Anemia hemolítica imunomediada medicamentosa em uma cadela / Immune-mediated hemolytic anemia in a bitch triggered by drugs

Background: Immune-mediated hemolytic anemia (IMHA) is characterized by an autoimmune response with production of auto-antibodies and destruction of erythrocytes resulting in anemia. Primary IMHA is referred to a condition when the cause is unknown (idiopathic), whereas secondary IMHA involves changes in red blood cells caused by the action of drugs, neoplasms, or infectious diseases. The diagnosis can be made through changes in the blood count, usually of a regenerative character, Coombs test, and autoagglutination test. The present study aimed to report a case of drug-induced hemolytic anemia, with emphasis on the clinical signs, diagnostic methods, and treatment, in a female dog. Case: A 9-year-old mixed-breed bitch weighing 29.6 kg was referred to the Veterinary Medical Teaching Hospital (HCVUFRGS) with a previous diagnosis of gallbladder mucocele that was unresponsive to clinical treatment. After laboratory tests, cholecystectomy was performed, and the procedure required conversion from laparoscopic to open cholecystectomy. Therapy included administration of amoxicillin, dipyrone, tramadol hydrochloride, and meloxicam. Three days after surgery, the dog presented with apathy, lethargy, hyporexia, and a pale and subicteric mucosa. The patient developed hypochromic macrocytic anemia with reticulocytosis, spherocytosis, anisocytosis, and leukocytosis with neutrophilia. The result of the autoagglutination test was positive, confirming the diagnosis. All medications were suspended, and immunosuppressive treatment with dexamethasone was included, with a subsequent switch to prednisolone. After 10 days of treatment, the patient experienced significant improvement, and therapy was discontinued. Discussion: Based on the patient's history, the cause of the IMHA was secondary to drug administration, and it is not possible to distinguish if it was due to one or a combination of drugs, as they were all started and stopped simultaneously. The patient had hypothyroidism, which may have contributed to the production of antibodies against TSH receptors, blocking the hormone's action, thereby causing tissue damage due to T cell-mediated cytotoxicity and the effect of cytokines. The pale and subicteric mucosa, apathy, weakness, lethargy, exercise intolerance, and dyspnea resulted from extravascular hemolysis and bilirubin released from erythrocyte rupture with a subsequent decrease in the number of red blood cells, leading to oxygen transport deficiency. The diagnosis is based on the blood count and results of autoagglutination supported by the response to immunosuppressive therapy. Anemia results in increased production and release of precursor cells from the bone marrow, accompanied by reticulocytosis and increased mean corpuscular volume (MCV) and mean corpuscular hemoglobin concentration (MCHC). The treatment of IMHA consists of supportive care and immunosuppressive therapy with corticosteroids to ensure suppression of the immune system, preventing response against erythrocytes. Initially, tramadol hydrochloride, dipyrone, and amoxicillin with potassium clavulanate were suspended to interrupt the cause of IMHA, and administration of dexamethasone in an immunosuppressive dose was started. Therefore, it is important to include drug-induced IMHA in the differential diagnosis of patients who present with anemia after using medications. Early diagnosis, initiation of therapy, and adequate care were important factors for the recovery of the animal.

Hemólise interfere na mensuração dos biomarcadores plasmáticos de estresse oxidativo em cães / Hemolysis interferes in the measurement of plasma biomakers of oxidative stress in dogs

Considerando que, entre todas as fontes de erro analítico, a hemólise é a mais importante na rotina laboratorial, o presente estudo teve como objetivo investigar o efeito da hemólise in vitro sobre os principais biomarcadores plasmáticos de estresse oxidativo mensurados (BPEO) de cães. Para tal, amostras de sangue total de 19 cães clinicamente saudáveis foram hemolisadas em diferentes graus por ação mecânica. Amostras controle contendo baixa concentração de hemoglobina (Hb) no plasma foram comparadas com quatro graus de hemólise (<0,36; 0,36-0,60; 0,61-1,0; 1,1-4g/L Hb). Imediatamente após a hemólise, foram mensuradas as concentrações plasmáticas de ácido úrico (AU), albumina, bilirrubina, gamaglutamiltransferase (GGT), capacidade antioxidante total (TAC) e concentração de oxidante total (TOC). Os erros relativos causados pelos diferentes graus de hemólises foram calculados e confrontados com o erro total aceitável (ETA) e com o limite de erro permitido (LEP) empregados nos programas de controle de qualidade de exames laboratoriais. Foi observado que mesmo pequeno grau de hemólise gera algum erro analítico não aceitável (ETA e/ou LEP) nos BPEO mensurados, exceto na bilirrubina. Foi possível concluir que a hemólise é um fator limitante para avaliação do estresse oxidativo sistêmico mensurado no plasma, podendo causar erros que potencialmente comprometem o diagnóstico clínico.(AU)

