Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 834
Filtrar
Mais filtros

Tipo de documento
Intervalo de ano de publicação
1.
Regul Toxicol Pharmacol ; 145: 105504, 2023 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-37806614

RESUMO

A database of field measurements of air concentrations of pesticide active ingredients has previously been compiled by CropLife Europe with an aim to revise the default air concentration values and assumptions applied in assessing vapour exposure in the risk assessment of bystanders and residents. The BROWSE model, released in 2014, which is a regulatory risk assessment model that includes the exposure of residents and bystanders has a component relating to post-application vapour inhalation. Predictions of concentration deduced from exposures obtained using the BROWSE model were compared with field measurements of 24-h and 7-day average concentrations. The methodology for obtaining concentration estimates from the BROWSE model is described, and the criteria for including field studies in the comparison are given. The field data were adjusted to account for differences between the field experiment and the BROWSE scenario using factors derived from a separate plume dispersion model. This showed that BROWSE provides a satisfactory level of conservatism in determining potential exposures of residents and bystanders to vapour and could be a reliable alternative to replace the current EFSA approach for predicting vapour inhalation exposures for pesticides where no compound-specific data are available.


Assuntos
Praguicidas , Praguicidas/análise , Exposição por Inalação , Medição de Risco , Europa (Continente) , Gases
2.
Proc Natl Acad Sci U S A ; 117(41): 25414-25422, 2020 10 13.
Artigo em Inglês | MEDLINE | ID: mdl-32989161

RESUMO

Documenting the first appearance of modern humans in a given region is key to understanding the dispersal process and the replacement or assimilation of indigenous human populations such as the Neanderthals. The Iberian Peninsula was the last refuge of Neanderthal populations as modern humans advanced across Eurasia. Here we present evidence of an early Aurignacian occupation at Lapa do Picareiro in central Portugal. Diagnostic artifacts were found in a sealed stratigraphic layer dated 41.1 to 38.1 ka cal BP, documenting a modern human presence on the western margin of Iberia ∼5,000 years earlier than previously known. The data indicate a rapid modern human dispersal across southern Europe, reaching the westernmost edge where Neanderthals were thought to persist. The results support the notion of a mosaic process of modern human dispersal and replacement of indigenous Neanderthal populations.


Assuntos
Arqueologia , Demografia , Fósseis , Emigração e Imigração/história , História Antiga , Humanos , Portugal , Datação Radiométrica
3.
J Zoo Wildl Med ; 54(3): 617-627, 2023 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-37817629

RESUMO

Intervertebral disc disease (IVDD) in captive large felids is a commonly encountered syndrome that is usually treated medically, with surgical cases only sparsely documented in the literature. This case series describes the diagnosis, surgical treatment, and postoperative care of three cases of IVDD in large felids: an 8-yr-old male Bengal tiger (Panthera tigris tigris) with acute paraplegia, a 10-yr-old male tiger of unknown subspecies (Panthera tigris) with progressive tetraparesis, and a 17-yr-old female African lion (Panthera leo) with mild paraparesis. Two cases were diagnosed via magnetic resonance imaging (MRI) and the third was diagnosed with computed tomography myelography. Disc herniations were confirmed during surgery in all cases and via necropsy in two cases. Surgical procedures included a thoracolumbar dorsal hemilaminectomy in one tiger, a cervical hemilaminectomy in the other tiger, and a continuous lumbar dorsal hemilaminectomy in the lion. One tiger was euthanized approximately 1 wk after surgery and the other tiger was euthanized approximately 1 mon after surgery, following a lack of clinical improvement in both cases. The lion, however, improved markedly over several months after surgery before acutely declining secondary to spinal neoplasia. Analysis of these cases suggests that pursuing MRI and surgery as soon as possible after the onset of clinical signs and marking affected disc sites based on imaging to provide landmarks for the surgeon may improve long-term prognosis. Additionally, strict postoperative confinement in an accessible cage is beneficial to facilitate care and prevent overexertion while allowing early movement.


Assuntos
Felidae , Deslocamento do Disco Intervertebral , Leões , Panthera , Tigres , Masculino , Feminino , Animais , Deslocamento do Disco Intervertebral/cirurgia , Deslocamento do Disco Intervertebral/veterinária
4.
Theor Appl Genet ; 135(9): 3247-3264, 2022 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-35925366

RESUMO

KEY MESSAGE: Greater embryo size in a large and carefully phenotyped mapping population was genetically associated with a greater number of longer seminal roots to increase grain yield in droughted field environments. Breeding modification of root architecture is challenging in field environments owing to genetic and phenotypic complexity, and poor repeatability with root sampling. Seeds from a large mapping population varying in embryo size were harvested from a common glasshouse and standardised to a common size before assessing in rolled germination paper at 12 and 20 °C for seedling growth. Differences in genotype means were large and heritabilities high (h2 = 0.55-0.93) indicating strong and repeatable genotypic differences for most root traits. Seminal roots 1 to 3 were produced on all seedlings, whereas growth of seminal roots 4, 5 and 6 was associated with differences in embryo size. Increases in seminal root number from 4 to 6 per plant were strongly, genetically correlated with increases in total seminal length (rg = 0.84, < 0.01). Multivariate analysis confirmed initiation and growth of seminal roots 1, 2 and 3, and of roots 4, 5 and 6 behaved as genetically independent (rPg = 0.15 ns) cohorts. Tails representing extremes in seedling root length and number were associated with significant differences in grain yield of up to 35% in droughted field environments but were not different in irrigated environments. Increases in grain yield were linked to greater lengths of seminal roots 4, 5 and 6 and were largely independent of plant height or development. This is the first report on the genetic relationship of seedling root architecture and embryo size, and potential in selection of seminal root size for accessing deep-soil moisture in droughted environments.


