Selectivity of Metarhizium anisopliae and Beauveria bassiana to adults of Telenomus podisi (Hymenoptera: Scelionidae) / Seletividade de Metarhizium anisopliae e Beauveria bassiana para adultos de Telenomus podisi (Hymenoptera: Scelionidae)

The selectivity of entomopathogenic fungi to non-target organisms needs to be considered in Integrated Pest Management (IPM), because even though they are biological control agents, if used incorrectly, they can negatively alter the functioning of agroecosystems. Therefore, studies that assess the selectivity of these fungi to beneficial organisms are extremely important. The objective of this work was to evaluate the selectivity of Metarhizium anisopliae (Metarril®) and Beauveria bassiana (Boveril®) to adults of Telenomus podisi Ashmead (Hymenoptera: Scelionidae), under laboratory conditions. The products were evaluated on adult females of T. podisi, at the concentrations recommended by the manufacturer. To this, 0.2 mL of suspensions of each product and control (treatments) were applied to the inner surface of glass tubes, and then a female T. podisi was placed in it (≤ 48 h of emergence). After 24 h of contact, cards with 25 eggs of Euschistus heros Fabricius (Hemiptera: Pentatomidae) were offered for 24 h (COF24). After this period, the COF24 were withdrawn. After 72 h of contact of the female with the tube surface, new E. heros egg cards were made available (COF72) for 24 h for T. podisi ovipositioning. The mortality of T. podisi females was evaluated daily to determine longevity, percentage of parasitism and emergence, sex ratio, and egg-adult period of the T. podisi offspring. Metarril® and Boveril®, considered selective for adult females of T. podisi, did not negatively affect most of the parameters evaluated.(AU)

A seletividade de fungos entomopatogênicos a organismos não-alvo deve ser considerada no Manejo Integrado de Pragas (MIP), pois mesmo sendo agentes de controle biológico, se utilizados de forma incorreta, podem alterar negativamente o funcionamento dos agroecossistemas. Portanto, estudos que avaliam a seletividade desses fungos a organismos benéficos são extremamente importantes. O objetivo deste trabalho foi avaliar a seletividade de Metarhizium anisopliae (Metarril®) e Beauveria bassiana (Boveril®) a adultos de Telenomus podisi Ashmead (Hymenoptera: Scelionidae), em condições de laboratório. Os produtos foram avaliados em fêmeas adultas de T. podisi, nas concentrações recomendadas pelo fabricante. Para tanto, 0,2 mL das suspensões de cada produto e controle (tratamentos) foram aplicados na superfície interna dos tubos de vidro, sendo então colocada uma fêmea de T. podisi (≤ 48 h de emergência). Após 24 h de contato, cartões com 25 ovos de Euschistus heros Fabricius (Hemiptera: Pentatomidae) foram oferecidos por 24 h (COF24). Após esse período, o COF24 foi retirado. Após 72 h de contato da fêmea com a superfície do tubo, foram disponibilizadas novas cartelas de ovos de E. heros (COF72) por 24 h para oviposição de T. podisi. A mortalidade de fêmeas de T. podisi foi avaliada diariamente para determinar longevidade, porcentagem de parasitismo e emergência, proporção sexual e período de ovo-adulto da prole de T. podisi. Metarril® e Boveril® foram considerados seletivos para fêmeas adultas de T. podisi, não afetaram negativamente a maioria dos parâmetros avaliados.(AU)

Pathogenicity of Metarhizium anisopliae and Beauveria bassiana fungi to Tetranychus ludeni (Acari: Tetranychidae) / Patogenicidade de fungos Metarhizium anisopliae e Beauveria bassiana ao Tetranychus ludeni (Acari: Tetranychidae)