Among all the various sources of analytical error, hemolysis is the most important in the laboratory routine. The present study aimed to investigate the effect of hemolysis "in vitro" on the main plasma biomarkers of oxidative stress (BPEO) dogs. For this purpose, whole blood samples from 19 healthy dogs were hemolyzed in different degrees by mechanical action. Control samples containing low concentration of hemoglobin (Hb) levels in plasma were compared with four degrees of hemolysis (<0.36, from 0.36 to 0.60, 0.61 to 1.0, 1.1 to 4g/L Hb). Immediately after causing hemolysis, plasma concentrations of uric acid (UA), albumin, bilirubin, gamma glutamyl transferase (GGT), total antioxidant capacity (TAC), and total oxidant concentration (TOC) were measured. The relative errors caused by several levels of hemolysis were calculated and compared with the total acceptable error (TAE) and allowed error limit (LEP) by employees in quality control programs for laboratory tests. Even small levels of hemolysis generate unacceptable analytical error (TAE and / or LEP) in BPEO measured, except for bilirubin. Hemolysis is a limiting factor for the assessment of systemic oxidative stress measured in plasma and may cause errors that potentially compromise clinical diagnosis.(AU)

Hemólise interfere na mensuração dos biomarcadores plasmáticos de estresse oxidativo em cães / Hemolysis interferes in the measurement of plasma biomakers of oxidative stress in dogs

Considerando que, entre todas as fontes de erro analítico, a hemólise é a mais importante na rotina laboratorial, o presente estudo teve como objetivo investigar o efeito da hemólise in vitro sobre os principais biomarcadores plasmáticos de estresse oxidativo mensurados (BPEO) de cães. Para tal, amostras de sangue total de 19 cães clinicamente saudáveis foram hemolisadas em diferentes graus por ação mecânica. Amostras controle contendo baixa concentração de hemoglobina (Hb) no plasma foram comparadas com quatro graus de hemólise (<0,36; 0,36-0,60; 0,61-1,0; 1,1-4g/L Hb). Imediatamente após a hemólise, foram mensuradas as concentrações plasmáticas de ácido úrico (AU), albumina, bilirrubina, gamaglutamiltransferase (GGT), capacidade antioxidante total (TAC) e concentração de oxidante total (TOC). Os erros relativos causados pelos diferentes graus de hemólises foram calculados e confrontados com o erro total aceitável (ETA) e com o limite de erro permitido (LEP) empregados nos programas de controle de qualidade de exames laboratoriais. Foi observado que mesmo pequeno grau de hemólise gera algum erro analítico não aceitável (ETA e/ou LEP) nos BPEO mensurados, exceto na bilirrubina. Foi possível concluir que a hemólise é um fator limitante para avaliação do estresse oxidativo sistêmico mensurado no plasma, podendo causar erros que potencialmente comprometem o diagnóstico clínico.(AU)

Among all the various sources of analytical error, hemolysis is the most important in the laboratory routine. The present study aimed to investigate the effect of hemolysis "in vitro" on the main plasma biomarkers of oxidative stress (BPEO) dogs. For this purpose, whole blood samples from 19 healthy dogs were hemolyzed in different degrees by mechanical action. Control samples containing low concentration of hemoglobin (Hb) levels in plasma were compared with four degrees of hemolysis (<0.36, from 0.36 to 0.60, 0.61 to 1.0, 1.1 to 4g/L Hb). Immediately after causing hemolysis, plasma concentrations of uric acid (UA), albumin, bilirubin, gamma glutamyl transferase (GGT), total antioxidant capacity (TAC), and total oxidant concentration (TOC) were measured. The relative errors caused by several levels of hemolysis were calculated and compared with the total acceptable error (TAE) and allowed error limit (LEP) by employees in quality control programs for laboratory tests. Even small levels of hemolysis generate unacceptable analytical error (TAE and / or LEP) in BPEO measured, except for bilirubin. Hemolysis is a limiting factor for the assessment of systemic oxidative stress measured in plasma and may cause errors that potentially compromise clinical diagnosis.(AU)

