Comparative endocrinology of leptin: assessing function in a phylogenetic context.

As we approach the end of two decades of leptin research, the comparative biology of leptin is just beginning. We now have several leptin orthologs described from nearly every major clade among vertebrates, and are moving beyond gene descriptions to functional studies. Even at this early stage, it is clear that non-mammals display clear functional similarities and differences with their better-studied mammalian counterparts. This review assesses what we know about leptin function in mammals and non-mammals, and gives examples of how these data can inform leptin biology in humans.

Fc glycan sialylation of biotherapeutic monoclonal antibodies has limited impact on antibody-dependent cellular cytotoxicity.

It has been well documented that the terminal sugars of Fc glycans can play a critical role in the safety and efficacy of therapeutic mAbs. However, many of the effects of highly heterogeneous Fc glycan structures have yet to be fully characterized. Different glycosylation patterns can affect Fc-dependent activities, such as the ability of mAbs to bind Fcγ receptors on the effector cell surface, which is critical to immune effector functions, such as antibody-dependent cellular cytotoxicity (ADCC). Previous studies on the impact of sialic acid in the Fc glycan on ADCC have not resulted in consistent conclusions. In our study, we tested sialic acid-enriched species from a chimeric murine/human kappa light chain IgG1 (mAb1) with known Fcγ receptor IIIa binding and ADCC activities. These enriched species contained up to a fourfold increase in sialic acid-containing glycans relative to the typical levels present in therapeutic mAbs, along with other attributes such as oxidized and deamidated species. The ADCC analysis of sialylated and asialo mAb1 provided herein shows evidence that sialic acids have little or no impact on ADCC activity. Altogether, our results highlight the value of novel glycan engineering strategies in designing therapeutic mAbs with high-quality attributes and in improving production process controls.

Expression of leptin receptor gene in developing and adult zebrafish.

Interactions of leptin and leptin receptors play crucial roles during animal development and regulation of appetite and energy balance. In this study we analyzed expression pattern of a zebrafish leptin receptor gene in both developing and adult zebrafish using in situ hybridization and Q-PCR methods. Zebrafish leptin receptor message (lepr) was detected in all embryonic and larval stages examined, and in adult zebrafish. In embryonic zebrafish, lepr was mainly expressed in the notochord. As development proceeded, lepr expression in the notochord decreased, while its expression in several other tissues, including the trunk muscles and gut, became evident. In both larval and adult brains, large lepr expressing cells were detected in similar regions of the hindbrain. In adult zebrafish, lepr expression was also observed in several other brain regions including the hypothalamic lateral tuberal nucleus, the fish homolog of the arcuate nucleus. Q-PCR experiments confirmed lepr expression in the adult fish brain, and also showed lepr expression in several adult tissues including liver, muscle and gonads. Our results showed that lepr expression was both spatially and temporally regulated.

Thermolytic release of covalently linked DNA oligonucleotides and their conjugates from controlled-pore glass at near neutral pH.

The functionalization of long chain alkylamine controlled-pore glass (CPG) with a 3-hydroxypropyl-(2-cyanoethyl)thiophosphoryl linker and its conversion to the support 7 has led to the synthesis of DNA oligonucleotides and their 3'- or (3',5')-conjugates. Indeed, CPG support 7 has been successfully employed in the synthesis of both native and fully phosphorothioated DNA 20-mers. Unlike conventional succinylated CPG supports, this distinctively functionalized support allows oligonucleotide deprotection and removal of the deprotection side products to proceed without releasing the oligonucleotide into the aqueous milieu. When freed from deprotection side products, the DNA oligonucleotide is thermolytically released from the support within 2 h under nearly neutral conditions (pH 7.2, 90 degrees C). The quality of these oligonucleotides is comparable to that of identical oligonucleotides synthesized from succinylated CPG supports in terms of shorter than full length oligonucleotide contaminants and overall yields. The versatility of the thermolytic CPG support 7 is further demonstrated by the synthesis of a DNA oligonucleotide (20-mer) and its conjugation with an azido and alkynyl groups at both 5'-and 3'-termini, respectively. The functionality of the (3',5')-heteroconjugated oligonucleotide 18 is verified by its circularization to the DNA oligonucleotide 19 under "click" chemistry conditions.

Improved sequence variant analysis strategy by automated false positive removal.

Sequence variant analysis (SVA) is critical in therapeutic protein development because it ensures the absence of genetic mutations of a production clone or high-level misincorporations during cell culture. While software for searching sequence variants from mass spectrometry data are available, effectively distinguishing true positives from a large number of false positives in the reported hits or identifications found in the error tolerant search mode is a challenge. This verification process must be done manually and can take several days or even weeks to accomplish. We report here the use of a Perl-based script to evaluate every identified hit to remove the false positives from the search results of PepFinder™ (also known as MassAnalyzer) based on orthogonal criteria. Our data show that the false positives from PepFinder™ output were reduced ∼4-fold without loss of accuracy in the detection of true identifications, representing a more than 70% reduction in time compared with the manual data verification process.

Evidence for an imidazoline by-product from glycans using tandem mass spectrometry.