The use of acaricides is the main control method for Tetranychus ludeni (Acari: Tetranychidae) in horticultural crops. This mite has been recorded causing damage to sweet potato (Ipomoea batatas L.). The use of pathogenic fungi is an alternative to chemical control. The objective was to evaluate the pathogenicity of the fungi Metarhizium anisopliae (Meetch) Sorok, and Beauveria bassiana (Bals.) Vuill. to phytophagous mite T. ludeni in sweet potato plants. Conidial suspensions of M. anisopliae and B. bassiana, at concentrations of 106 and 107 con.mL-1 were applied to sweet potato leaves. After 24 hours, five females of T. ludeni newly emerged were released on the leaves. The bioassay was arranged in a completely randomized design with factorial arrangement 2 × 2 (two species of fungi and two concentrations) plus the control (distilled water), with 10 repetitions per treatment. The evaluation consisted of observing of three biological parameters of the mite: mortality, oviposition, and repellency, after 24, 48, 72, and 96 hours of contact with the fungi. The isolates of M. anisopliae cause high mortality rates of T. ludeni in laboratory. Beauveria bassiana has the potential to suppress future generations of mite, reducing its oviposition rate. Repellency behavior was not observed.(AU)

O uso de acaricidas é o principal método de controle de Tetranychus ludeni (Acari: Tetranychidae) em cultivos hortícolas. Esse ácaro foi registrado causando danos em batata-doce (Ipomoea batatas (L.). A utilização de fungos patogênicos é uma alternativa ao controle químico. O objetivo foi avaliar a patogenicidade dos fungos Metarhizium anisopliae (Meetch) Sorok. e Beauveria bassiana (Bals.) Vuill. ao ácaro fitófago T. ludeni em batata-doce. Suspensões conidiais de M. anisopliae e B. bassiana, nas concentrações de 106 e 107 con.mL-1, foram aplicadas sobre folhas de batata-doce. Após 24 horas, cinco fêmeas recém-emergidas foram liberadas sobre as folhas. O bioensaio foi inteiramente randomizado, com arranjo fatorial 2 × 2 (duas espécies de fungos e duas concentrações) e controle (água destilada), com 10 replicações por tratamento. A avaliação consistiu na observação de três parâmetros biológicos do ácaro: mortalidade, oviposição e repelência, após 24, 48, 72 e 96 horas de contato com os fungos. Os isolados de M. anisopliae causam altas taxas de mortalidade de T. ludeni em laboratório. Beauveria bassiana tem potencial para suprimir futuras gerações do ácaro, reduzindo a taxa de oviposição. Comportamento de repelência nos ácaros não foi observado.(AU)

Pathogenicity of Metarhizium anisopliae and Beauveria bassiana fungi to Tetranychus ludeni (Acari: Tetranychidae) / Patogenicidade de fungos Metarhizium anisopliae e Beauveria bassiana ao Tetranychus ludeni (Acari: Tetranychidae)

The use of acaricides is the main control method for Tetranychus ludeni (Acari: Tetranychidae) in horticultural crops. This mite has been recorded causing damage to sweet potato (Ipomoea batatas L.). The use of pathogenic fungi is an alternative to chemical control. The objective was to evaluate the pathogenicity of the fungi Metarhizium anisopliae (Meetch) Sorok, and Beauveria bassiana (Bals.) Vuill. to phytophagous mite T. ludeni in sweet potato plants. Conidial suspensions of M. anisopliae and B. bassiana, at concentrations of 106 and 107 con.mL-1 were applied to sweet potato leaves. After 24 hours, five females of T. ludeni newly emerged were released on the leaves. The bioassay was arranged in a completely randomized design with factorial arrangement 2 × 2 (two species of fungi and two concentrations) plus the control (distilled water), with 10 repetitions per treatment. The evaluation consisted of observing of three biological parameters of the mite: mortality, oviposition, and repellency, after 24, 48, 72, and 96 hours of contact with the fungi. The isolates of M. anisopliae cause high mortality rates of T. ludeni in laboratory. Beauveria bassiana has the potential to suppress future generations of mite, reducing its oviposition rate. Repellency behavior was not observed.(AU)