Principais causas de anemia hemolítica nos animais domésticos

A anemia causada por destruição acelerada dos eritrócitos devido a hemólise, é denominada anemia hemolítica. Podendoser extravascular (hemácias são destruídas pelas células fagocíticas mononucleares) ou intravascular (lise direta dashemácias causada por anticorpo-complemento, drogas, fragmentos de fibrina, toxinas, agentes infecciosos, desequilíbriometabólico. Se manifestam de forma adquirida (devido a um defeito intracelular restrito a apenas uma proteína) oucongênita (anomalia resultante na síntese do grupo heme, podendo levar ao quadro de anemia). As anemias hemolíticaspodem ter várias causas como imunomediada, anemia hemolítica de origem tóxica e anemia hemolítica de origem parasitária.

Anemia caused by accelerated destruction of erythrocytes due to hemolysis is termed hemolytic anemia. They may beextravascular (red cells destroyed by mononuclear phagocytic cells) or intravascular (direct lysis of the red blood cellscaused by antibody-complement, drugs, fibrin fragments, toxins, infectious agents, metabolic disequilibrium.) Theymanifest themselves in an acquired form (due to an intracellular defect Restricted to only one protein) or congenital(resulting anomaly in the synthesis of the heme group, which may lead to anemia). Hemolytic anemia may have severalcauses such as immunomediated, hemolytic anemia of toxic origin and haemolytic anemia of parasitic origin.

Composition and biological activities of the aqueous extracts of three scleractinian corals from the Mexican Caribbean: Pseudodiploria strigosa, Porites astreoides and Siderastrea siderea

Background: Scleractinian corals (stony corals) are the most abundant reef-forming cnidarians found in coral reefs throughout the world. Despite their abundance and ecological importance, information about the diversity of their toxins and their biological activities is very scarce. In this study, the chemical composition and the biological activities of the aqueous extracts of Pseudodiploria strigosa, Porites astreoides and Siderastrea siderea, three scleractinian corals from the Mexican Caribbean, have been assessed for the first time. Methods: Toxicity of the extracts was assessed in crickets; the presence of cytolysins was detected by the hemolysis assay; the vasoconstrictor activity was determined by the isolated rat aortic ring assay; the nociceptive activity was evaluated by the formalin test. The presence of phospholipases A2 (PLA2), serine proteases, and hyaluronidases was determined by enzymatic methods. Low-molecular-weight fractions were obtained by gel filtration chromatography and ultrafiltration. Results: Extracts from the three species were toxic to crickets, induced hemolysis in human and rat erythrocytes, produced vasoconstriction on isolated rat aortic rings, and presented phospholipase A2 and serine-protease activity. Despite the fact that these corals are not considered to be harmless to humans, the extracts generated significant nociceptive responses. The matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry analysis of the low-molecular-weight fractions revealed the presence of peptides within a mass range of 3000 to 6000 Da. These fractions were toxic to crickets and two of them induced a transitory vasoconstrictor effect on isolated rat aortic rings. Conclusion: This study suggests that scleractinian corals produce low-molecular-weight peptides that are lethal to crickets and induce vasoconstriction.(AU)

Cytolytic and systemic toxic effects induced by the aqueous extract of the fire coral Millepora alcicornis collected in the Mexican Caribbean and detection of two types of cytolisins

Background Millepora alcicornis is a branching hydrocoral common throughout the Caribbean Sea. Like other members of this genus, this species is capable of inducing skin eruptions and blisters with severe pain after contact. In the present study, we investigated the toxicity of theM. alcicornis aqueous extract on several animal models. Considering that some cnidarian hemolysins have been associated to local tissue damage, since they also induce lysis of other cell types, we also made a partial characterization of the hemolytic activity of M. alcicornis aqueous extract. This information is important for understanding the defense mechanisms of the "fire corals".Methods The effects of pH, temperature, and some divalent cations on the hemolytic activity of the extract were assayed, followed by a zymogram analysis to detect the cytolysins and determine their approximate molecular weight. The toxicity of the aqueous extract was assayed in mice, by intravenous administration, and histopathological changes on several tissues were analyzed by light microscopy. The toxicity of the extract was also tested inArtemia salina nauplii, and the damages caused on the crustaceans were analyzed by transmission and scanning electron microscopy.Results The hemolytic activity of the hydrocoral extract was enhanced in the presence of Ca 2+ (≥2 mM), Mg 2+ (≥6 mM), and Ba2+ (≥0.1 mM); however, it was reduced in the presence of Cu2+(≥0.1 mM), Zn 2+ (≥6 mM), and EDTA (≥0.34 mM). Differences in the pH did not affect the hemolytic activity, but it was temperature-sensitive, since preincubation at ≥ 50 °C sharply reduced hemolysis. The zymogram showed the presence of two types of hemolysins: ~ 28-30 kDa proteins with phospholipase A 2 activity and ~ 200 kDa proteins that do not elicit enzymatic activity. The aqueous extract of this cnidarian was lethal to mice (LD 50 = 17 μg protein/g), and induced kidney, liver, and lung damages. Under denaturing conditions, the aqueous extract completely lost its toxic and hemolytic activities.Conclusions The results showed that the M. alcicornis aqueous extract contains two types of thermolabile hemolysins: proteins of approximately 28-30 kDa with PLA 2 activity, while the others are larger proteins of approximately 200 kDa, which do not possess PLA 2activity. Those thermolabile cytolysins, which are stable to pH changes and whose activity is calcium dependent, are capable of inducing damage in lung, kidney and liver tissues, resulting in a slow death of mice. M. alcicorniscytolysins also provoke tissue dissociation inArtemia salina nauplii that might be attributed to pore forming mechanisms.(AU)

