Competing endogenous RNA: the key to posttranscriptional regulation.

Competing endogenous RNA, ceRNA, vie with messenger RNAs (mRNAs) for microRNAs (miRNAs) with shared miRNAs responses elements (MREs) and act as modulator of miRNA by influencing the available level of miRNA. It has recently been discovered that, apart from protein-coding ceRNAs, pseudogenes, long noncoding RNAs (lncRNAs), and circular RNAs act as miRNA "sponges" by sharing common MRE, inhibiting normal miRNA targeting activity on mRNA. These MRE sharing elements form the posttranscriptional ceRNA network to regulate mRNA expression. ceRNAs are widely implicated in many biological processes. Recent studies have identified ceRNAs associated with a number of diseases including cancer. This brief review focuses on the molecular mechanism of ceRNA as part of the complex post-transcriptional regulatory circuit in cell and the impact of ceRNAs in development and disease.

Analysis of the genome and proteome composition of Bdellovibrio bacteriovorus: indication for recent prey-derived horizontal gene transfer.

The genome/proteome composition of Bdellovibrio bacteriovorus, the predatory microorganism that preys on other Gram-negative bacteria, has been analyzed. The study elucidates that translational selection plays a major role in genome compositional variation with higher intensity compared to other deltaproteobacteria. Other sources of variations having relatively minor contributions are local GC-bias, horizontal gene transfer and strand-specific mutational bias. The study identifies a group of AT-rich genes with distinct codon composition that is presumably acquired by Bdellovibrio recently from Gram-negative prey-bacteria other than deltaproteobacteria. The proteome composition of this species is influenced by various physico-chemical factors, viz, alcoholicity, residue-charge, aromaticity and hydropathy. Cell-wall-surface-anchor-family (CSAPs) and transporter proteins with distinct amino acid composition and specific secondary-structure also contribute notably to proteome compositional variation. CSAPs, which are low molecular-weight, outer-membrane proteins with highly disordered secondary-structure, have preference toward polar-uncharged residues and cysteine that presumably help in prey-predator interaction by providing particular bonds of attachment.

MicroRNA reins in embryonic and cancer stem cells.

MicroRNAs represents a new layer of gene regulation in stem cells by controlling the molecular mechanisms involved in modulating stem cell fate and behavior. Such a role of microRNA is seen in embryonic stem cell as well, maintaining a delicate balance between survival, proliferation, and self-renewal signals. Further, dysregulation of stem cell self-renewal is a likely requirement for the initiation and formation of cancer stem cells that probably pose resistance to current cancer treatments. In fact, the precise mechanism that regulates embryonic as well as cancer stem cell self-renewal and pluripotency remains largely unknown. Understanding the miRNA related stem cell biology and pathways offers great promise for improving stem cell mediated regenerative therapy as well as cancer therapies. Here we summarize some of the emerging evidences demonstrating the role of these molecular switches in embryonic and cancer stem cells.

Cellular versus viral microRNAs in host-virus interaction.

MicroRNAs (miRNAs) mark a new paradigm of RNA-directed gene expression regulation in a wide spectrum of biological systems. These small non-coding RNAs can contribute to the repertoire of host-pathogen interactions during viral infection. This interplay has important consequences, both for the virus and the host. There have been reported evidences of host-cellular miRNAs modulating the expression of various viral genes, thereby playing a pivotal role in the host-pathogen interaction network. In the hide-and-seek game between the pathogens and the infected host, viruses have evolved highly sophisticated gene-silencing mechanisms to evade host-immune response. Recent reports indicate that virus too encode miRNAs that protect them against cellular antiviral response. Furthermore, they may exploit the cellular miRNA pathway to their own advantage. Nevertheless, our increasing knowledge of the host-virus interaction at the molecular level should lead us toward possible explanations to viral tropism, latency and oncogenesis along with the development of an effective, durable and nontoxic antiviral therapy. Here, we summarize the recent updates on miRNA-induced gene-silencing mechanism, modulating host-virus interactions with a glimpse of the miRNA-based antiviral therapy for near future.

Identification and characterization of a tRNA decoding the rare AUA codon in Haloarcula marismortui.