O uso de acaricidas é o principal método de controle de Tetranychus ludeni (Acari: Tetranychidae) em cultivos hortícolas. Esse ácaro foi registrado causando danos em batata-doce (Ipomoea batatas (L.). A utilização de fungos patogênicos é uma alternativa ao controle químico. O objetivo foi avaliar a patogenicidade dos fungos Metarhizium anisopliae (Meetch) Sorok. e Beauveria bassiana (Bals.) Vuill. ao ácaro fitófago T. ludeni em batata-doce. Suspensões conidiais de M. anisopliae e B. bassiana, nas concentrações de 106 e 107 con.mL-1, foram aplicadas sobre folhas de batata-doce. Após 24 horas, cinco fêmeas recém-emergidas foram liberadas sobre as folhas. O bioensaio foi inteiramente randomizado, com arranjo fatorial 2 × 2 (duas espécies de fungos e duas concentrações) e controle (água destilada), com 10 replicações por tratamento. A avaliação consistiu na observação de três parâmetros biológicos do ácaro: mortalidade, oviposição e repelência, após 24, 48, 72 e 96 horas de contato com os fungos. Os isolados de M. anisopliae causam altas taxas de mortalidade de T. ludeni em laboratório. Beauveria bassiana tem potencial para suprimir futuras gerações do ácaro, reduzindo a taxa de oviposição. Comportamento de repelência nos ácaros não foi observado.(AU)

Infectivity of housefly, Musca domestica (Diptera: Muscidae) to different entomopathogenic fungi

The housefly Musca domestica is a worldwide insect pest that acts as a vector for many pathogenic diseases in both people and animals. The present study was conducted to evaluate the virulence of different local isolates of Beauveria bassiana, Metarhizium anisopliae and Isaria fumosorosea on M. domestica using two bioassay techniques: (1) adult immersion and (2) a bait method applied to both larvae and adults. The results showed evidence of a broad range of responses by both stages (larvae and adults) to the tested isolates of B. bassiana, M. anisopliae and I. fumosorosea. These responses were concentration-dependent, with mortality percentages ranging from 53.00% to 96.00%. Because it resulted in lower LC50 values and a shorter lethal time, B. bassiana (Bb-01) proved to be the most virulent isolate against both housefly larvae and adults. Sublethal doses of the tested isolates were also assessed to evaluate their effect on M. domestica fecundity and longevity. The fungal infections reduced housefly survival regardless of their sex and also decreased egg production in females.(AU)

Activity of some Brazilian isolates of Entomopathogenic fungi against the poultry red mite Dermanyssus gallinae de geer (Acari: Dermanyssidae)

Poultry red mite Dermanyssus gallinae is a cosmopolitan and hematophagous species commonly found in layer houses around the world. Poultry mite infestations may cause anemia, stress, low body weight and egg production, and mortality. Mite control is typically based on chemical products, but they are not effective and leave residues in eggs; therefore, alternative control methods, such as entomopathogenic fungi, need to researched. This study aimed at evaluating, in the laboratory, the activity of Brazilian isolates of entomopathogenic fungi against D. gallinae. The mites were collected from a commercial layer house and were sprayed with conidial suspensions (1 × 108 conidia/mL) of five isolates of Beauveria bassiana and Metarhizium anisopliae. All tested isolates were pathogenic for the red mite, with confirmed mortality ranging from 22.9 to 52.4%. This demonstrate the potential of the tested entomopathogenic fungi isolates for mite control, and reinforces the need for further studies with other isolates, application strategies, and with fungal formulations.

Activity of some Brazilian isolates of Entomopathogenic fungi against the poultry red mite Dermanyssus gallinae de geer (Acari: Dermanyssidae)

Poultry red mite Dermanyssus gallinae is a cosmopolitan and hematophagous species commonly found in layer houses around the world. Poultry mite infestations may cause anemia, stress, low body weight and egg production, and mortality. Mite control is typically based on chemical products, but they are not effective and leave residues in eggs; therefore, alternative control methods, such as entomopathogenic fungi, need to researched. This study aimed at evaluating, in the laboratory, the activity of Brazilian isolates of entomopathogenic fungi against D. gallinae. The mites were collected from a commercial layer house and were sprayed with conidial suspensions (1 × 108 conidia/mL) of five isolates of Beauveria bassiana and Metarhizium anisopliae. All tested isolates were pathogenic for the red mite, with confirmed mortality ranging from 22.9 to 52.4%. This demonstrate the potential of the tested entomopathogenic fungi isolates for mite control, and reinforces the need for further studies with other isolates, application strategies, and with fungal formulations.(AU)