A PCR for differentiate between Anaplasma marginale and A. centrale

Background: Anaplasma marginale ssp. centrale (A. centrale) exhibits low pathogenicity and therefore is used as a live vaccine against bovine anaplasmosis in several countries. During production of the vaccine, accidental contamination with Anaplasma marginale (A. marginale) is a risk that can jeopardize the entire batch of vaccine. Due to limitation of microscopic examination to detect low levels of parasitaemia, the present study aims to standardize a polymerase chain reaction assay using primers for the msp4 gene of Anaplasma sp. for detecting and differentiating with greater sensitivity and specificity the species of A. centrale and A. marginale in blood samples from experimentally infected cattle.Materials, Methods & Results: The DNA extraction was performed from frozen blood. Erythrocytes infected with known A. centrale, A. marginale served as positive control and the erytrocytes infected with Babesia bovis and Babesia bigemina served as the negative control polymerase chain reaction. PCR was standardized from annealing temperature variations of the primers, magnesium chloride concentration, amounts concentration of primers and DNA concentration of rickettsiae. By PCR method, it was analyzed the DNA from blood samples of 13 cattle positive to A. marginale by microscopic examination from smear stained with Giemsa. The PCR assay was specific for A. centrale and A. marginale, presented 100% identity without presenting cross-reactivity with other bovine hemoparasites. The detection limits of the PCR were 0.25 pg and 0.125 pg of DNA for detection of A. centrale and A. marginale DNA respectively.Discussion: A. marginale is an obligate intracellular bacterium that infects bovine erythrocytes causing extravascular hemolysis and anemia being considered the main agent of bovine anaplasmosis.[...](AU)

A PCR for differentiate between Anaplasma marginale and A. centrale

Background: Anaplasma marginale ssp. centrale (A. centrale) exhibits low pathogenicity and therefore is used as a live vaccine against bovine anaplasmosis in several countries. During production of the vaccine, accidental contamination with Anaplasma marginale (A. marginale) is a risk that can jeopardize the entire batch of vaccine. Due to limitation of microscopic examination to detect low levels of parasitaemia, the present study aims to standardize a polymerase chain reaction assay using primers for the msp4 gene of Anaplasma sp. for detecting and differentiating with greater sensitivity and specificity the species of A. centrale and A. marginale in blood samples from experimentally infected cattle.Materials, Methods & Results: The DNA extraction was performed from frozen blood. Erythrocytes infected with known A. centrale, A. marginale served as positive control and the erytrocytes infected with Babesia bovis and Babesia bigemina served as the negative control polymerase chain reaction. PCR was standardized from annealing temperature variations of the primers, magnesium chloride concentration, amounts concentration of primers and DNA concentration of rickettsiae. By PCR method, it was analyzed the DNA from blood samples of 13 cattle positive to A. marginale by microscopic examination from smear stained with Giemsa. The PCR assay was specific for A. centrale and A. marginale, presented 100% identity without presenting cross-reactivity with other bovine hemoparasites. The detection limits of the PCR were 0.25 pg and 0.125 pg of DNA for detection of A. centrale and A. marginale DNA respectively.Discussion: A. marginale is an obligate intracellular bacterium that infects bovine erythrocytes causing extravascular hemolysis and anemia being considered the main agent of bovine anaplasmosis.[...]