Herein is reported the separation and identification of a previously unknown imidazoline by-product originating from the fluorescent labeling procedure when applied to enzymatically released N-linked glycans of a human IgG1. The imidazoline by-product was generated via the reductive amination procedure with either sodium cyanoborohydride or 2-picoline borane. Using ultra performance liquid chromatography (UPLC) in conjunction with hydrophilic interaction-based chromatography (HILIC), the 2-aminobenzoic acid (2-AA)-labeled glycans were well-resolved from imidazoline by-products to facilitate direct identification utilizing electrospray ionization mass spectrometry (ESI-MS) with fragmentation. It was found that this minor species (∼2%) was 18.0105u less than the neighboring peak GlcNAc2Man3GlcNAc2Fuc peak, abbreviated as A2G0F at 1582.5899u. While this mass loss corresponds to the mass of a water molecule, the molecular location of loss of water was not straightforward in consideration of the biantennary A2G0F structure. Model studies were carried out using A2G0F standard and N-acetyllactosamine to identify the impurity as an imidazoline ring structure located at the reducing end of the glycan as confirmed by high resolution mass fragment ions. Imidazoline content decreased when the reductant concentration was increased. To conclude, evidence for the imidazoline structure was accomplished through high resolution, high accuracy mass spectrometry (HRAM), and experiments showing chemical susceptibility and isotopically labeled tracers. This study is the first to identify these minor species which likely impact all N-acetylglucosamine-type N-linked glycans from biologics.

Expression of cadherin10, a type II classic cadherin gene, in the nervous system of the embryonic zebrafish.

Cadherins are cell surface adhesion molecules that play important roles in development of tissues and organs. In this study, we analyzed expression pattern of cadherin10, a member of the type II classic cadherin subfamily, in the embryonic zebrafish using in situ hybridization methods. cadherin10 message (cdh10) is first and transiently expressed by the notochord. In the developing nervous system, cdh10 was first detected in a subset of the cranial ganglia, then in restricted brain regions and neural retina. As development proceeds, cdh10 expression domain and/or expression levels increased in the embryonic nervous system. Our results show that cdh10 expression in the zebrafish developing nervous system is both spatially and temporally regulated.

Discovery of the elusive leptin in birds: identification of several 'missing links' in the evolution of leptin and its receptor.

Leptin is a pleiotropic protein best known for regulation of appetite and fat storage in mammals. While many leptin orthologs have been identified among vertebrates, an authentic leptin in birds has remained elusive and controversial. Here we identify leptin sequence from the Peregrine falcon, Falco peregrinus (pfleptin), and identify sequences from two other birds (mallard and zebra finch), and 'missing' vertebrates (elephant shark, alligator, Indian python, Chinese soft-shelled turtle, and coelacanth). The pattern of genes surrounding leptin (snd1, rbm28) is syntenic between the falcon and mammalian genomes. Phylogenetic analysis of all known leptin protein sequences improves our understanding of leptin's evolution. Structural modeling of leptin orthologs highlights a highly conserved hydrophobic core in the four-helix cytokine packing domain. A docked model of leptin with the leptin receptor for Peregrine falcon reveals several conserved amino acids important for the interaction and possible coevolution of leptin with its receptor. We also show for the first time, an authentic avian leptin sequence that activates the JAK-STAT signaling pathway. These newly identified sequences, structures, and tools for avian leptin and its receptor will allow elucidation of the function of these proteins in feral and domestic birds.

The 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleosides in the solid-phase synthesis of oligoribonucleotides.

Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.2 M solutions in dry MeCN and 5-benzylthio-1H-tetrazole as an activator. The coupling efficiency of 9a-d averaged 99% within a coupling time of 180 s. Following removal of all base-sensitive protecting groups, cleavage of the remaining 2'-[4-(N-methylamino)benzyl] acetals from the RNA oligonucleotide was effected in buffered 0.1 M AcOH (pH 3.8) within 30 min at 90 degrees C. RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to those of a commercial RNA oligonucleotide sharing an identical sequence. Enzymatic digestion of the RNA oligomer catalyzed by bovine spleen phosphodiesterase and bacterial alkaline phosphatase revealed no significant amounts of RNA fragments containing (2'-->5')-internucleotidic phosphodiester linkages or noteworthy nucleobase modifications.

Release of DNA oligonucleotides and their conjugates from controlled-pore glass under thermolytic conditions.

The sequential functionalization of long-chain alkylamine controlled-pore glass (CPG) with a 3-hydroxypropyl-(2-cyanoethyl)thiophosphoryl linker and a dinucleoside phosphorotetrazolide leads to a uniquely engineered support for solid-phase synthesis. Unlike conventional succinylated-CPG supports, this support is designed to allow oligonucleotide deprotection and elimination of deprotection side-products to proceed without release of the oligonucleotide. When needed, the DNA oligonucleotide can be thermolytically released in 2 hr under essentially neutral conditions. The modified CPG support has been successfully employed in the synthesis of both native and fully phosphorothioated DNA 20-mers. On the basis of reversed-phase HPLC and electrophoretic analyses, the purity of the released oligonucleotides is comparable to that of identical oligonucleotides synthesized from succinylated-CPG supports, in terms of both shorter-than-full-length oligonucleotide contaminants and overall yields. The detailed preparation of DNA oligonucleotides conjugated with exemplary reporter or functional groups, either at the 3'-terminus or at both 3'- and 5'-termini, is also described.