Patogenicidade de isolados de fungos entomopatogênicos à Spodoptera frugiperda (Smith) (Lepidoptera: Noctuidae) / Patogenicity of entomopathogenic fungi to Spodoptera frugiperda (Smith) (Lepidoptera: Noctuidae)

Este trabalho teve como objetivo avaliar a patogenicidade, em condições de laboratório, de 49 isolados dos fungos entomopatogênicos das espécies Beauveria bassiana e Metarhizium anisopliae, contra lagartas de Spodoptera frugiperda. Lagartas de 3o ínstar foram imersas em suspensões de 1 × 109 conídios/mL de cada um dos isolados por 10 segundos. Posteriormente, foram individualizadas em placas de Petri com dieta artificial, sendo incubadas a 26 ± 1°C e 12 horas de fotofase, e avaliadas, diariamente, durante dez dias. Os isolados de B. bassian amostraram-se mais eficientes, com destaque para o Unioeste 26, que provocou 44,5% de mortalidade e gerou a maior quantidade de conídios nos testes de produção do fungo. Apesar da porcentagem de mortalidade baixa, tais estudos evidenciam potencial dos fungos entomopatogênicos como promissores agentes de controle de S. frugiperda.(AU)

This study aimed to evaluate the pathogenicity, under laboratory conditions, of 49 isolates of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae against Spodoptera frugiperda larvae. Insects (3rd instar caterpillars) were immersed in 1 × 109 conidia/mL suspensions of each of the isolates for 10 seconds. After that, caterpillars were individually placed in Petri dishes with artificial diet and incubated at 26 ± 1°C and 12 hours of photophase, and they were evaluated daily for ten days. The B. bassiana isolates were more efficient, mainly Unioeste 26 strain, which reached 44.5% mortality and generated the greatest number of conidia in production testing of the fungus. Despite the low mortality percentage, these studies showed the potential of entomopathogenic fungi as promising agents for the control of S. frugiperda.(AU)

Patogenicidade de isolados de fungos entomopatogênicos à Spodoptera frugiperda (Smith) (Lepidoptera: Noctuidae) / Patogenicity of entomopathogenic fungi to Spodoptera frugiperda (Smith) (Lepidoptera: Noctuidae)

Este trabalho teve como objetivo avaliar a patogenicidade, em condições de laboratório, de 49 isolados dos fungos entomopatogênicos das espécies Beauveria bassiana e Metarhizium anisopliae, contra lagartas de Spodoptera frugiperda. Lagartas de 3º ínstar foram imersas em suspensões de 1 × 10(9) conídios/mL de cada um dos isolados por 10 segundos. Posteriormente, foram individualizadas em placas de Petri com dieta artificial, sendo incubadas a 26 ± 1°C e 12 horas de fotofase, e avaliadas, diariamente, durante dez dias. Os isolados de B. bassian amostraram-se mais eficientes, com destaque para o Unioeste 26, que provocou 44,5% de mortalidade e gerou a maior quantidade de conídios nos testes de produção do fungo. Apesar da porcentagem de mortalidade baixa, tais estudos evidenciam potencial dos fungos entomopatogênicos como promissores agentes de controle de S. frugiperda.(AU)

This study aimed to evaluate the pathogenicity, under laboratory conditions, of 49 isolates of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae against Spodoptera frugiperda larvae. Insects (3rd instar caterpillars) were immersed in 1 × 10(9) conidia/mL suspensions of each of the isolates for 10 seconds. After that, caterpillars were individually placed in Petri dishes with artificial diet and incubated at 26 ± 1°C and 12 hours of photophase, and they were evaluated daily for ten days. The B. bassiana isolates were more efficient, mainly Unioeste 26 strain, which reached 44.5% mortality and generated the greatest number of conidia in production testing of the fungus. Despite the low mortality percentage, these studies showed the potential of entomopathogenic fungi as promising agents for the control of S. frugiperda.(AU)

