Identifying genetic loci that are associated with changes in gene expression in PTSD in a South African cohort.

The molecular mechanisms underlying posttraumatic stress disorder (PTSD) are yet to be fully elucidated, especially in underrepresented population groups. Expression quantitative trait loci (eQTLs) are DNA sequence variants that influence gene expression, in a local (cis-) or distal (trans-) manner, and subsequently impact cellular, tissue, and system physiology. This study aims to identify genetic loci associated with gene expression changes in a South African PTSD cohort. Genome-wide genotype and RNA-sequencing data were obtained from 32 trauma-exposed controls and 35 PTSD cases of mixed-ancestry, as part of the SHARED ROOTS project. The first approach utilised 108 937 single-nucleotide polymorphisms (SNPs) (MAF > 10%) and 11 312 genes with Matrix eQTL to map potential eQTLs, while controlling for covariates as appropriate. The second analysis was focused on 5638 SNPs related to a previously calculated PTSD polygenic risk score for this cohort. SNP-gene pairs were considered eQTLs if they surpassed Bonferroni correction and had a false discovery rate <0.05. We did not identify eQTLs that significantly influenced gene expression in a PTSD-dependent manner. However, several known cis-eQTLs, independent of PTSD diagnosis, were observed. rs8521 (C > T) was associated with TAGLN and SIDT2 expression, and rs11085906 (C > T) was associated with ZNF333 expression. This exploratory study provides insight into the molecular mechanisms associated with PTSD in a non-European, admixed sample population. This study was limited by the cross-sectional design and insufficient statistical power. Overall, this study should encourage further multi-omics approaches towards investigating PTSD in diverse populations.

Invasive Amphibian Gut Microbiota and Functions Shift Differentially in an Expanding Population but Remain Conserved Across Established Populations.

Studies of laboratory animals demonstrate extensive variation of host gut microbiomes and their functional capabilities across populations, but how does anthropogenic change impact the microbiomes of non-model species? The anthropogenic movement of species to novel environments can drastically alter animals' microbiomes; however, factors that shape invasive species gut microbiota during introduction remain relatively unexplored. Through 16S amplicon sequencing on guttural toad (Sclerophrys gutturalis) faecal samples, we determine that residence time does not impact microbiome variation between source and introduced populations. The youngest population (~ 20 years in Cape Town) has the most distinct microbiome and associated functional capabilities, whereas longer residence times (~ 100 years in Réunion and Mauritius) produce less divergent microbial compositional, phylogenetic, and predicted functional diversity and differential abundance from source populations (Durban). Additionally, we show extensive variation of microbial and functional diversity, as well as differential abundance patterns in an expanding introduced population (Cape Town) between core and periphery sites. Contrasting previous studies, we suggest that introduction pathways might be an important factor impacting host microbial divergence. These findings also imply that the microbiome can diverge in accordance with host population dynamics.

Mitochondrial genomes of African pangolins and insights into evolutionary patterns and phylogeny of the family Manidae.

BACKGROUND: This study used next generation sequencing to generate the mitogenomes of four African pangolin species; Temminck's ground pangolin (Smutsia temminckii), giant ground pangolin (S. gigantea), white-bellied pangolin (Phataginus tricuspis) and black-bellied pangolin (P. tetradactyla). RESULTS: The results indicate that the mitogenomes of the African pangolins are 16,558 bp for S. temminckii, 16,540 bp for S. gigantea, 16,649 bp for P. tetradactyla and 16,565 bp for P. tricuspis. Phylogenetic comparisons of the African pangolins indicated two lineages with high posterior probabilities providing evidence to support the classification of two genera; Smutsia and Phataginus. The total GC content between African pangolins was observed to be similar between species (36.5% - 37.3%). The most frequent codon was found to be A or C at the 3rd codon position. Significant variations in GC-content and codon usage were observed for several regions between African and Asian pangolin species which may be attributed to mutation pressure and/or natural selection. Lastly, a total of two insertions of 80 bp and 28 bp in size respectively was observed in the control region of the black-bellied pangolin which were absent in the other African pangolin species. CONCLUSIONS: The current study presents reference mitogenomes of all four African pangolin species and thus expands on the current set of reference genomes available for six of the eight extant pangolin species globally and represents the first phylogenetic analysis with six pangolin species using full mitochondrial genomes. Knowledge of full mitochondrial DNA genomes will assist in providing a better understanding on the evolution of pangolins which will be essential for conservation genetic studies.