Annotation of the complete genome of the extreme halophilic archaeon Haloarcula marismortui does not include a tRNA for translation of AUA, the rare codon for isoleucine. This is a situation typical for most archaeal genomes sequenced to date. Based on computational analysis, it has been proposed recently that a single intron-containing tRNA gene produces two very similar but functionally different tRNAs by means of alternative splicing; a UGG-decoding tRNA(TrpCCA) and an AUA-decoding tRNA(IleUAU). Through analysis of tRNAs from H. marismortui, we have confirmed the presence of tRNA(TrpCCA), but found no evidence for the presence of tRNA(IleUAU). Instead, we have shown that a tRNA, currently annotated as elongator methionine tRNA and containing CAU as the anticodon, is aminoacylated with isoleucine in vivo and that this tRNA represents the missing isoleucine tRNA. Interestingly, this tRNA carries a base modification of C34 in the anticodon different from the well-known lysidine found in eubacteria, which switches the amino acid identity of the tRNA from methionine to isoleucine and its decoding specificity from AUG to AUA. The methods described in this work for the identification of individual tRNAs present in H. marismortui provide the tools necessary for experimentally confirming the presence of any tRNA in a cell and, thereby, to test computational predictions of tRNA genes.

MicroRNA switches in Trypanosoma brucei.

Trypanosoma brucei develops chronic infection in mammalian hosts due to a sophisticated strategy of antigenic variation of variant surface glycoprotein (VSG) coat to escape antibody-mediated lysis. MicroRNAs are a class of non-coding RNAs with presumed post-transcriptional regulatory activity. Homology based informatic approach is used to identify the microRNA (miRNA) genes of T. brucei and their target mRNAs. Our observation reveals a set of microRNAs targeting mRNAs corresponding to VSGs. Further, a number of miRNA hairpins have been found in clusters of multiple identical copies. The target proteins, 20S proteosome, GM6 and GRESAG 4.2 corresponding to these clustered miRNAs play essential role in trypanosomiasis. These snippets can act as genetic switches modulating host-parasite interaction and provide useful clue toward treatment of trypanosomiasis.

Structural determinants characteristic to AARS subclasses and tRNA-splicing endonuclease in eukaryotes.

We compare and analyse the whole set of cytoplasmic, nonorganellar transfer RNA genes from 22 eukaryal genomes. Grouping this whole set into sets of isoacceptors we have elucidated structural elements that are characteristic to individual isoacceptor tRNAs within the subclasses of aminoacyl tRNA synthetases. Further, we have observed structural motifs straddling the exon-intron boundaries, which includes selective occurrence of both symmetric- 3-4-3 and asymmetric-3-4-(4, 5) bulge-helix-bulge-like structural motifs. Among all the tRNA isoacceptors, Ile, Leu, Ser, Pro, Met, Arg, and Tyr harbor BHB-like secondary structures at exon-intron boundaries. The structural signatories at the exon-intron boundaries appear to contribute to the specificity of splice site recognition.

Decrypting ENCODEd epigenetic marks of human tRN-A-RS genes in normal, stem and cancer cell lines.

Screening large-scale ENCODE data of 625 cytoplasmic transfer RNA (tRNAs) and 37 aminoacyl tRNA synthetase (AARSs) human genes, we deconstruct the array of relations between 10 histone marks affecting 15 chromatin states; their tissue specificity and variations and interchange amongst normal, cancerous and stem cells. The histone marks of RNA Pol II transcribed AARS genes share, but also contrast with that on RNA Pol III transcribed tRNA genes. tRNAs with identical/similar sequences may be in significantly varying states even within the same cell line; the chromatin scaffold, where the tRNA gene resides, is the key determinant. Hepatocellular carcinoma cell line has dominant H3K27me3, and singular clustering of other marks. Leukaemic cell line has hyperactive genes. The quiescence of the stem cells is encoded in the markers. Leaving aside the important exceptions in stem cells and elsewhere, tRNAs with cove scores above 50 have active markers and precise sets of transcription factors, and are usually well conserved compared to the low-scoring ones. Pseudo tRNAs are in heterochromatin/repressed state with anomalous exceptions in cancer cells. We motivate that Epigenetic-Phishing hacks the translation apparatus through the chromatin states governed by the histone marks of tRNA and AARS genes, and speculate on their therapeutic implications in cancer and on stem cells.

Correlation of altered expression of a long non-coding RNA, NEAT1, in peripheral blood mononuclear cells with dengue disease progression.