Rendimento de conídios e germinação de diferentes isolados de Metarhizium anisopliae (Metsch.) Sorok. (Ascomycota: Clavicipitaceae) cultivados em arroz / Yield of conidia and germination of different isolates of Metarhizium anisopliae (Metsch) Sorok. (Ascomycota: Clavicipitaceae) grown on rice

O objetivo desta pesquisa foi determinar a produção e a viabilidade de diferentes isolados de Metarhizium anisopliae em arroz. Foram colocados em sacos de polipropileno medindo 35 cm de comprimento e 22 cm de largura 100 g de arroz pré-cozido, imediatamente autoclavados a 120 °C, por 25 minutos. Após o resfriamento do arroz, inoculou-se 1 mL de uma suspensão contendo 1,0 x 109 conídios/mL de cada isolado testado, sendo acondicionados em câmara climatizada à temperatura de 25 ± 1°C, 70 ± 10% de UR e fotofase de 12 horas de incubação por 10 dias. Decorrido esse período, o arroz + fungo foi acondicionado em bandejas plásticas para promover a conidiogênese do fungo, dentro da câmara climática a 25 ± 1°C, 70 ± 10% de UR e fotofase de 12 horas. As bandejas ficaram empilhadas por quatro dias, cruzando-as por mais quatro dias. O isolado IBCB 425 foi o que mais produziu conídios em arroz com 1,82 x 109 conídios/g de arroz pré-cozido pelo método de bandeja. Com relação à viabilidade dos isolados, o IBCB 425 também apresentou maior capacidade de germinação dos conídios, com 94,84%.(AU)

In order to determine the production and viability of different isolates of Metarhizium anisopliae, 100 g of pre-cooked rice were placed in 35 cm long and 22 cm wide polypropylene bags, being immediately autoclaved at 120°C for 25 minutes. After cooling down, the rice was inoculated with 1 mL of a suspension containing 1,0 x 109 conidia/mL, packed in an incubator at 25 ± 1°C, 70 ± 10% RH and 12 hours of photophase. Plastic bags containing rice + fungus were incubated for 10 days. After this period, rice + fungus was packed in plastic trays to promote fungal conidiogenesis, within the climatic chamber at 2 5 ±1°C, 70 ± 10% RH and 12 hours of photophase. The trays were stacked for four days, being crossed for another four days. The IBCB 425 isolate was the most produced conidia on rice with 1.82 x 109 conidia/g of pre-cooked rice by the tray method. Regarding the viability of the isolates, IBCB 425 also showed a higher germination of conidia, with 94.84%.(AU)

Rendimento de conídios e germinação de diferentes isolados de Metarhizium anisopliae (Metsch.) Sorok. (Ascomycota: Clavicipitaceae) cultivados em arroz / Yield of conidia and germination of different isolates of Metarhizium anisopliae (Metsch) Sorok. (Ascomycota: Clavicipitaceae) grown on rice

O objetivo desta pesquisa foi determinar a produção e a viabilidade de diferentes isolados de Metarhizium anisopliae em arroz. Foram colocados em sacos de polipropileno medindo 35 cm de comprimento e 22 cm de largura 100 g de arroz pré-cozido, imediatamente autoclavados a 120 °C, por 25 minutos. Após o resfriamento do arroz, inoculou-se 1 mL de uma suspensão contendo 1,0 x 10(9) conídios/mL de cada isolado testado, sendo acondicionados em câmara climatizada à temperatura de 25 ± 1°C, 70 ± 10% de UR e fotofase de 12 horas de incubação por 10 dias. Decorrido esse período, o arroz + fungo foi acondicionado em bandejas plásticas para promover a conidiogênese do fungo, dentro da câmara climática a 25 ± 1°C, 70 ± 10% de UR e fotofase de 12 horas. As bandejas ficaram empilhadas por quatro dias, cruzando-as por mais quatro dias. O isolado IBCB 425 foi o que mais produziu conídios em arroz com 1,82 x 10(9) conídios/g de arroz pré-cozido pelo método de bandeja. Com relação à viabilidade dos isolados, o IBCB 425 também apresentou maior capacidade de germinação dos conídios, com 94,84%.(AU)