Assuntos
Plântula , Triticum , Grão Comestível/genética , Genótipo , Melhoramento Vegetal , Raízes de Plantas/genética , Plântula/genética , Solo , Triticum/genética
5.
Nanotechnology ; 33(48)2022 Sep 08.
Artigo em Inglês | MEDLINE | ID: mdl-35940063

RESUMO

Devices based on arrays of interconnected magnetic nano-rings with emergent magnetization dynamics have recently been proposed for use in reservoir computing applications, but for them to be computationally useful it must be possible to optimise their dynamical responses. Here, we use a phenomenological model to demonstrate that such reservoirs can be optimised for classification tasks by tuning hyperparameters that control the scaling and input-rate of data into the system using rotating magnetic fields. We use task-independent metrics to assess the rings' computational capabilities at each set of these hyperparameters and show how these metrics correlate directly to performance in spoken and written digit recognition tasks. We then show that these metrics, and performance in tasks, can be further improved by expanding the reservoir's output to include multiple, concurrent measures of the ring arrays' magnetic states.

6.
J Intern Med ; 287(1): 32-41, 2020 01.
Artigo em Inglês | MEDLINE | ID: mdl-31394000

RESUMO

BACKGROUND: Patients with venous thromboembolism (VTE) secondary to transient risk factors may develop VTE recurrences after discontinuing anticoagulation. Identifying at-risk patients could help to guide the duration of therapy. METHODS: We used the RIETE database to assess the prognostic value of d-dimer testing after discontinuing anticoagulation to identify patients at increased risk for recurrences. Transient risk factors were classified as major (postoperative) or minor (pregnancy, oestrogen use, immobilization or recent travel). RESULTS: In December 2018, 1655 VTE patients with transient risk factors (major 460, minor 1195) underwent d-dimer measurements after discontinuing anticoagulation. Amongst patients with major risk factors, the recurrence rate was 5.74 (95% CI: 3.19-9.57) events per 100 patient-years in those with raised d-dimer levels and 2.68 (95% CI: 1.45-4.56) in those with normal levels. Amongst patients with minor risk factors, the rates were 7.79 (95% CI: 5.71-10.4) and 3.34 (95% CI: 2.39-4.53), respectively. Patients with major risk factors and raised d-dimer levels (n = 171) had a nonsignificantly higher rate of recurrences (hazard ratio [HR]: 2.14; 95% CI: 0.96-4.79) than those with normal levels. Patients with minor risk factors and raised d-dimer levels (n = 382) had a higher rate of recurrences (HR: 2.34; 95% CI: 1.51-3.63) than those with normal levels. On multivariate analysis, raised d-dimers (HR: 1.74; 95% CI: 1.09-2.77) were associated with an increased risk for recurrences in patients with minor risk factors, not in those with major risk factors. CONCLUSIONS: Patients with raised d-dimer levels after discontinuing anticoagulant therapy for VTE provoked by a minor transient risk factor were at an increased risk for recurrences.


Assuntos
Produtos de Degradação da Fibrina e do Fibrinogênio/análise , Recidiva , Tromboembolia Venosa/sangue , Fatores Etários , Anticoagulantes/uso terapêutico , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Prognóstico , Sistema de Registros , Fatores de Risco , Tromboembolia Venosa/tratamento farmacológico
7.
J Hum Evol ; 148: 102886, 2020 11.
Artigo em Inglês | MEDLINE | ID: mdl-33031954

RESUMO

The late Early Miocene site of Buluk, Kenya, has yielded fossil remains of several catarrhine primates, including 16 dentognathic specimens of the stem cercopithecoid Noropithecus bulukensis. With the exception of the large sample of Victoriapithecus macinnesi from the middle Miocene of Maboko Island, Kenya, the majority of stem cercopithecoid taxa are represented by small sample sizes. We describe and analyze 91 new cercopithecoid fossils collected from Buluk between 2004 and 2018, including several previously undescribed tooth positions for N. bulukensis, and provide the first evaluation of dental metric and morphological variation in this sample. The results show that the expanded Buluk sample exhibits high levels of dental variation in the postcanine tooth row, similar to V. macinnesi at Maboko, but this variation is consistent with a single-species hypothesis. Subtle differences in the shape of the I1, breadth of the C1 and P3, relative breadth of M1, upper and lower molar distal shelf lengths, the degree of M2 basal flare, and a less-developed lower molar distal lophid differentiate the dentition of N. bulukensis from V. macinnesi. Although differences exist between the N. bulukensis and V. macinnesi dental samples, the high degree of variation within each sample complicates the identification of many individual specimens. New partial maxillae and mandibles allow reassessment of previously described diagnostic differences between N. bulukensis and V. macinnesi, negating upper molar arcade shape as a diagnostic feature and confirming the existence of differences in mandibular symphyseal morphology. Overall, new fossils from Buluk provide new evidence of the dentognathic anatomy of a medium-sized cercopithecoid that coexisted with a diverse group of noncercopithecoid catarrhines at the end of the early Miocene.


