Antifungal activity of Stenotrophomonas maltophilia in Stomoxys calcitrans larvae / Atividade antifúngica de Stenotrophomonas maltophilia em larvas de Stomoxys calcitrans

The microbiota present in Stomoxys calcitrans larvae may assist their survival in contaminated environments through production of inhibitory substances. Bacteriological identification methods, the polymerase chain reaction (PCR) and scanning electron microscopy (SEM) were used to detect a bacterium naturally present in mucus and macerated S. calcitrans larvae. The antifungal activity was determined based on the results from disk diffusion tests on an artificial solid medium. The bacterium was identified as Stenotrophomonas maltophilia and presented antifungal activity against Beauveria bassiana sensu lato isolates CG 138, CG 228 and ESALQ 986. This result suggests that the larval microbiota is a factor that can compromise the use of B. bassiana s.l. fungus for biological control of S. calcitrans larvae.

A microbiota presente em larvas de Stomoxys calcitrans pode auxiliar na sua sobrevivência em ambientes contaminados, devido à produção de substâncias inibidoras. Métodos bacteriológicos de identificação, reação em cadeia da polimerase (PCR) e microscopia eletrônica de varredura (MEV) foram utilizados para detectar uma bactéria naturalmente presente no muco e macerado de larvas de S. calcitrans. A atividade antifúngica foi baseada nos resultados obtidos no teste de difusão em meio sólido artificial. A bactéria foi identificada como Stenotrophomonas maltophilia e apresentou atividade antifúngica contra os isolados CG 138, CG 228 e ESALQ 986 de Beauveria bassiana sensu lato. Estes resultados sugerem que a microbiota larval é um fator que pode comprometer o uso de B. bassiana s.l. no controle biológico de larvas de S. calcitrans.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae) / Eventos histológicos e detecção de Metarhizium anisopliae usando primers específicos em estágios imaturos da mosca das frutas Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

O fungo Metarhizium anisopliae é usado em larga escala no Brasil como um agente de controle microbiológico contra a cigarrinha da cana-de-açúcar, Mahanarva posticata e M. fimbriolata (Hemiptera, Cercopidae). Aplicou-se a linhagem E9 de M. anisopliae em bioensaio no solo, nas dosagens de campo, para se determinar se este poderia causar infecção, doença e morte a estágios imaturos de Anastrepha fraterculus, a mosca sul-americana das frutas. Todos os eventos foram estudados histologicamente e ao nível molecular durante o ciclo da doença, usando-se uma nova técnica de coloração, o corante light Green, associado com a microscopia de luz, e a técnica do PCR, usando-se primers específicos desenvolvidos para M. anisopliae linhagens brasileiras, entre elas a E9. O ciclo infectivo, que se inicia pela adesão do conídio sobre a cutícula do hospedeiro, seguido da germinação, com ou sem a formação de apressório, penetração através da cutícula, colonização, com desenvolvimento da fase dimórfica, corpos hifais na hemocela com a morte do hospedeiro, dura 96 horas, nas condições do bioensaio, similar às condições de campo. Durante o ciclo da doença, propágulos do fungo entomopatogênico foram detectados pela identificação do DNA com primer específico ITSMet: 5'TCTGAATTTTTTATAAGTAT3' com o ITS4 (5'TCCTCCGCTTATTGATATGC3') como primer reverso. Esta metodologia simples permite o estudo in situ do processo infectivo, contribuindo com o entendimento da relação entre patógeneo hospedeiro e permitindo o monitoramento da eficácia e sobrevivência deste fungo entomopatogênico em aplicações em larga escala no campo. Esta também permite e facilita o monitoramento do impacto de M. anisopliae sobre insetos não alvos.