Characteristics of hemolytic activity induced by the aqueous extract of the Mexican fire coral Millepora complanata

Background Millepora complanata is a plate-like fire coral common throughout the Caribbean. Contact with this species usually provokes burning pain, erythema and urticariform lesions. Our previous study suggested that the aqueous extract of M. complanata contains non-protein hemolysins that are soluble in water and ethanol. In general, the local damage induced by cnidarian venoms has been associated with hemolysins. The characterization of the effects of these components is important for the understanding of the defense mechanisms of fire corals. In addition, this information could lead to better care for victims of envenomation accidents.Methods An ethanolic extract from the lyophilized aqueous extract was prepared and its hemolytic activity was compared with the hemolysis induced by the denatured aqueous extract. Based on the finding that ethanol failed to induce nematocyst discharge, ethanolic extracts were prepared from artificially bleached and normal M. complanata fragments and their hemolytic activity was tested in order to obtain information about the source of the heat-stable hemolysins.Results Rodent erythrocytes were more susceptible to the aqueous extract than chicken and human erythrocytes. Hemolytic activity started at ten minutes of incubation and was relatively stable within the range of 28-50°C. When the aqueous extract was preincubated at temperatures over 60°C, hemolytic activity was significantly reduced. The denatured extract induced a slow hemolytic activity (HU50= 1,050.00 ± 45.85 μg/mL), detectable four hours after incubation, which was similar to that induced by the ethanolic extract prepared from the aqueous extract (HU50= 1,167.00 ± 54.95 μg/mL). No significant differences were observed between hemolysis induced by ethanolic extracts from bleached and normal fragments, although both activities were more potent than hemolysis induced by the denatured extract.Conclusions The results showed that the aqueous extract of M. complanata possesses one or more powerful heat-labile hemolytic proteins that are slightly more resistant to temperature than jellyfish venoms. This extract also contains slow thermostable hemolysins highly soluble in ethanol that are probably derived from the body tissues of the hydrozoan.(AU)

Prevalence and phenotypic characterization of Enterococcus spp. isolated from food in Brazil

We evaluated the frequency of enterococci from food and found 95.2% of positivity, being E. faecium and E. faecalis the most frequent species. High-level streptomycin resistance was observed, as well as gelatinase and hemolysis activity, showing the potential role of environmental strains as reservoir of virulence and resistance traits.(AU)

Molecular detection of virulence factors among food and clinical Enterococcus faecalis strains in South Brazil

The present report aimed to perform a molecular epidemiological survey by investigating the presence of virulence factors in E. faecalis isolated from different human clinical (n = 57) and food samples (n = 55) in Porto Alegre, Brazil, collected from 2006 to 2009. In addition, the ability to form biofilm in vitro on polystyrene and the β-haemolytic and gelatinase activities were determined. Clinical strains presented a higher prevalence of aggregation substance (agg), enterococcal surface protein (esp) and cytolysin (cylA) genes when compared with food isolates. The esp gene was found only in clinical strains. On the other hand, the gelatinase (gelE) and adherence factor (ace) genes had similar prevalence among the strains, showing the widespread occurrence of these virulence factors among food and clinical E. faecalis strains in South Brazil. More than three virulence factor genes were detected in 77.2% and 18.2% of clinical and food strains, respectively. Gelatinase and β-haemolysin activities were not associated with the presence of gelE and cylA genes. The ability to produce biofilm was detected in 100% of clinical and 94.6% of food isolates, and clinical strains were more able to form biofilm than the food isolates (Student's t-test, p < 0.01). Results from the statistical analysis showed significant associations between strong biofilm formation and ace (p = 0.015) and gelE (p = 0.007) genes in clinical strains. In conclusion, our data indicate that E. faecalis strains isolated from clinical and food samples possess distinctive patterns of virulence factors, with a larger number of genes that encode virulence factors detected in clinical strains.(AU)

Characteristics of hemolytic activity induced by skin secretions of the frog Kaloula pulchra hainana