Assuntos
Fósseis , Primatas , Animais , Cercopithecidae , Quênia , Dente Molar
8.
Br J Anaesth ; 124(3): 261-270, 2020 03.
Artigo em Inglês | MEDLINE | ID: mdl-31864719

RESUMO

BACKGROUND: The Duke Activity Status Index (DASI) questionnaire might help incorporate self-reported functional capacity into preoperative risk assessment. Nonetheless, prognostically important thresholds in DASI scores remain unclear. We conducted a nested cohort analysis of the Measurement of Exercise Tolerance before Surgery (METS) study to characterise the association of preoperative DASI scores with postoperative death or complications. METHODS: The analysis included 1546 participants (≥40 yr of age) at an elevated cardiac risk who had inpatient noncardiac surgery. The primary outcome was 30-day death or myocardial injury. The secondary outcomes were 30-day death or myocardial infarction, in-hospital moderate-to-severe complications, and 1 yr death or new disability. Multivariable logistic regression modelling was used to characterise the adjusted association of preoperative DASI scores with outcomes. RESULTS: The DASI score had non-linear associations with outcomes. Self-reported functional capacity better than a DASI score of 34 was associated with reduced odds of 30-day death or myocardial injury (odds ratio: 0.97 per 1 point increase above 34; 95% confidence interval [CI]: 0.96-0.99) and 1 yr death or new disability (odds ratio: 0.96 per 1 point increase above 34; 95% CI: 0.92-0.99). Self-reported functional capacity worse than a DASI score of 34 was associated with increased odds of 30-day death or myocardial infarction (odds ratio: 1.05 per 1 point decrease below 34; 95% CI: 1.00-1.09), and moderate-to-severe complications (odds ratio: 1.03 per 1 point decrease below 34; 95% CI: 1.01-1.05). CONCLUSIONS: A DASI score of 34 represents a threshold for identifying patients at risk for myocardial injury, myocardial infarction, moderate-to-severe complications, and new disability.


Assuntos
Tolerância ao Exercício/fisiologia , Indicadores Básicos de Saúde , Cuidados Pré-Operatórios/métodos , Adulto , Idoso , Biomarcadores/sangue , Feminino , Nível de Saúde , Humanos , Masculino , Pessoa de Meia-Idade , Infarto do Miocárdio/etiologia , Infarto do Miocárdio/mortalidade , Peptídeo Natriurético Encefálico/sangue , Fragmentos de Peptídeos/sangue , Complicações Pós-Operatórias/mortalidade , Prognóstico , Estudos Prospectivos , Medição de Risco , Fatores de Risco , Autorrelato , Inquéritos e Questionários
9.
J Lipid Res ; 59(12): 2456-2465, 2018 12.
Artigo em Inglês | MEDLINE | ID: mdl-30318473

RESUMO

LPL is a secreted enzyme that hydrolyzes triglycerides from circulating lipoproteins. Individuals lacking LPL suffer from severe hypertriglyceridemia, a risk factor for acute pancreatitis. One potential treatment is to administer recombinant LPL as a protein therapeutic. However, use of LPL as a protein therapeutic is limited because it is an unstable enzyme that is difficult to produce in large quantities. Furthermore, these considerations also limit structural and biochemical studies that are needed for large-scale drug discovery efforts. We demonstrate that the yield of purified LPL can be dramatically enhanced by coexpressing its maturation factor, LMF1, and by introducing novel mutations into the LPL sequence to render it resistant to proteolytic cleavage by furin. One of these mutations introduces a motif for addition of an N-linked glycan to the furin-recognition site. Furin-resistant LPL has previously been reported, but is not commonly used. We show that our modifications do not adversely alter LPL's enzymatic activity, stability, or in vivo function. Together, these data show that furin-resistant LPL is a useful reagent for both biochemical and biomedical studies.


Assuntos
Furina/metabolismo , Lipase Lipoproteica/metabolismo , Proteínas de Membrana/metabolismo , Animais , Transporte Biológico , Western Blotting , Humanos , Lipase Lipoproteica/genética , Masculino , Proteínas de Membrana/genética , Camundongos
10.
Ann Oncol ; 28(5): 1070-1077, 2017 05 01.
Artigo em Inglês | MEDLINE | ID: mdl-28453704