Genetic polymorphisms of the organic cation transporter 1 gene (SLC22A1) within the Cape Admixed population of South Africa.

Human organic cation transporter 1 (hOCT1) is expressed primarily in hepatocytes and mediate the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for hOCT1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response of individual patients to clinical drugs which are substrates for this transporter. The aim of this study was to investigate the allele and genotype frequencies of single-nucleotide polymorphisms (SNPs) of SLC22A1 in the Cape Admixed population of South Africa. The genotypic and allelic distributions of nineteen nonsynonomous and one intronic SLC22A1 SNPs were determined in 100 healthy Cape Admixed participants, using a SNaPshot(®) multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F, P341L, S189L, G220V, V519F, M440I, G465R and the rs622342 intronic variant were 1.0, 0.5, 1.0, 1.0, 1.5, 0.5, 0.5 and 18.0%, respectively. None of the participants carried the variant allele for R61C, C88R, P283L, R287G and G401S. In addition, no variant alleles were observed for A306T, A413V, M420V, I421F, C436F, V501E, and I542V in the population. Twelve haplotypes were inferred from the genotypic data. The frequencies for most common haplotypes CCTCGGCGCGCTAGAGCTGA, CCTCGGCGCGCTAGCGCTGA and CCTCGGCGCGCGAGCGCTGA were 80, 9.9, and 3.5%, respectively.

Genetic polymorphisms and haplotypes of the organic cation transporter 1 gene (SLC22A1) in the Xhosa population of South Africa.

Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot(®) multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885), P341L (rs2282143), V519F (rs78899680), and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357), C88R (rs55918055), S189L (rs34104736), G220V (rs36103319), P283L (rs4646277), R287G (rs4646278), G401S (rs34130495), M440I (rs35956182), or G465R (rs34059508). In addition, no variant alleles were observed for A306T (COSM164365), A413V (rs144322387), M420V (rs142448543), I421F (rs139512541), C436F (rs139512541), V501E (rs143175763), or I542V (rs137928512) in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.

Hypervirulent Klebsiella pneumoniae in a South African tertiary hospital-Clinical profile, genetic determinants, and virulence in Caenorhabditis elegans.

Introduction: A distinct strain of Klebsiella pneumoniae (K. pneumoniae) referred to as hypervirulent (hvKp) is associated with invasive infections such as pyogenic liver abscess in young and healthy individuals. In South Africa, limited information about the prevalence and virulence of this hvKp strain is available. The aim of this study was to determine the prevalence of hvKp and virulence-associated factors in K. pneumoniae isolates from one of the largest tertiary hospitals in a South African province. Methods: A total of 74 K. pneumoniae isolates were received from Pelonomi Tertiary Hospital National Health Laboratory Service (NHLS), Bloemfontein. Virulence-associated genes (rmpA, capsule serotype K1/K2, iroB and irp2) were screened using Polymerase Chain Reaction (PCR). The iutA (aerobactin transporter) gene was used as a primary biomarker of hvKp. The extracted DNAs were sequenced using the next-generation sequencing pipeline and the curated sequences were used for phylogeny analyses using appropriate bioinformatic tools. The virulence of hvKp vs. classical Klebsiella pneumoniae (cKp) was investigated using the Caenorhabditis elegans nematode model. Results: Nine (12.2%) isolates were identified as hvKp. Moreover, hvKp was significantly (p < 0.05) more virulent in vivo in Caenorhabditis elegans relative to cKp. The virulence-associated genes [rmpA, iroB, hypermucoviscous phenotype (hmv) phenotype and capsule K1/K2] were significantly (p < 0.05) associated with hvKp. A homology search of the curated sequences revealed a high percentage of identity between 99.8 and 100% with other homologous iutA gene sequences of other hvKp in the GenBank. Conclusion: Findings from this study confirm the presence of hvKp in a large tertiary hospital in central South Africa. However, the low prevalence and mild to moderate clinical presentation of infected patients suggest a marginal threat to public health. Further studies in different settings are required to establish the true potential impact of hvKp in developing countries.

Introducing an rbcL and a trnL reference library to aid in the metabarcoding analysis of foraged plants from two semi-arid eastern South African savanna bioregions.