The hemolytic activity of skin secretions obtained by stimulating the frog Kaloula pulchra hainana with diethyl ether was tested using human, cattle, rabbit, and chicken erythrocytes. The skin secretions had a significant concentration-dependent hemolytic effect on erythrocytes. The hemolytic activity of the skin secretions was studied in the presence of osmotic protectants (polyethylene glycols and carbohydrates), cations (Mg2+, Ca2+, Ba2+, Cu2+, and K+), or antioxidants (ascorbic acid, reduced glutathione, and cysteine). Results Depending on their molecular mass, osmotic protectants effectively inhibited hemolysis. The inhibition of skin hemolysis was observed after treatment with polyethylene glycols (1000, 3400, and 6000 Da). Among divalent cations, only 1 mM Cu2+ markedly inhibited hemolytic activity. Antioxidant compounds slightly reduced the hemolytic activity. Conclusions The results suggested that skin secretions of K. pulchra hainana induce a pore-forming mechanism to form pores with a diameter of 1.36-2.0 nm rather than causing oxidative damage to the erythrocyte membrane.(AU)

Characteristics of hemolytic activity induced by skin secretions of the frog Kaloula pulchra hainana

The hemolytic activity of skin secretions obtained by stimulating the frog Kaloula pulchra hainana with diethyl ether was tested using human, cattle, rabbit, and chicken erythrocytes. The skin secretions had a significant concentration-dependent hemolytic effect on erythrocytes. The hemolytic activity of the skin secretions was studied in the presence of osmotic protectants (polyethylene glycols and carbohydrates), cations (Mg2+, Ca2+, Ba2+, Cu2+, and K+), or antioxidants (ascorbic acid, reduced glutathione, and cysteine). Results Depending on their molecular mass, osmotic protectants effectively inhibited hemolysis. The inhibition of skin hemolysis was observed after treatment with polyethylene glycols (1000, 3400, and 6000 Da). Among divalent cations, only 1 mM Cu2+ markedly inhibited hemolytic activity. Antioxidant compounds slightly reduced the hemolytic activity. Conclusions The results suggested that skin secretions of K. pulchra hainana induce a pore-forming mechanism to form pores with a diameter of 1.36-2.0 nm rather than causing oxidative damage to the erythrocyte membrane.

Hemolytic activity of venom from crown-of-thorns starfish Acanthaster planci spines

Background : The crown-of-thorns starfish Acanthaster planci is a venomous species from Taiwan whose venom provokes strong hemolytic activity. To understand the hemolytic properties of A. planci venom, samples were collected from A. planci spines in the Penghu Islands, dialyzed with distilled water, and lyophilized into A. planci spine venom (ASV) powder. Results : Both crude venom and ASV cause 50% hemolysis at a concentration of 20 μg/mL. The highest hemolytic activity of ASV was measured at pH 7.0-7.4; ASV-dependent hemolysis was sharply reduced when the pH was lower than 3 or greater than 8. There was almost no hemolytic activity when the Cu2+ concentration was increased to 10 mM. Furthermore, incubation at 100°C for 30 to 60 minutes sharply decreased the hemolytic activity of ASV. After treatment with the protease α-chymotrypsin, the glycoside hydrolase cellulase, and the membrane component cholesterin, the hemolytic activity of ASV was significantly inhibited. Conclusions : The results of this study provide fundamental information about A. planci spine venom. The hemolytic activity was affected by pH, temperature, metal ions, EDTA, cholesterin, proteases, and glycoside hydrolases. ASV hemolysis was inhibited by Cu2+, cholesterin, α-chymotrypsin, and cellulose, factors that might prevent the hemolytic activity of venom and provide the medical treatment for sting.(AU)

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG, R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.(AU)

Intoxicação crônica por cobre em ovinos: conduta para o diagnóstico conclusivo / Chronic copper toxicities in sheep: conduct for diagnostic confirmation

Descreveram-se os sinais clínicos e achados anatomopatológicos da intoxicação crônica por cobre em um ovino da raça Texxel e definiu-se a conduta diagnóstica correta para confirmação da enfermidade. Um ovino foi encaminhado ao setor de patologia com histórico de apatia, hemoglobinúria e morte em dois a três dias. No exame necroscópico, observaram-se icterícia e edema subcutâneo, fígado aumentado de volume e amarelado e rins escuros. No exame histológico, observaram-se necrose zonal aleatória e acentuada no fígado, necrose epitelial tubular, gotas hialinas e cilindros marrom-alaranjados em túbulos coletores dos rins. O histórico alimentar, a sensibilidade de espécie/raça, o quadro clínico, as alterações macroscópicas e microscópicas sugeriram o quadro de intoxicação crônica por cobre. A confirmação diagnóstica somente foi possível após a marcação de pigmentos de cobre pela técnica histoquímica de Ulzmann e pela quantificação de cobre em matéria seca de fígado e rins, cujos valores foram mais altos que o normal.(AU)