RESUMO

Background: HER2 (ERBB2) gene amplification and its corresponding overexpression are present in 15-30% of invasive breast cancers. While HER2-targeted agents are effective treatments, resistance remains a major cause of death. The American College of Surgeons Oncology Group Z1041 trial (NCT00513292) was designed to compare the pathologic complete response (pCR) rate of distinct regimens of neoadjuvant chemotherapy and trastuzumab, but ultimately identified no difference. Patients and methods: In supplement to tissues from 37 Z1041 cases, 11 similarly treated cases were obtained from a single institution study (NCT00353483). We have extracted genomic DNA from both pre-treatment tumor biopsies and blood of these 48 cases, and performed whole genome (WGS) and exome sequencing. Coincident with these efforts, we have generated RNA-seq profiles from 42 of the tumor biopsies. Among patients in this cohort, 24 (50%) achieved a pCR. Results: We have characterized the genomic landscape of HER2-positive breast cancer and investigated associations between genomic features and pCR. Cases assigned to the HER2-enriched subtype by RNA-seq analysis were more likely to achieve a pCR compared to the luminal, basal-like, or normal-like subtypes (19/27 versus 3/15; P = 0.0032). Mutational events led to the generation of putatively active neoantigens, but were overall not associated with pCR. ERBB2 and GRB7 were the genes most commonly observed in fusion events, and genomic copy number analysis of the ERBB2 locus indicated that cases with either no observable or low-level ERBB2 amplification were less likely to achieve a pCR (7/8 versus 17/40; P = 0.048). Moreover, among cases that achieved a pCR, tumors consistently expressed immune signatures that may contribute to therapeutic response. Conclusion: The identification of these features suggests that it may be possible to predict, at the time of diagnosis, those HER2-positive breast cancer patients who will not respond to treatment with chemotherapy and trastuzumab. ClinicalTrials.gov identifiers: NCT00513292, NCT00353483.


Assuntos
Antineoplásicos Imunológicos/uso terapêutico , Neoplasias da Mama/tratamento farmacológico , Trastuzumab/uso terapêutico , Idoso , Neoplasias da Mama/genética , Quimioterapia Adjuvante , Variações do Número de Cópias de DNA , Feminino , Estudos de Associação Genética , Genoma Humano , Mutação em Linhagem Germinativa , Humanos , Mutação INDEL , Pessoa de Meia-Idade , Terapia Neoadjuvante , Polimorfismo de Nucleotídeo Único , Receptor ErbB-2/metabolismo , Resultado do Tratamento
11.
Mol Psychiatry ; 21(5): 656-64, 2016 May.
Artigo em Inglês | MEDLINE | ID: mdl-26347317

RESUMO

Selective serotonin reuptake inhibitors (SSRIs) are the most commonly prescribed treatments for depression and, as a class of drugs, are among the most used medications in the world. Concern regarding possible effects of SSRI treatment on fetal development has arisen recently as studies have suggested a link between maternal SSRI use and an increase in birth defects such as persistent pulmonary hypertension, seizures and craniosynostosis. Furthermore, SSRI exposure in adults is associated with decreased bone mineral density and increased fracture risk, and serotonin receptors are expressed in human osteoblasts and osteoclasts. To determine possible effects of SSRI exposure on developing bone, we treated both zebrafish, during embryonic development, and human mesenchymal stem cells (MSCs), during differentiation into osteoblasts, with the two most prescribed SSRIs, citalopram and sertraline. SSRI treatment in zebrafish decreased bone mineralization, visualized by alizarin red staining and decreased the expression of mature osteoblast-specific markers during embryogenesis. Furthermore, we showed that this inhibition was not associated with increased apoptosis. In differentiating human MSCs, we observed a decrease in osteoblast activity that was associated with a decrease in expression of the osteoblast-specific genes Runx2, Sparc and Spp1, measured with quantitative real-time PCR (qRT-PCR). Similar to the developing zebrafish, no increase in expression of the apoptotic marker Caspase 3 was observed. Therefore, we propose that SSRIs inhibit bone development by affecting osteoblast maturation during embryonic development and MSC differentiation. These results highlight the need to further investigate the risks of SSRI use during pregnancy in exposing unborn babies to potential skeletal abnormalities.


Assuntos
Osso e Ossos/efeitos dos fármacos , Osso e Ossos/embriologia , Citalopram/toxicidade , Inibidores Seletivos de Recaptação de Serotonina/toxicidade , Sertralina/toxicidade , Animais , Apoptose/efeitos dos fármacos , Apoptose/fisiologia , Calcificação Fisiológica/efeitos dos fármacos , Calcificação Fisiológica/fisiologia , Cartilagem/efeitos dos fármacos , Cartilagem/embriologia , Células Cultivadas , Modelos Animais de Doenças , Humanos , Células-Tronco Mesenquimais/efeitos dos fármacos , Células-Tronco Mesenquimais/fisiologia , Osteoblastos/efeitos dos fármacos , Osteoblastos/fisiologia , Osteogênese/efeitos dos fármacos , Osteogênese/fisiologia , Peixe-Zebra
12.
Vox Sang ; 112(3): 268-278, 2017 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-28220494