Success of a metabarcoding study is determined by the extent of taxonomic coverage and the quality of records available in the DNA barcode reference database used. This study aimed to create an rbcL and a trnL (UAA) DNA barcode sequence reference database of plant species that are potential herbivore foraging targets and commonly found in semi-arid savannas of eastern South Africa. An area-specific species list of 765 species was compiled according to plant collection records available and areas comparable to an eastern semi-arid South African savanna. Thereafter, rbcL and trnL sequences of species from this list were mined from GenBank and BOLD sequence databases according to specific quality criteria to ensure accurate taxonomic coverage and resolution. These were supplemented with sequences of 24 species sequenced for this study. A phylogenetic approach, employing Neighbor-Joining, was used to verify the topology of the reference libraries to known angiosperm phylogeny. The taxonomic reliability of these reference libraries was evaluated by testing for the presence of a barcode gap, identifying a data-appropriate identification threshold, and determining the identification accuracy of reference sequences via primary distance-based criteria. The final rbcL reference dataset consisted of 1238 sequences representing 318 genera and 562 species. The final trnL dataset consisted of 921 sequences representing 270 genera and 461 species. Barcode gaps were found for 76% of the taxa in the rbcL barcode reference dataset and 68% of the taxa in the trnL barcode reference dataset. The identification success rate, calculated with the k-nn criterion was 85.86% for the rbcL dataset and 73.72% for the trnL dataset. The datasets for rbcL and trnL combined during this study are not presented as complete DNA reference libraries, but rather as two datasets that should be used in unison to identify plants present in the semi-arid eastern savannas of South Africa.

Recent advances in genetic tools for engineering probiotic lactic acid bacteria.

Synthetic biology has grown exponentially in the last few years, with a variety of biological applications. One of the emerging applications of synthetic biology is to exploit the link between microorganisms, biologics, and human health. To exploit this link, it is critical to select effective synthetic biology tools for use in appropriate microorganisms that would address unmet needs in human health through the development of new game-changing applications and by complementing existing technological capabilities. Lactic acid bacteria (LAB) are considered appropriate chassis organisms that can be genetically engineered for therapeutic and industrial applications. Here, we have reviewed comprehensively various synthetic biology techniques for engineering probiotic LAB strains, such as clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 mediated genome editing, homologous recombination, and recombineering. In addition, we also discussed heterologous protein expression systems used in engineering probiotic LAB. By combining computational biology with genetic engineering, there is a lot of potential to develop next-generation synthetic LAB with capabilities to address bottlenecks in industrial scale-up and complex biologics production. Recently, we started working on Lactochassis project where we aim to develop next generation synthetic LAB for biomedical application.

Advances in the molecular neurobiology of posttraumatic stress disorder from global contexts: A systematic review of longitudinal studies.

Trauma exposure is prevalent globally and is a defining event for the development of posttraumatic stress disorder (PTSD), characterised by intrusive thoughts, avoidance behaviours, hypervigilance and negative alterations in cognition and mood. Exposure to trauma elicits a range of physiological responses which can interact with environmental factors to confer relative risk or resilience for PTSD. This systematic review summarises the findings of longitudinal studies examining biological correlates predictive of PTSD symptomology. Databases (Pubmed, Scopus and Web of Science) were systematically searched using relevant keywords for studies published between 1 January 2021 and 31 December 2022. English language studies were included if they were original research manuscripts or meta-analyses of cohort investigations that assessed longitudinal relationships between one or more molecular-level measures and either PTSD status or symptoms. Eighteen of the 1,042 records identified were included. Studies primarily included military veterans/personnel, individuals admitted to hospitals after acute traumatic injury, and women exposed to interpersonal violence or rape. Genomic, inflammation and endocrine measures were the most commonly assessed molecular markers and highlighted processes related to inflammation, stress responding, and learning and memory. Quality assessments were done using the Systematic Appraisal of Quality in Observational Research, and the majority of studies were rated as being of high quality, with the remainder of moderate quality. Studies were predominantly conducted in upper-income countries. Those performed in low- and middle-income countries were not broadly representative in terms of demographic, trauma type and geographic profiles, with three out of the four studies conducted assessing only female participants, rape exposure and South Africa, respectively. They also did not generate multimodal data or use machine learning or multilevel modelling, potentially reflecting greater resource limitations in LMICs. Research examining molecular contributions to PTSD does not adequately reflect the global burden of the disorder.

Coding-Complete Genome Sequences for Two Confirmed Monkeypox Cases in South Africa 2022.

The coding-complete genome sequences of monkeypox virus (MPXV) were obtained from skin lesion swabs from two human cases detected in South Africa in June 2022. Sequence analyses indicated that the genetic sequences of the viruses associated with these two cases were related most closely to the genetic sequences of other MPXVs reported during the 2022 multicountry outbreak and belong to the monkeypox hMPXV-1 clade (previously West Africa clade) and B.1 lineage.