Detection of Paenibacillus larvae by Real-Time PCR

Background: Paenibacillus larvae is the agent of the American Foulbrood disease (AFB), which may determine the death of the hive. The detection strategy for its diagnosis is based on clinical signs of disease, isolation and identification of P. larvae, which usually employs microbiological and biochemical methods. Recently, molecular methods based on analysis of 16S rDNA by conventional PCR have been adopted, providing greater security and analytical speed. The rapid diagnosis is important to minimize economic losses and assess routes of spread of the pathogen. Despite the strong existing sanitary control, P. larvae was recently identified in the Brazilian states of Rio Grande do Sul and Paraná. After that, outbreaks have been reported in neighboring countries. This investigation was conducted to develop a protocol for detection of P. larvae by real-time PCR, allowing the reduction in the time of diagnosis, without loss of robustness found in the conventional PCR methods. Materials, Methods & Results: Twenty-nine (29) P. larvae strains were evaluated by real-time PCR using SYBR Green. The primers Pltr-F/R were designed according to the sequence X60619 of 16S rDNA gene published in GenBank, to amplify a fragment of 74 base pairs. The target gene is highly conserved and specific to P. larvae. The amplification conditions consisted of 1 cycle of 50°C for 2 min and 1 cycle of 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. The fluorescence was monitored during the annealing at 60°C. The reactions were conducted in a 7500 Real Time PCR System equipment, using SYBRGreen PCR master mix (both Applied Biosystems), containing 2X Platinum SYBRGreen qPCR Supermix-UDG. The concentrations of primers were 1, 10 and 100 mM, and different concentrations of MgCl2 (0,0 mM de MgCl2, 1.0 mM de MgCl2, 2.0 mM de MgCl2 and 3.0 mM de MgCl2) were tested, with a final volume of 50 mL; 25 mL and 15 mL, containing a 5 mL sample.(...)

Detection of Paenibacillus larvae by Real-Time PCR

Background: Paenibacillus larvae is the agent of the American Foulbrood disease (AFB), which may determine the death of the hive. The detection strategy for its diagnosis is based on clinical signs of disease, isolation and identification of P. larvae, which usually employs microbiological and biochemical methods. Recently, molecular methods based on analysis of 16S rDNA by conventional PCR have been adopted, providing greater security and analytical speed. The rapid diagnosis is important to minimize economic losses and assess routes of spread of the pathogen. Despite the strong existing sanitary control, P. larvae was recently identified in the Brazilian states of Rio Grande do Sul and Paraná. After that, outbreaks have been reported in neighboring countries. This investigation was conducted to develop a protocol for detection of P. larvae by real-time PCR, allowing the reduction in the time of diagnosis, without loss of robustness found in the conventional PCR methods. Materials, Methods & Results: Twenty-nine (29) P. larvae strains were evaluated by real-time PCR using SYBR Green. The primers Pltr-F/R were designed according to the sequence X60619 of 16S rDNA gene published in GenBank, to amplify a fragment of 74 base pairs. The target gene is highly conserved and specific to P. larvae. The amplification conditions consisted of 1 cycle of 50°C for 2 min and 1 cycle of 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. The fluorescence was monitored during the annealing at 60°C. The reactions were conducted in a 7500 Real Time PCR System equipment, using SYBRGreen PCR master mix (both Applied Biosystems), containing 2X Platinum SYBRGreen qPCR Supermix-UDG. The concentrations of primers were 1, 10 and 100 mM, and different concentrations of MgCl2 (0,0 mM de MgCl2, 1.0 mM de MgCl2, 2.0 mM de MgCl2 and 3.0 mM de MgCl2) were tested, with a final volume of 50 mL; 25 mL and 15 mL, containing a 5 mL sample.(...)(AU)

Bacillus thuringiensis isolates entomopathogenic for Culex quinquefasciatus (Diptera: Culicidae) and Anticarsia gemmatalis (Lepidoptera: Noctuidae) / Isolados de Bacillus thuringiensis entomopatogênicos para Culex quinquefasciatus (Diptera: Culicidae) e Anticarsia gemmatalis (Lepidoptera: Noctuidae)

Samples of the Bacillus thuringiensis (Bt) were collected from soil and insects. Eight isolates were selected from rural soil, 15 from urban soil and 11 from insects. These were evaluated for entomopathogenicity against larvae of Anticarsia gemmatalis and Culex quinquefasciatus. The pathogenicity tests showed that a higher percentage of isolates were active against A. gemmatalis (60 percent) compared to C. quinquefasciatus (31 percent). Probit analysis (LC50) indicated that against A. gemmatalis four of the isolates presented values similar to the reference strain against A. gemmatalis, while against C. quinquefasciatus one isolate showed an LC50 similar to the reference strain (IPS-82). SDS-PAGE characterisation of two isolates showed a 27 kDa protein fraction related to the Bt subspecies israelensis cytolytic toxin (cyt) gene. One 130 kDa protein, possibly related to the Bt crystal inclusions (cry1) gene, was identified in the other two isolates, which were more toxic for lepidoptera; another isolate presented a protein of 100 kDa. Some new local Bt isolates had similar LC50 probit values to the reference strains.