RESUMO

BACKGROUND: Among transfused patients, the effect of the duration of red blood cell storage on mortality remains unclear. This study aims to compare the mortality of patients who were transfused with fresher versus older red blood cells. METHODS: We performed an updated systematic search in the CENTRAL, MEDLINE, EMBASE and CINAHL databases, from January 2015 to October 2016. RCTs of hospitalized patients of any age comparing transfusion of fresher versus older red blood cells were eligible. We used a random-effects model to calculate pooled risk ratios (RRs) with corresponding 95% confidence interval (CI). RESULTS: We identified 14 randomized trials that enrolled 26 374 participants. All-cause mortality occurred in 1219 of 9531 (12·8%) patients who received a transfusion of fresher red blood cells and 1810 of 16 843 (10·7%) in those who received older red blood cells (RR: 1·04, 95% CI: 0·98-1·12, P = 0·90, I2 = 0%, high certainty for ruling out benefit of fresh blood, moderate certainty for ruling out harm of fresh blood). In six studies, in-hospital death occurred in 691 of 7479 (9·2%) patients receiving fresher red cells and 1291 of 14 757 (8·8%) receiving older red cells (RR: 1·06, 95% CI: 0·97-1·15, P = 0·81, I2 = 0%, high certainty for ruling out benefit of fresh blood, moderate certainty for ruling out harm of fresh blood). CONCLUSION: Transfusion of fresher red blood cells does not reduce overall or in-hospital mortality when compared with older red blood cells. Our results support the practice of transfusing patients with the oldest red blood cells available in the blood bank.


Assuntos
Causas de Morte , Transfusão de Eritrócitos , Eritrócitos/metabolismo , Preservação de Sangue , Bases de Dados Factuais , Transfusão de Eritrócitos/efeitos adversos , Eritrócitos/citologia , Mortalidade Hospitalar , Humanos , Ensaios Clínicos Controlados Aleatórios como Assunto , Risco , Fatores de Tempo
13.
Clin Radiol ; 72(10): 904.e11-904.e20, 2017 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-28506798

RESUMO

AIM: To assess observer reliability and diagnostic accuracy in children, of a semi-automated six-point technique developed for vertebral fracture (VF) diagnosis in adults, which records percentage loss of vertebral body height. MATERIALS AND METHODS: Using a semi-automated software program, five observers independently assessed T4 to L4 from the lateral spine radiographs of 137 children and adolescents for VF. A previous consensus read by three paediatric radiologists using a simplified algorithm-based qualitative technique (i.e., no software involved) served as the reference standard. RESULTS: Of a total of 1,781 vertebrae, 1,187 (67%) were adequately visualised according to three or more observers. Interobserver agreement in vertebral readability for each vertebral level for five observers ranged from 0.05 to 0.47 (95% CI: -0.19, 0.76). Intra-observer agreement using the intraclass correlation coefficient (ICC) ranged from 0.25 to 0.61. The overall sensitivity and specificity were 18% (95% CI: 14-22) and 97% (95% CI: 97-98), respectively. CONCLUSION: In contrast to adults, the six-point technique assessing anterior, middle, and posterior vertebral height ratios is neither satisfactorily reliable nor sensitive for VF diagnosis in children. Training of the software on paediatric images is required in order to develop a paediatric standard that incorporates not only specific vertebral body height ratios but also the age-related physiological changes in vertebral shape that occur throughout childhood.


Assuntos
Estatura/fisiologia , Densidade Óssea/fisiologia , Diagnóstico por Computador/métodos , Radiografia/métodos , Fraturas da Coluna Vertebral/diagnóstico , Adolescente , Algoritmos , Criança , Pré-Escolar , Feminino , Humanos , Masculino , Variações Dependentes do Observador , Reprodutibilidade dos Testes , Sensibilidade e Especificidade , Software , Fraturas da Coluna Vertebral/fisiopatologia , Coluna Vertebral/diagnóstico por imagem , Coluna Vertebral/fisiopatologia
14.
Lett Appl Microbiol ; 64(5): 364-369, 2017 May.
Artigo em Inglês | MEDLINE | ID: mdl-28256003

RESUMO

Spores of Bacillus anthracis deposited on surfaces can become airborne again as a result of air currents and mechanical forces. As such, they are a potential source of infection by inhalation. Spores of Bacillus thuringiensis were used to quantify this phenomenon in a simulation of outdoor conditions. Concrete and turf surfaces were inoculated by aerosol to produce high spore densities (greater than 1 × 109  CFU per m2 ) which were then subjected to the passage of air at 10 ms-1 with and without simulated walking. Re-aerosolized spores were sampled by wetted wall cyclone air samplers. The mean total re-aerosolization rate from concrete (m-2  min-1 ) was 1·16 × 10-3 for wind alone and 3·2 × 10-3 for wind and simulated walking while for turf the respective values were 2·7 × 10-4 and 6·7 × 10-4 . SIGNIFICANCE AND IMPACT OF THE STUDY: Following the malicious and/or accidental release of an aerosol of Bacillus anthracis spores, the immediate risk of human inhalation would decrease as the spores were deposited on surfaces or diluted by wind flow. There is, however, a concern that the deposited spores could become re-aerosolized and so present an ongoing hazard. Using an accurate simulant for B. anthracis spores a method is reported here that allowed the enumeration of re-aerosolized spores from concrete and turf by wind flow and footfall. Under the conditions used, the rates of re-aerosolization were low. These findings will need to be verified under real outdoor conditions before the true significance in terms of secondary exposure to pathogenic spores can be assessed.