In order to determine the production and viability of different isolates of Metarhizium anisopliae, 100 g of pre-cooked rice were placed in 35 cm long and 22 cm wide polypropylene bags, being immediately autoclaved at 120°C for 25 minutes. After cooling down, the rice was inoculated with 1 mL of a suspension containing 1,0 x 10(9) conidia/mL, packed in an incubator at 25 ± 1°C, 70 ± 10% RH and 12 hours of photophase. Plastic bags containing rice + fungus were incubated for 10 days. After this period, rice + fungus was packed in plastic trays to promote fungal conidiogenesis, within the climatic chamber at 2 5 ±1°C, 70 ± 10% RH and 12 hours of photophase. The trays were stacked for four days, being crossed for another four days. The IBCB 425 isolate was the most produced conidia on rice with 1.82 x 10(9) conidia/g of pre-cooked rice by the tray method. Regarding the viability of the isolates, IBCB 425 also showed a higher germination of conidia, with 94.84%.(AU)

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae) / Eventos histológicos e detecção de Metarhizium anisopliae usando primers específicos em estágios imaturos da mosca das frutas Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

O fungo Metarhizium anisopliae é usado em larga escala no Brasil como um agente de controle microbiológico contra a cigarrinha da cana-de-açúcar, Mahanarva posticata e M. fimbriolata (Hemiptera, Cercopidae). Aplicou-se a linhagem E9 de M. anisopliae em bioensaio no solo, nas dosagens de campo, para se determinar se este poderia causar infecção, doença e morte a estágios imaturos de Anastrepha fraterculus, a mosca sul-americana das frutas. Todos os eventos foram estudados histologicamente e ao nível molecular durante o ciclo da doença, usando-se uma nova técnica de coloração, o corante light Green, associado com a microscopia de luz, e a técnica do PCR, usando-se primers específicos desenvolvidos para M. anisopliae linhagens brasileiras, entre elas a E9. O ciclo infectivo, que se inicia pela adesão do conídio sobre a cutícula do hospedeiro, seguido da germinação, com ou sem a formação de apressório, penetração através da cutícula, colonização, com desenvolvimento da fase dimórfica, corpos hifais na hemocela com a morte do hospedeiro, dura 96 horas, nas condições do bioensaio, similar às condições de campo. Durante o ciclo da doença, propágulos do fungo entomopatogênico foram detectados pela identificação do DNA com primer específico ITSMet: 5'TCTGAATTTTTTATAAGTAT3' com o ITS4 (5'TCCTCCGCTTATTGATATGC3') como primer reverso. Esta metodologia simples permite o estudo in situ do processo infectivo, contribuindo com o entendimento da relação entre patógeneo hospedeiro e permitindo o monitoramento da eficácia e sobrevivência deste fungo entomopatogênico em aplicações em larga escala no campo. Esta também permite e facilita o monitoramento do impacto de M. anisopliae sobre insetos não alvos.

Produção semissólida de Metarhizium anisopliae e Beauveria bassiana em diferentes substratos e efeito da radiação ultravioleta e da temperatura sobre propágulos desses entomopatógenos / Semi-solid production of Metarhizium anisopliae (Metsch) Sorok and Beauveria bassiana (Bals) Vuill on different media and the effects of ultraviolet radiation and temperature on the infective propagules of these fungi