Draft Whole-Genome Sequence of Penicillium simplicissimum A4, a Putative Endophyte from Echium plantagineum.

We report the draft whole-genome sequence of the putative endophytic fungus Penicillium simplicissimum A4, isolated from the roots of Echium plantagineum plants. The genome was sequenced using PacBio technology with an estimated genome size of 39 Mb.

Population and genetic structure of a male-dispersing strepsirrhine, Galago moholi (Primates, Galagidae), from northern South Africa, inferred from mitochondrial DNA.

The habitats of Galago moholi are suspected to be largely fragmented, while the species is thought to be expanding further into the southernmost fringe of its range, as well as into human settlements. To date, no intraspecific molecular genetic studies have been published on G. moholi. Here we estimate the genetic diversity and connectivity of populations of G. moholi using two mitochondrial gene regions, the cytochrome C oxidase subunit I gene (COI) and the displacement loop of the control region (D-loop). Samples from five localities in northern South Africa were obtained from archived collections. The two mitochondrial DNA gene regions were amplified and sequenced to provide population summary statistics, differentiation [proportion of the total genetic variation in a population relative to the total genetic variance of all the populations (FST), differentiation within populations among regions (ΦST)], genetic distance and structure. There was discernible genetic structure among the individuals, with two COI and six D-loop haplotypes belonging to two genetically different groups. There was population differentiation among regions (FST = 0.670; ΦST = 0.783; P < 0.01). However, there were low levels of differentiation among populations, as haplotypes were shared between distant populations. Adjacent populations were as divergent from each other as from distant populations. The results suggest that genetic introgression, most likely due to past migrations or recent unintentional translocations that include the animal trade, may have led to connectivity among populations.

Draft Genome Sequence of the Putative Endophytic Bacterium Pantoea agglomerans R6, Associated with Lactuca serriola from South Africa.

Here, we present the draft genome sequence (∼4.7 Mb) of the endopyhtic bacterium Pantoea agglomerans strain R6, which was isolated from surface-sterilized roots of Lactuca serriola (prickly lettuce).

Delayed breeding affects lifetime reproductive success differently in male and female green woodhoopoes.

In cooperatively breeding species, many individuals only start breeding long after reaching physiological maturity [1], and this delay is expected to reduce lifetime reproductive success (LRS) [1-3]. Although many studies have investigated how nonbreeding helpers might mitigate the assumed cost of delayed breeding (reviewed in [3]), few have directly quantified the cost itself [4, 5] (but see [6, 7]). Moreover, although life-history tradeoffs frequently influence the sexes in profoundly different ways [8, 9], it has been generally assumed that males and females are similarly affected by a delayed start to breeding [7]. Here, we use 24 years of data to investigate the sex-specific cost of delayed breeding in the cooperatively breeding green woodhoopoe (Phoeniculus purpureus) and show that age at first breeding is related to LRS differently in males and females. As is traditionally expected, males that started to breed earlier in life had greater LRS than those that started later. However, females showed the opposite pattern: Those individuals that started to breed later in life actually had greater LRS than those that started earlier. In both sexes, the association between age at first breeding and LRS was driven by differences in breeding-career length, rather than per-season productivity. We hypothesize that the high mortality rate of young female breeders, and thus their short breeding careers, is related to a reduced ability to deal with the high physiological costs of reproduction in this species. These results demonstrate the importance of considering sex-specific reproductive costs when estimating the payoffs of life-history decisions and bring into question the long-held assumption that delayed breeding is necessarily costly.

Isolation and characterization of 30 STRs in Temminck's ground pangolin (Smutsia temminckii) and potential for cross amplification in other African species.

Temminck's ground pangolin (Smutsia temminckii) is one of four species of pangolin, endemic to Africa. Two of the African pangolin species are listed as vulnerable and two are listed as endangered on the International Union for Conservation of Nature Red List of Threatened Species due to their ongoing exploitation for traditional medicine and bushmeat. In this study, we developed 30 species-specific short-tandem repeats (STRs) in Temminck's ground pangolin using next-generation sequencing. The markers were also optimized for crossamplification in other African species. All the markers amplified successfully in Temminck's ground pangolin with allelic polymorphisms observed in 87% of the markers in giant pangolin (S. gigantea) whereas 60% of the markers were amplified polymorphic loci in both whitebellied pangolin (Phataginus tricuspis) and black-bellied pangolin (P. tetradactyla). Analysis of diversity estimates showed moderate levels of variability in Temminck's ground pangolin (Na = 5; Ho = 0.559), giant pangolin (Na = 4.909; Ho = 0.514) and white-bellied pangolin (Na= 2.686; Ho = 0.541) with lower values being observed in black-bellied pangolin (Na = 3; Ho = 0.242). This study provides data of the first available STR markers which was amplified in all four African pangolin species that can now be used in conservation genetic and evolutionary aspects of population histories.