Assuntos
Aerossóis/efeitos adversos , Bacillus anthracis/isolamento & purificação , Bacillus thuringiensis/isolamento & purificação , Material Particulado/efeitos adversos , Esporos Bacterianos/isolamento & purificação , Humanos , Microbiologia do Solo
15.
BMC Biol ; 14: 47, 2016 06 17.
Artigo em Inglês | MEDLINE | ID: mdl-27317311

RESUMO

BACKGROUND: The epithelial to mesenchymal transition (EMT) has been implicated in metastasis and therapy resistance of carcinomas and can endow cancer cells with cancer stem cell (CSC) properties. The ability to detect cancer cells that are undergoing or have completed EMT has typically relied on the expression of cell surface antigens that correlate with an EMT/CSC phenotype. Alternatively these cells may be permanently marked through Cre-mediated recombination or through immunostaining of fixed cells. The EMT process is dynamic, and these existing methods cannot reveal such changes within live cells. The development of fluorescent sensors that mirror the dynamic EMT state by following the expression of bona fide EMT regulators in live cells would provide a valuable new tool for characterizing EMT. In addition, these sensors will allow direct observation of cellular plasticity with respect to the epithelial/mesenchymal state to enable more effective studies of EMT in cancer and development. RESULTS: We generated a lentiviral-based, dual fluorescent reporter system, designated as the Z-cad dual sensor, comprising destabilized green fluorescent protein containing the ZEB1 3' UTR and red fluorescent protein driven by the E-cadherin (CDH1) promoter. Using this sensor, we robustly detected EMT and mesenchymal to epithelial transition (MET) in breast cancer cells by flow cytometry and fluorescence microscopy. Importantly, we observed dynamic changes in cellular populations undergoing MET. Additionally, we used the Z-cad sensor to identify and isolate minor subpopulations of cells displaying mesenchymal properties within a population comprising predominately epithelial-like cells. The Z-cad dual sensor identified cells with CSC-like properties more effectively than either the ZEB1 3' UTR or E-cadherin sensor alone. CONCLUSIONS: The Z-cad dual sensor effectively reports the activities of two factors critical in determining the epithelial/mesenchymal state of carcinoma cells. The ability of this stably integrating dual sensor system to detect dynamic fluctuations between these two states through live cell imaging offers a significant improvement over existing methods and helps facilitate the study of EMT/MET plasticity in response to different stimuli and in cancer pathogenesis. Finally, the versatile Z-cad sensor can be adapted to a variety of in vitro or in vivo systems to elucidate whether EMT/MET contributes to normal and disease phenotypes.


Assuntos
Técnicas Biossensoriais , Células Epiteliais/citologia , Transição Epitelial-Mesenquimal , Células-Tronco Mesenquimais/citologia , Animais , Antígenos CD , Caderinas/genética , Linhagem Celular Tumoral , Proteínas de Fluorescência Verde/genética , Proteínas de Fluorescência Verde/metabolismo , Humanos , Proteínas Luminescentes/genética , Proteínas Luminescentes/metabolismo , Camundongos , Regiões Promotoras Genéticas , Fator de Crescimento Transformador beta1/farmacologia , Homeobox 1 de Ligação a E-box em Dedo de Zinco/genética , Proteína Vermelha Fluorescente
16.
Matern Child Health J ; 20(6): 1103-13, 2016 06.
Artigo em Inglês | MEDLINE | ID: mdl-27107859

RESUMO

Objectives Domains of psychosocial health have been separately connected to pregnancy outcomes. This study explores the relationship between five domains of psychosocial health and their joint association with prenatal health and pregnancy outcomes. Methods Women from a prospective cohort study in Durham, North Carolina were clustered based on measures of paternal support, perceived stress, social support, depression, and self-efficacy. Clusters were constructed using the K-means algorithm. We examined associations between psychosocial health and maternal health correlates, pregnancy intention, and pregnancy outcomes using Chi square tests and multivariable models. Results Three psychosocial health profiles were identified, with the first (Resilient; n = 509) characterized by low depression and perceived stress and high interpersonal support, paternal support, and self-efficacy. The second profile (Vulnerable; n = 278) was marked by high depression and perceived stress, and low interpersonal support, paternal support, and self-efficacy. The third profile (Moderate, n = 526) fell between the other profiles on all domains. Health correlates, pregnancy intention, and pregnancy outcomes varied significantly across profiles. Women with the vulnerable profile were more likely to have risky health correlates, have an unintended pregnancy, and deliver preterm. Women with the resilient profile had better birth outcomes and fewer deleterious health correlates, preconception and prenatally. Conclusions We posit that vulnerable psychosocial health, deleterious health correlates, and the stress which often accompanies pregnancy may interact to magnify risk during pregnancy. Identifying and intervening with women experiencing vulnerable psychosocial health may improve outcomes for women and their children.


