as características patogênicas de B. ovis REO 198 em carneiros Santa Inês, bem como a importância dos animais como potenciais fontes de infecção.