The association of long non-coding RNAs (lncRNAs) with dengue disease progression is currently unknown. Therefore, the present study aimed to identify lncRNAs in different categories of dengue patients and evaluate their association with dengue disease progression. Herein, we examined the expression profiles of lncRNAs and protein-coding genes between other febrile illness (OFI) and different grade of dengue patients through high-throughput RNA sequencing. We identified Nuclear Enriched Abundant Transcript 1 (NEAT1) as one of the differentially expressed lncRNAs (adjusted P ≤ 0.05 and log-fold change ≥ 2) and subsequently validated the expression by qRT-PCR. The co-expression analysis further revealed that NEAT1 and the coding gene IFI27 were highly co-expressed and negatively correlated with dengue severity. Using regression analysis, we observed that NEAT1 expression was significantly dependent on disease progression (Coefficient = -0.27750, SE Coefficient = 0.07145, and t = -3.88).Further, receiver operating characteristic (ROC) curve revealed that NEAT1 expression could discriminate DI from DS (sensitivity and specificity of 100% (95%CI: 85.69 - 97.22) and area under the curve (AUC) = 0.97). Overall, the results of this study offer the first experimental evidence demonstrating the correlation between lncRNAs and severe dengue phenotype. Monitoring NEAT1and IFI27 expression in PBMC may be useful in understanding dengue virus-induced disease progression.

miRepress: modelling gene expression regulation by microRNA with non-conventional binding sites.

Some earlier studies have reported an alternative mode of microRNA-target interaction. We detected target regions within mRNA transcripts from AGO PAR-CLIP that did not contain any conventional microRNA seed pairing but only had non-conventional binding sites with microRNA 3' end. Our study from 7 set of data that measured global protein fold change after microRNA transfection pointed towards the association of target protein fold change with 6-mer and 7-mer target sites involving microRNA 3' end. We developed a model to predict the degree of microRNA target regulation in terms of protein fold changes from the number of different conventional and non-conventional target sites present in the target, and found significant correlation of its output with protein expression changes. We validated the effect of non-conventional interactions with target by modulating the abundance of microRNA in a human breast cancer cell line MCF-7. The validation was done using luciferase assay and immunoblot analysis for our predicted non-conventional microRNA-target pair WNT1 (3' UTR) and miR-367-5p and immunoblot analysis for another predicted non-conventional microRNA-target pair MYH10 (coding region) and miR-181a-5p. Both experiments showed inhibition of targets by transfection of microRNA mimics that were predicted to have only non-conventional sites.

Dynamic changes in global microRNAome and transcriptome reveal complex miRNA-mRNA regulated host response to Japanese Encephalitis Virus in microglial cells.

Microglia cells in the brain play essential role during Japanese Encephalitis Virus (JEV) infection and may lead to change in microRNA (miRNA) and mRNA profile. These changes may together control disease outcome. Using Affymetrix microarray platform, we profiled cellular miRNA and mRNA expression at multiple time points during viral infection in human microglial (CHME3) cells. In silico analysis of microarray data revealed a phased pattern of miRNAs expression, associated with JEV replication and provided unique signatures of infection. Target prediction and pathway enrichment analysis identified anti correlation between differentially expressed miRNA and the gene expression at multiple time point which ultimately affected diverse signaling pathways including Notch signaling pathways in microglia. Activation of Notch pathway during JEV infection was demonstrated in vitro and in vivo. The expression of a subset of miRNAs that target multiple genes in Notch signaling pathways were suppressed and their overexpression could affect JEV induced immune response. Further analysis provided evidence for the possible presence of cellular competing endogenous RNA (ceRNA) associated with innate immune response. Collectively, our data provide a uniquely comprehensive view of the changes in the host miRNAs induced by JEV during cellular infection and identify Notch pathway in modulating microglia mediated inflammation.

A new measure to study phylogenetic relations in the brown algal order Ectocarpales: the "codon impact parameter".

We analyse forty-seven chloroplast genes of the large subunit of RuBisCO, from the algal order Ectocarpales, sourced from GenBank. Codon-usage weighted by the nucleotide base-bias defines our score called the codon-impact-parameter. This score is used to obtain phylogenetic relations amongst the 47 Ectocarpales. We compare our classification with the ones done earlier.

TRNomics: a comparative analysis of Picrophilus torridus with other archaeal thermoacidophiles.