Assuntos
Depressão , Intenção , Resultado da Gravidez/psicologia , Gravidez não Planejada/psicologia , Gestantes/psicologia , Apoio Social , Estresse Psicológico , Adulto , Análise por Conglomerados , Depressão/etiologia , Depressão/prevenção & controle , Feminino , Comportamentos Relacionados com a Saúde , Humanos , North Carolina , Gravidez , Complicações na Gravidez/psicologia , Gravidez não Desejada/psicologia , Estudos Prospectivos , Psicologia , Fatores de Risco , Fatores Socioeconômicos , Estresse Psicológico/complicações , Estresse Psicológico/etiologia
17.
Intern Med J ; 45(11): 1147-53, 2015 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-26337606

RESUMO

BACKGROUND: Elderly patients with diffuse large B-cell lymphoma (DLBCL) have an inferior prognosis, due in part to advanced age and pre-existing comorbidities, with reduced tolerability and deliverability of standard R-CHOP chemotherapy. AIMS: To examine the deliverability, toxicity and efficacy of R-CHOP and the prevalence of the germinal and non-germinal phenotype DLBCL in an elderly Australian cohort. METHODS: This retrospective analysis included patients ≥75 years diagnosed with DLBCL. Comprehensive chemotherapy and toxicity data were collected for patients treated with R-CHOP. Baseline demographics and chemotherapy characteristics were compared with progression-free (PFS) and overall survival (OS). Immunohistochemical staining identified the prevalence of the non-germinal centre (non-GCB) phenotype. RESULTS: Of the 111 patients, 92 (83%) commenced R-CHOP with 26/92 (28%) receiving ≤4 cycles. Median average relative dose (ARD) was 0.80 (0.07-1.17). Median average relative dose intensity (ARDI) was 0.89 (0.33-1.18). Serious adverse events occurred in 77% of patients with ≥Gd3 adverse events in 74%. Overall response rate was 85%. Two-year PFS was 63% and OS 74%. ARD and performance status ≥2 were significant prognostic factors for PFS and OS but not ARDI. Non-GCB-phenotype was identified in 44/72 (61%) of patients with immunohistochemical data. CONCLUSION: Despite high response rates and respectable survival estimates, the absence of standard therapy in 17% of patients, and dose reductions and serious toxicity of R-CHOP in this Australian cohort highlights the need for the development of less toxic yet efficacious treatments for very elderly patients with DLBCL. The high prevalence of the non-GCB phenotype highlights the potential value of targeted biological therapy for this demographic.


Assuntos
Protocolos de Quimioterapia Combinada Antineoplásica/administração & dosagem , Sistemas de Liberação de Medicamentos/métodos , Linfoma Difuso de Grandes Células B/tratamento farmacológico , Linfoma Difuso de Grandes Células B/mortalidade , Idoso , Idoso de 80 Anos ou mais , Anticorpos Monoclonais Murinos/administração & dosagem , Austrália/epidemiologia , Ciclofosfamida/administração & dosagem , Doxorrubicina/administração & dosagem , Feminino , Humanos , Linfoma Difuso de Grandes Células B/diagnóstico , Masculino , Prednisona/administração & dosagem , Estudos Retrospectivos , Rituximab , Taxa de Sobrevida/tendências , Resultado do Tratamento , Vincristina/administração & dosagem
18.
Br J Cancer ; 111(8): 1532-41, 2014 Oct 14.
Artigo em Inglês | MEDLINE | ID: mdl-25101563

RESUMO

BACKGROUND: In this study, we evaluated the ability of gene expression profiles to predict chemotherapy response and survival in triple-negative breast cancer (TNBC). METHODS: Gene expression and clinical-pathological data were evaluated in five independent cohorts, including three randomised clinical trials for a total of 1055 patients with TNBC, basal-like disease (BLBC) or both. Previously defined intrinsic molecular subtype and a proliferation signature were determined and tested. Each signature was tested using multivariable logistic regression models (for pCR (pathological complete response)) and Cox models (for survival). Within TNBC, interactions between each signature and the basal-like subtype (vs other subtypes) for predicting either pCR or survival were investigated. RESULTS: Within TNBC, all intrinsic subtypes were identified but BLBC predominated (55-81%). Significant associations between genomic signatures and response and survival after chemotherapy were only identified within BLBC and not within TNBC as a whole. In particular, high expression of a previously identified proliferation signature, or low expression of the luminal A signature, was found independently associated with pCR and improved survival following chemotherapy across different cohorts. Significant interaction tests were only obtained between each signature and the BLBC subtype for prediction of chemotherapy response or survival. CONCLUSIONS: The proliferation signature predicts response and improved survival after chemotherapy, but only within BLBC. This highlights the clinical implications of TNBC heterogeneity, and suggests that future clinical trials focused on this phenotypic subtype should consider stratifying patients as having BLBC or not.