Amostras de Bacillus thuringiensis (Bt) foram coletadas do solo e de insetos. Oito isolados foram coletados de solo rural, 15 de solo urbano e 11 de insetos, os quais foram avaliados quanto a sua entomopatogenicidade contra larvas de Anticarsia gemmatalis e Culex quinquefasciatus. Os testes de patogenicidade mostraram uma alta porcentagem de isolados ativos contra A. gemmatalis (60 por cento), comparado a C. quinquefasciatus (31 por cento). Por análise de probit (CL50), verificou-se que quatro isolados apresentaram valores similares aos da estirpe de referência contra A. gemmatalis, enquanto somente um isolado mostrou CL50 similar à estirpe de referência (IPS 82) contra C.quinquefasciatus. A caracterização por SDS-PAGE de dois isolados mostrou uma proteína de 27 kDa relativa à toxina citolítica (Cyt) de B. thuringiensis subespécie israelensis. Uma proteína de 130 kDa, possivelmente relacionada à família do gene cry 1, foi identificada em outros dois isolados, os quais foram mais tóxicos para lepidópteros, enquanto que os outros dois isolados apresentaram uma proteína de 100 kDa. Alguns novos isolados locais de B. thuringiensis apresentaram valores de CL50 similares às estirpes de referência.

Isolamento e seleção de fungos para controle de larvas de terceiro instar de Musca domestica / Isolation and selection of fungi in order to control Musca domestica third-instar larvae

O controle biológico no Brasil vem crescendo devido aos problemas gerados pelo uso indiscriminado de inseticidas químicos. A Musca domestica representa o maior problema em granjas avícolas devido às condições favoráveis para seu crescimento populacional. Sendo assim, foram realizadas capturas de dípteros muscoides em um aviário na região de Montes Claros, MG, usando armadilhas contendo isca química e captura por busca direta e, destas moscas, foram isolados e identificados fungos residentes nestes insetos. Os fungos isolados foram duas espécies do gênero Aspergillus sp., um do gênero Memnoniella sp., Scopulariopsis sp., Paecilomyces sp e um fungo da família Moniliaceae. Foram também requeridos junto ao CENARGEM/EMBRAPA as espécies de fungos entomopatogênicos Beauveria bassiana CG 470 e CG 472; Metarhizium anisopliae CG 34 e CG 312 e o Paecilomyces sp. CG 301. As espécies selecionadas para os bioensaios foram um Aspergillus sp., Memnoniella sp. e os Metarhizium anisopliae CG 34 e CG 312 por terem boa esporulação. Os fungos Aspergillus sp. e o Memnoniella sp. não apresentaram capacidade entomopatogênica, os fungos M. anisopliae CG 34 e CG 312 foram bastante eficientes em controlar a emergência dos adultos de M. domestica, mostrando-se bons agentes de controle biológico.

Use of biological control measures in Brazil has been increasing because of the problems generated from the indiscriminate use of chemical insecticides. Musca domestica represents the biggest problem to poultry farms due to the favorable conditions for its population growth. The present study was therefore conducted, beginning with captures of muscoid diptera on a poultry farm in the Montes Claros region, state of Minas Gerais, Brazil, using traps containing chemical bait and as well as capture by direct search, and the fungi resident on these flies was isolated and identified. The isolated fungi were two species of Aspergillus sp., one each from the genera Memnoniella sp., Scopulariopsis sp., Paecilomyces sp., and one fungi of the family Moniliaceae. Also, the entomopathogenic species of fungi Beauveria bassiana CG 470 and CG 472, Metarhizium anisopliae CG 34 and CG 312, and Paecilomyces sp. CG 301 were requested from CENARGEM/EMBRAPA. The species selected for the bioassays were Aspergillus sp., Memnoniella sp. and Metarhizium anisopliae CG 34 and CG 312. The fungi Aspergillus sp. and the Memnoniella sp. did not present entomopathogenic capacity; the fungi Metarhizium anisopliae CG 34 and CG 312 were sufficiently efficient in controlling the emergence of the adults of Musca domestica, showing themselves good agents of biological control.