In the euryarchaeal thermoacidophile Picrophilus torridus DSM 9790, we identified a copy of rare tRNA(Ile)(TAT) gene, along with the other 47 tDNAs with the help of our in-house program. Further, tRNAs of P. torridus were also compared with other archaeal thermoacidophiles Thermoplasma acidophilum, T. volcanium, Sulfolobus solfataricus and S. tokodaii.

Eukaryotic tRNA paradox.

tRNAs are widely believed to segregate into two classes, I and II. Computational analysis of eukaryotic tRNA entries in Genomic tRNA Database, however, leads to new, albeit paradoxical, presence of more than a thousand class-I tRNAs with uncharacteristic long variable arms (V-arms), like in class-II. Out of 62,202 tRNAs from 69 eukaryotes, as many as 1431 class-I tRNAs have these novel extended V-arms, and we refer to them as paradoxical tRNAs (pxtRNAs). A great majority of these 1431 pxtRNA genes are located in intergenic regions, about 18% embedded in introns of genes or ESTs, and just one in 3'UTR. A check on the conservations of 2D and 3D base pairs for each position of these pxtRNAs reveals a few variations, but they seem to have almost all the known features (already known identity and conserved elements of tRNA). Analyses of the A-Box and B-Box of these pxtRNA genes in eukaryotes display salient deviations from the previously annotated conserved features of the standard promoters, whereas the transcription termination signals are just canonical and non-canonical runs of thymidine, similar to the ones in standard tRNA genes. There is just one such pxtRNA(ProAGG) gene in the entire human genome, and the availability of data allows epigenetic analysis of this human pxtRNA(ProAGG) in three different cell lines, H1 hESC, K562, and NHEK, to assess the level of its expression. Histone acetylation and methylation of this lone pxtRNA(ProAGG) gene in human differ from that of the nine standard human tRNA(ProAGG) genes. The V-arm nucleotide sequences and their secondary structures in pxtRNA differ from that of class-II tRNA. Considering these differences, hypotheses of alternative splicing, non-canonical intron and gene transfer are examined to partially improve the Cove scores of these pxtRNAs and to critically question their antecedence and novelty.

Eukaryotic tRNAs fingerprint invertebrates vis-à-vis vertebrates.

During translation, aminoacyl-tRNA synthetases recognize the identities of the tRNAs to charge them with their respective amino acids. The conserved identities of 58,244 eukaryotic tRNAs of 24 invertebrates and 45 vertebrates in genomic tRNA database were analyzed and their novel features extracted. The internal promoter sequences, namely, A-Box and B-Box, were investigated and evidence gathered that the intervention of optional nucleotides at 17a and 17b correlated with the optimal length of the A-Box. The presence of canonical transcription terminator sequences at the immediate vicinity of tRNA genes was ventured. Even though non-canonical introns had been reported in red alga, green alga, and nucleomorph so far, fairly motivating evidence of their existence emerged in tRNA genes of other eukaryotes. Non-canonical introns were seen to interfere with the internal promoters in two cases, questioning their transcription fidelity. In a first of its kind, phylogenetic constructs based on tRNA molecules delineated and built the trees of the vast and diverse invertebrates and vertebrates. Finally, two tRNA models representing the invertebrates and the vertebrates were drawn, by isolating the dominant consensus in the positional fluctuations of nucleotide compositions.

Temporal changes in phosphoglycerate kinase coding sequences: a quantitative measure.

The ratio of the average of the square of the number of the nucleotides to that of the random sequence of the same strand bias is proposed as a quantitative measure of evolution in some coding DNA sequences. Applying this measure to the phosphoglycerate kinase gene we observe a monotonic rise of the ratio with evolution. We present an interpretation of this data on some bacteria.

Viral/plasmid captures in Crenarchaea.

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3'-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3'-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.

lnCeDB: database of human long noncoding RNA acting as competing endogenous RNA.