O trabalho teve os seguintes objetivos: 1) avaliar diferentes substratos para a produção semissólida dos fungos Metarhizium anisopliae e Beauveria bassiana; 2) verificar a tolerância dos conídios produzidos ao efeito da radiação ultravioleta e da temperatura; e 3) avaliar a patogenicidade dos conídios a Diatraea saccharalis. Para ambos os fungos, foram utilizadas 6 repetições para cada tratamento: amido de milho, arroz integral, arroz parboilizado tipo1, arroz tipo 1 e 2, aveia em flocos, canjiquinha, farelo de trigo, farinhas de mandioca crua, de milho amarela e de trigo especial, fubá, milho em grãos, polvilho azedo, soja em grãos, trigo moído e turfa. Os conídios foram quantificados em câmara de Neubauer e a determinação da viabilidade foi realizada através da observação em microscópio, dos conídios germinados e não germinados, após espalhamento da suspensão fúngica em placas de Petri contendo BDA. No ensaio com radiação os fungos foram expostos à radiação por 25 e 50 segundos e foi considerado um tratamento sem exposição; para temperatura os fungos foram expostos a 20, 25, 30 e 35o C. Utilizando a torre de Potter, 2 mL de cada suspensão fúngica dos tratamentos foram pulverizados em lagartas de D. saccharalis. As maiores concentrações de conídios de M. anisopliae e B. bassiana foram encontradas nos tratamentos com arroz parboilizado tipo 1, arroz tipo 1 e 2, farinha de milho amarela, fubá e trigo moído e a viabilidade dos conídios produzidos superou os 94%. Quanto maior o tempo de exposição à radiação menor foi o número de conídios viáveis; também ocorreu perda significativa da viabilidade dos conídios quando expostos à temperatura de 35o C. Os fungos foram patogênicos para D. saccharalis.

The present study was aimed to evaluate different (semi-solid) media for the production of Metarhizium anisopliae and Beauveria bassiana propagules, and to evaluate the tolerance of these propagules to ultraviolet radiation and temperature. The experiments were performed at the Biological Control Laboratory of the Instituto Biológico at Campinas, São Paulo, Brazil. For both fungi, 6 repetitions were performed for each of the 17 treatments: corn starch, full rice, parboiled rice, type-1 rice, type-2 rice, oat flakes, canjiquinha [grits], wheat flour, raw cassava flour, yellow corn flour, special wheat flour, corn flour, corn in grains, cassava starch, soy in grains, crushed wheat, and turf. The viability analysis was done in plastic plates containing BDA. For the bioassays involving exposure to ultraviolet light and temperature, BDA was also used for viability analysis, and each treatment was exposed to the UV radiation for 0, 25 and 50 seconds, the temperature exposure being at 20, 25, 30 and 35º C. Using a Potter tower, 2 mL of fungus suspension from each treatment was inoculated to the Diatraea saccharalis caterpillars. Regarding the sporulation, the largest concentrations of M. anisopliae and B. bassiana were found for the treatments with parboiled rice, type-1 rice, type-2 rice, yellow corn flour, corn flour and crushed wheat. The viability of all treatments was superior to 94.00%. Also, the longer the duration of the exposition to the UV, the 2Universidade Estadual Paulista, Faculdade de Ciências Agronômicas, Botucatu, SP, Brasil.

Ação do fungo Metarhizium anisopliae sobre desenvolvimento do díptero Muscina stabulans em laboratório / Action of Metarhizium anisopliae fungi over the development of Muscina stabulans dipteran in laboratory

Avaliou-se o desenvolvimento de Muscina stabulans (Diptera, Muscidae) após exposição ao fungo Metarhizium anisopliae (isolado CG34), sob condições de laboratório. Suspensões de esporos foram preparadas nas concentrações de 10(5), 10(6), 10(7) e 10(8)conídeos/mL-1. Noventa larvas pós-alimentar por tratamento, distribuídas em cinco tratamentos e três repetições, foram mergulhadas por um segundo nas respectivas suspensões, transferidas para placas de Petri com papel filtro umedecido e mantidas em estufa BOD à temperatura de 25ºC, umidade relativa de 80 por cento e fotoperíodo de 12:12 horas até a emergência dos adultos. Foram avaliados a taxa de mortalidade pupal e o período de desenvolvimento pupal. As larvas apresentaram suscetibilidade à ação de M. anisopliae em diferentes concentrações. A mortalidade pupal assim como o tempo de desenvolvimento das pupas (de 8,8 a 10 dias) aumentaram conforme o aumento da concentração de conídios (de zero a 47 por cento). A aplicação de M. anisopliae nesta fase do ciclo biológico comprometeu o desenvolvimento de M. stabulans e interferiu no controle natural de pragas que se desenvolvem no mesmo ambiente.(AU)