The present work describes the clinical signs and anatomopathological findings of chronic copper toxicities in a Texxel breed sheep and defines the optimal diagnostic procedure for confirmation of the disorder. A sheep was sent to pathology analysis service with a history of apathy, hemoglobinuria and death within two to three days. Necropsy showed jaundice and subcutaneous edema, enlarged yellow liver and dark kidneys. The histologic examination showed random zonal necrosis, marked necrosis in the liver and tubular epithelial and orange-brown spotted hyaline cylinders in the collecting tubules of the kidneys. The dietary history, sensitivity of species/breed, clinical, macroscopic and microscopic alterations suggested the framework of chronic copper poisoning. Diagnostic confirmation was only possible after staining copper pigments trough the Ulzmann technique and quantification of copper in the dry liver and kidney, which were higher than normal levels.(AU)

Etiologias da icterícia e diagnóstico diferencial prospectivo em 84 cães

A icterícia é a coloração amarelada decorrente da deposição de bilirrubina em tecidos ricos em elastina, devido à elevada concentração plasmática. A icterícia ocorre por alterações no metabolismo ou na excreção de bilirrubina, sendo classificadas em pré-hepática, hepática ou pós-hepática. A icterícia pré-hepática ocorre quando há hemólise intra- ou extravascular de causa infecciosa ou imunomediada. A icterícia hepática decorre de lesão hepática extensa. A icterícia pós-hepática pode ser secundária à obstrução parcial ou completa do ducto colédoco por colelitíases ou neoplasias. O objetivo desse estudo foi identificar, avaliar e classificar as causas de icterícia em cães necropsiados entre 2014 e 2017 associando as lesões macroscópicas, histológicas e exames complementares. Foram avaliados macro- e microscopicamente 84 cães com diferentes graus de icterícia, sendo classificados 22 (26,2%) cães com icterícia pré-hepática, 48 (57,1%) cães com icterícia hepática, 13 (15,5%) com icterícia pré-hepática e hepática e um (1,2%) com icterícia pós-hepática. Nos exames hematológicos, a alteração mais frequente foi anemia moderada a acentuada com leucocitose e trombocitopenia. Na bioquímica sanguínea, a maioria dos cães estava com azotemia e alteração nos níveis séricos das enzimas hepáticas, como fosfatase alcalina (FA), aspartato aminotransferase (AST) e alanina aminotransferase (ALT). Foram identificadas várias etiologias associadas à icterícia, dentre elas pode-se destacar, agentes infecciosos (47/84), neoplasias (13/84), processos degenerativos (12/84), crônicos (6/84), processos septicêmicos (5/84) e obstrutivos (1/84). Dentre as causas infecciosas, as mais frequentes foram leptospirose (40/84) e erliquiose (7/84). Das neoplásicas, foram colangiocarcinoma (5/84), hemangiossarcoma (4/84) e (2/84) linfoma. Dos processos degenerativos, os mais frequentes foram degenerações gordurosa (9/84) e glicogênica (3/84). Dos processos crônicos os mais frequentes foram fibrose hepática (cirrose) (6/84) e dos obstrutivos foi diagnosticado somente um caso de colelitíase (1/84). A PCR foi utilizada para o diagnóstico confirmatório da infecção por Leptopira interrogans e Ehrlichia canis. O DNA de Leptospira interrogans foi amplificado em 37 cães, e destes, quatro estavam co-infectados com Ehrlichia canis. A classificação e a identificação das causas de icterícia em cães são de relevância devido a frequência de doenças que apresentam essa alteração, muitas vezes sem diagnóstico ante-mortem.