The complete mitochondrial genome of Gyps coprotheres (Aves, Accipitridae, Accipitriformes): phylogenetic analysis of mitogenome among raptors.

Three species of Old World vultures on the Asian peninsula are slowly recovering from the lethal consequences of diclofenac. At present the reason for species sensitivity to diclofenac is unknown. Furthermore, it has since been demonstrated that other Old World vultures like the Cape (Gyps coprotheres; CGV) and griffon (G. fulvus) vultures are also susceptible to diclofenac toxicity. Oddly, the New World Turkey vulture (Cathartes aura) and pied crow (Corvus albus) are not susceptible to diclofenac toxicity. As a result of the latter, we postulate an evolutionary link to toxicity. As a first step in understanding the susceptibility to diclofenac toxicity, we use the CGV as a model species for phylogenetic evaluations, by comparing the relatedness of various raptor species known to be susceptible, non-susceptible and suspected by their relationship to the Cape vulture mitogenome. This was achieved by next generation sequencing and assembly. The Cape vulture mitogenome had a genome size of 16,908 bp. The mitogenome phylogenetic analysis indicated a close evolutionary relationship between Old World vultures and other members of the Accipitridae as indicated by bootstrap value of 100% on the phylogenetic trees. Based on this, we postulate that the other species could also be sensitive to the toxic effects of diclofenac. This warrants further investigations.

Population genetic structure of the thick-tailed bushbaby (Otolemur crassicaudatus) from the Soutpansberg Mountain range, Northern South Africa, based on four mitochondrial DNA regions.

Greater bushbabies, strepsirrhine primates, that are distributed across central, eastern and southern Africa, with northern and eastern South Africa representing the species' most southerly distribution. Greater bushbabies are habitat specialists whose naturally fragmented habitats are getting even more fragmented due to anthropogenic activities. Currently, there is no population genetic data or study published on the species. The aim of our study was to investigate the genetic variation in a thick-tailed bushbaby, Otolemur crassicaudatus, population in the Soutpansberg mountain range, Limpopo Province, South Africa. Four mitochondrial regions, ranging from highly conserved to highly variable, were sequenced from 47 individuals. The sequences were aligned and genetic diversity, structure, as well as demographic analyses were performed. Low genetic diversity (π = 0.0007-0.0038 in coding regions and π = 0.0127 in non-coding region; Hd = 0.166-0.569 in coding regions and Hd = 0.584 in non-coding region) and sub-structuring (H = 2-3 in coding regions and H = 4 in non-coding region) was observed with two divergent haplogroups (haplotype pairwise distance = 3-5 in coding region and 6-10 in non-coding region) being identified. This suggests the population may have experienced fixation of mitochondrial haplotypes due to limited female immigration, which is consistent with philopatric species, that alternative haplotypes are not native to this population, and that there may be male mobility from adjacent populations. This study provides the first detailed insights into the mitochondrial genetic diversity of a continental African strepsirrhine primate and demonstrates the utility of mitochondrial DNA in intraspecific genetic population analyses of these primates.

Next generation sequencing yields the mitochondrial genome of the critically endangered Sarothrura ayresi (white-winged flufftail).

The mitochondrial genome of Sarothrura ayresi was sequenced using next generation sequencing technology. The size of the genome is reported as 16,767 bp and comprises 13 protein-coding genes, 2 rRNAs and 22 tRNAs. The organization of the genome is comparable to that of other bird species. A phylogenetic comparison mapped the relative relationship of Sarothrura ayresi with respect to other species in the order Gruiformes.

Genome Sequences of Three Vaccine Strains and Two Wild-Type Canine Distemper Virus Strains from a Recent Disease Outbreak in South Africa.

Canine distemper virus causes global multihost infectious disease. This report details complete genome sequences of three vaccine and two new wild-type strains. The wild-type strains belong to the South African lineage, and all three vaccine strains to the America 1 lineage. This constitutes the first genomic sequences of this virus from South Africa.