The development of Muscina stabulans (Diptera, Muscidae) after exposure to Metarhizium anisopliae (CG34 isolated) fungi under laboratory conditions was evaluated. Suspensions of spores were prepared in concentrations of 10(5), 10(6), 10(7), and 10(8)conidia/mL-1. Ninety postfeeding larvae per treatment, divided into five treatments and three repetitions, were dived for one second in the respective suspensions, and transferred to Petri dishes with humidified filter paper and maintained in BOD at 25 ºC with 80 percent relative humidity and a 12:12h photoperiod, until the emergency of adults. The rate of pupal mortality and the period of pupal development were evaluated. The larvae showed susceptibility to the action of M. anisopliae in different levels of concentration. The pupal mortality increased accordingly to the increase in the conidia concentration (from zero to 47 percent), as well as prolonged the time of development of the pupae (from 8.8 to 10 days). The application of M. anisopliae in this phase of the biological cycle compromised the development of M. stabulans and interfered in the natural control of pests that develop in the same environment.(AU)

Análise de adesão do fungo entomopatogênico Metarhizium anisopliae para o controle de Alphitobius diaperinus (cascudinho) em instalações avícolas / Analysis of entomogenous fungus Metarhizium anisopliae to control Alphitobius diaperinus in poultry buildings

Este trabalho permitiu a construção de um modelo estatístico para a adesão de conídios do fungo Metarhizium anisopliae diante de diferentes níveis de concentração e tempo, além de avaliar seu potencial para o controle do cascudinho (Alphitobius diaperinus), importante praga da avicultura, causadora de danos às aves pelos ferimentos no trato digestivo e pela transmissão de várias doenças. O estudo da adesão sobre o tegumento é de grande importância, pois a adesão representa um evento complexo, sendo o primeiro do ciclo das relações patógeno-hospedeiro que ocorre após a deposição do fungo sobre o inseto e visa a preparação do local para a fase de penetração. Insetos adultos do cascudinho foram expostos a três concentrações do fungo: 1x10 elevado a 3, 1x10 elevado a 6 e 1x10 elevado a 9 conídios/mL, sendo 5, 10 e 15 minutos de exposição em cada concentração. Para verificar o potencial de controle de M. anisopliae, os insetos foram colocados para caminhar sobre uma massa de conídios crescida em meio BDA por 10 minutos, resultando num potencial de inóculo de 8,1x10 elevado a 8 conídios/mL, a mortalidade foi avaliada durante 21 dias consecutivos, onde se verificou uma mortalidade de 74% em larvas após 48h, e 50% de mortalidade em adultos após 15 dias de exposição ao fungo. A análise de variância (ANOVA) mostrou que existe influência e interação de ambos os efeitos: concentração e tempo.(AU)

This present research work has allowed a statistical modeling for conidial adhesion and the potential fungus Metarhizium anisopliae ability to lesser the mealworm Alphitobius diaperinus control, that is an important pest of poultry production, which causes damage to the birds by the development of injuries in the digestion tract, and yet it serves as vector of many avian pathogens. The study of the host cuticle adhesion is very important, whereas the adhesion process represents a complex event, as it is the first occurrence in the pathogen-host cycle, taking place after fungus deposition on the insect, aiming the penetration phase. Adult insects of A. diaperinus were exposed to three concentrations of the fungus: 1x10 superscript to 3, 1x10 superscript to 6 e 1x10 superscript to 9 conidia/mL, for 5, 10 and 15 minutes of exposition to each conidial concentration. In order to verify the ability control of M. anisopliae, the insects were forced to the displacement on the conidial mass growth onto PDA medium for 10 minutes, resulting in a 8,1x10 superscript to 8 conidia/mL inocullum potential, and the mortality was monitored during 21 days, obtaining 74% of mortality in larvae after 48h and 50% of mortality in adults after 15 days, under fungus exposition. ANOVA has showed that there is influence and interaction between both effects: concentration and time.(AU)