UNLABELLED: Long noncoding RNA (lncRNA) influences post-transcriptional regulation by interfering with the microRNA (miRNA) pathways, acting as competing endogenous RNA (ceRNA). These lncRNAs have miRNA responsive elements (MRE) in them, and control endogenous miRNAs available for binding with their target mRNAs, thus reducing the repression of these mRNAs. lnCeDB provides a database of human lncRNAs (from GENCODE 19 version) that can potentially act as ceRNAs. The putative mRNA targets of human miRNAs and the targets mapped to AGO clipped regions are collected from TargetScan and StarBase respectively. The lncRNA targets of human miRNAs (up to GENCODE 11) are downloaded from miRCode database. miRNA targets on the rest of the GENCODE 19 lncRNAs are predicted by our algorithm for finding seed-matched target sites. These putative miRNA-lncRNA interactions are mapped to the Ago interacting regions within lncRNAs. To find out the likelihood of an lncRNA-mRNA pair for actually being ceRNA we take recourse to two methods. First, a ceRNA score is calculated from the ratio of the number of shared MREs between the pair with the total number of MREs of the individual candidate gene. Second, the P-value for each ceRNA pair is determined by hypergeometric test using the number of shared miRNAs between the ceRNA pair against the number of miRNAs interacting with the individual RNAs. Typically, in a pair of RNAs being targeted by common miRNA(s), there should be a correlation of expression so that the increase in level of one ceRNA results in the increased level of the other ceRNA. Near-equimolar concentration of the competing RNAs is associated with more profound ceRNA effect. In lnCeDB one can not only browse for lncRNA-mRNA pairs having common targeting miRNAs, but also compare the expression of the pair in 22 human tissues to estimate the chances of the pair for actually being ceRNAs. AVAILABILITY: Downloadable freely from http://gyanxet-beta.com/lncedb/.

HumanViCe: host ceRNA network in virus infected cells in human.

Host-virus interaction via host cellular components has been an important field of research in recent times. RNA interference mediated by short interfering RNAs and microRNAs (miRNA), is a widespread anti-viral defense strategy. Importantly, viruses also encode their own miRNAs. In recent times miRNAs were identified as key players in host-virus interaction. Furthermore, viruses were shown to exploit the host miRNA networks to suite their own need. The complex cross-talk between host and viral miRNAs and their cellular and viral targets forms the environment for viral pathogenesis. Apart from protein-coding mRNAs, non-coding RNAs may also be targeted by host or viral miRNAs in virus infected cells, and viruses can exploit the host miRNA mediated gene regulatory network via the competing endogenous RNA effect. A recent report showed that viral U-rich non-coding RNAs called HSUR, expressed in primate virus herpesvirus saimiri (HVS) infected T cells, were able to bind to three host miRNAs, causing significant alteration in cellular level for one of the miRNAs. We have predicted protein coding and non protein-coding targets for viral and human miRNAs in virus infected cells. We identified viral miRNA targets within host non-coding RNA loci from AGO interacting regions in three different virus infected cells. Gene ontology (GO) and pathway enrichment analysis of the genes comprising the ceRNA networks in the virus infected cells revealed enrichment of key cellular signaling pathways related to cell fate decisions and gene transcription, like Notch and Wnt signaling pathways, as well as pathways related to viral entry, replication and virulence. We identified a vast number of non-coding transcripts playing as potential ceRNAs to the immune response associated genes; e.g., APOBEC family genes, in some virus infected cells. All these information are compiled in HumanViCe (http://gyanxet-beta.com/humanvice), a comprehensive database that provides the potential ceRNA networks in virus infected human cells.

Anomalous altered expressions of downstream gene-targets in TP53-miRNA pathways in head and neck cancer.

The prevalence of head and neck squamous cell carcinoma, HNSCC, continues to grow. Change in the expression of TP53 in HNSCC affects its downstream miRNAs and their gene targets, anomalously altering the expressions of the five genes, MEIS1, AGTR1, DTL, TYMS and BAK1. These expression alterations follow the repression of TP53 that upregulates miRNA-107, miRNA- 215, miRNA-34 b/c and miRNA-125b, but downregulates miRNA-155. The above five so far unreported genes are the targets of these miRNAs. Meta-analyses of microarray and RNA-Seq data followed by qRT-PCR validation unravel these new ones in HNSCC. The regulatory roles of TP53 on miRNA-155 and miRNA-125b differentiate the expressions of AGTR1 and BAK1in HNSCC vis-à-vis other carcinogenesis. Expression changes alter cell cycle regulation, angiogenic and blood cell formation, and apoptotic modes in affliction. Pathway analyses establish the resulting systems-level functional and mechanistic insights into the etiology of HNSCC.