Icterus is a yellowish discoloration developed from the bilirubin deposition, in tissues abundant in elastin, due to its high plasmatic concentration. It occurs in metabolism changes or bilirubin excretion and it is classified in pre-hepatic, hepatic and post-hepatic. Pre-hepatic icterus is a result of intra- or extravascular hemolysis by infectious or immune-mediated forms. The hepatic jaundice is a consequence of extensive liver damage. Post-hepatic form is usually secondary to partial or complete bile duct obstruction in cholelithiasis or neoplasms. The aim of this study was to evaluate and classify different icterus causes in dogs necropsied between 2014 and 2017, associating macroscopic and histologic changes as well as ancillary tests. Eighty four dogs were analyzed macro- and microscopically and separated in groups of icterus causes; 22 (26,2 %) dogs had pre-hepatic icterus, 48 (57,1%) hepatic, 13 (15.5%) pre-hepatic and hepatic and one (1.2%) with post-hepatic icterus. The hematological exam detected moderate anemia with severe leukocytosis and thrombocytopenia. The biochemical exam detected azotemia in most of the dogs with high increase in the sera levels of the hepatic enzymes, as alkaline phosphatase (AP), aspartate aminotransferase (AST), and alanine aminotransferase (ALT). Many factors were identified as the cause of icterus and the main factors were infectious agents (47/84), neoplasms (13/84), degenerative changes (12/84), chronic changes (6/84) and obstructive cause (1/84). The most frequent infectious causes were leptospirosis (40/84) and ehrlichiosis (7/84). Neoplastic causes include cholangiocarcinoma (5/84), hemangiosarcoma (4/84) and lymphoma (2/84). Degenerative changes were lipidosis (9/84) and glycogen (3/84) degeneration. Hepatic fibrosis (cirrhosis) (6/84) was the most frequent chronic changes and cholelithiasis (1/84) was diagnosed once as obstructive cause. PCR was performed to confirm Leptopira interrogans e Ehrlichia canis infections. DNA of Leptospira interrogans was amplified in 37 dogs, which four had coinfection with Ehrlichia canis. The classification and identification of icterus causes in dogs are very important due to the number of diseases with this alteration, frequently without ante-mortem diagnosis.

Heparina e K3EDTA como anticoagulantes para tambaqui (Colossoma macropomum Cuvier, 1816) / Heparin and K3EDTA as anticoagulants for tambaqui (Colossoma macropomum Cuvier, 1816)

Este estudo avaliou a eficácia da heparina sódica e do EDTA tripotássico como anticoagulantes e seus efeitos sobre os parâmetros hematológicos de tambaqui (Colossoma macropomum). Foram utilizados dez indivíduos de tambaqui com médias de 384,9 ± 85,71 g de peso e 27,90 ± 2,10 cm de comprimento total para avaliação da heparina 5.000 UI e 100 UI, bem como do K3EDTA 10 por cento. Foram analisados a inibição da coagulação por 10 h, eritrograma e teste de fragilidade osmótica dos eritrócitos. Os resultados foram submetidos à análise de variância e as médias comparadas pelo teste de Tukey (P < 0,05). Heparina 5000 UI, heparina 100 UI e K3EDTA 10 por cento foram eficazes na prevenção da coagulação por mais de 10 h, no entanto o EDTA tripotássico causou hemólise desde os primeiros momentos. No eritrograma não foi observada diferença (P > 0,05) na contagem de eritrócitos, hematócrito, taxa de hemoglobina e CHCM, no entanto, houve aumento do VCM (P < 0,05) nas amostras acondicionados com K3EDTA 10 por cento. Este anticoagulante causou incremento (P < 0,01) na fragilidade osmótica dos eritrócitos quando comparado com a heparina pura, heparina diluída, e grupo controle. A utilização da heparina como anticoagulante é mais apropriada para tambaqui (Colossoma macropomum), visto que foi eficiente na prevenção da coagulação por mais de 10 h, sem ocasionar hemólise, ou alterações nos parâmetros hematológicos e na fragilidade osmótica dos eritrócitos.(AU)

The efficacy of sodium heparin and tripotassium EDTA as anticoagulant and their effect on the hematological parameters of tambaqui (Colossoma macropomum) were evaluated in this study. Ten fish weighing 384.9 ± 85.71 g and measuring 27.90 ± 2.10 cm were used for heparin 5.000 IU, heparin 100 IU and K3EDTA 10 percent evaluation. Clotting inhibition after 10 h, erythrogram and osmotic fragility of erythrocytes were observed. The results were submitted to variance analysis and means compared by Tukey test (P < 0.05). Heparin 5.000 IU, heparin 100 IU and K3EDTA 10 percent were effective in preventing coagulation for more than 10 h. However, tripotassium EDTA caused hemolysis since first moments. In erythrogram there was no difference (P > 0.05) in erythrocyte count, hematocrit, hemoglobin and MCHC. On the other hand, an increase in MCV (P < 0.05) in samples kept with K3EDTA10 percent was observed. This anticoagulant provoked a significant increase (P < 0.01) in the osmotic fragility of erythrocytes when compared to pure heparin, diluted heparin and the control group. Heparin as an anticoagulant is more appropriate for tambaqui since it was effective in preventing coagulation for more than 10 h, without causing hemolysis, changes on hematological parameters or osmotic fragility of erythrocytes.(AU)