Assuntos
Antineoplásicos/uso terapêutico , Análise de Sobrevida , Neoplasias de Mama Triplo Negativas/tratamento farmacológico , Estudos de Coortes , Feminino , Humanos , Pessoa de Meia-Idade , Resultado do Tratamento , Neoplasias de Mama Triplo Negativas/fisiopatologia
19.
Plant Dis ; 98(7): 1012, 2014 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-30708932

RESUMO

Fusarium graminearum is an economically important pathogen that causes Fusarium head blight of wheat, barley, and oat, and Gibberella ear and stalk rot of maize. More recently, F. graminearum was reported as a soybean seedling and root pathogen in North America (1,5), causing seed decay, damping-off, and brown to reddish-brown root rot symptoms. Type B trichothecene mycotoxins are commonly produced by F. graminearum, which can be categorized into three trichothecene genotypes; those that produce 3-acetyldeoxynivalenol (3-ADON), 15-acetyldeoxynivalenol (15-ADON), or nivalenol (NIV). The 15-ADON genotype is dominant in populations from small grains and maize in North America (4), but the 3-ADON genotype has recently been found (4). F. graminearum was known as a pathogen of wheat and maize in North America for over a century before it was reported as a soybean pathogen. Therefore, we hypothesized that recent reports on soybean could be associated with the appearance of the 3-ADON genotype. The objective of this research was to determine the trichothecene genotype of F. graminearum isolates from soybean in the United States. Thirty-eight isolates from soybean were evaluated. Twenty-seven isolates came from a 3-year survey for Fusarium root rot from 2007 to 2009 in Iowa. Other isolates (Ahmad Fakhoury, Southern Illinois University, Carbondale) were collected from soybean seedlings during a multi-state survey in 2012, and included three isolates from Illinois, three from Indiana, and five from Nebraska. Species identification and lineage of F. graminearum were confirmed by sequencing the translation elongation factor gene (EF1-α) using EF-1H and EF-2T primers. A maximum likelihood analysis of the EF1-α, including voucher strains from nine lineages of F. graminearum (2), placed all 38 isolates into lineage 7, F. graminearum sensu stricto (representative GenBank accessions KJ415349 to KJ415352). To determine the trichothecene genotype of each isolate we used three multiplex PCR assays. The first two assays targeted a portion of trichothecene biosynthesis genes Tri3 and Tri12 (4), while the third assay targeted portions of the Tri3, Tri5, and Tri7 genes (3). The PCR for the first two assays was conducted as described by Ward et al. (4) using four sets of primers: 3CON, 3NA, 3D15A, and 3D3A; and 12CON, 12NF, 12-15F, and 12-3F for the Tri3 and Tri12 genes, respectively. The PCR for the third assay was conducted as described by Quarta et al. (3) using the following primers: Tri3F971, Tri3F1325, Tri3R1679, Tri7F340, Tri7R965, 3551H, and 4056H. The amplification products were analyzed by gel electrophoresis. All 38 isolates produced amplicons consistent with the 15-ADON genotype; ~610 and 670 bp for the Tri3 and Tri12 genes, respectively (4), and two amplicons of ~708 and 525 bp for the Tri3/Tri5 genes (3). Our results indicated that the dominant trichothecene genotype among isolates of F. graminearum from soybean is 15-ADON, and the introduction of 3-ADON isolates does not explain the recent host shift of F. graminearum to soybean in North America. To our knowledge, this is the first assessment of trichothecene genotypes in F. graminearum populations from soybean from the United States. References: (1) K. E. Broders et al. Plant Dis. 91:1155, 2007. (2) K. O'Donnell et al. Fungal Gen. Biol. 41:600, 2004. (3) A. Quarta et al. FEMS Microbiol. Lett. 259:7, 2006. (4) T. D. Ward et al. Fungal Gen. Biol. 45:473, 2008. (5) A. G. Zue et al. Can. J. Plant Pathol. 29:35, 2007.

20.
Plant Dis ; 98(2): 284, 2014 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-30708780

RESUMO

Grapevine leaf roll-associated viruses (GLRaVs) are a group of nine closely related viruses belonging to the Closteroviridae family that cause grapevine leaf roll disease in vineyards across the world (3). Within the continental United States, GLRaVs have been reported in the states of California, Michigan, Missouri, New York, Oregon, Washington, and Wisconsin, but not in Ohio (2,3). During 2012, grapevines with typical leaf roll symptoms were reported by owners of several Ohio vineyards. The symptoms included small, red leaves and downwardly rolled leaf margins, accompanied by tiny grape clusters with few fruits. A total of 20 symptomatic leaf samples were collected from two sites about 300 miles apart within Ohio, namely Valley Vineyards (cultivars Vidal Blanc and Fronterac) and South River Winery (cultivar Cabernet Franc). Total RNA was extracted from the samples using a previously reported procedure (1) and subjected to reverse transcription (RT)-PCR using specific primers for five known grapevine viruses including GLRaV-1 (1F: 5'-ACCTGGTTGAACGAGATCGCTT and 1R: 5'-GTAAACGGGTGTTCTTCAATTCTCT), GLRaV-2 [2F(FQ): 5'-GCTCCTAACGAGGGTATAGAAG and 2R(FQ): 5'-AGAGCGTACATACTCGCGAACAT], GLRaV-3 [3F(FQ): CAAGTGCTCTAGTTAAGGTCAG and 3R(FQ): 5'-CGGAACGTCGGTTCATTTAGA], Grapevine fan leaf virus (GFLVR1-F: 5'-TGAGATTAGTCATGGAGCAGCTT and GFLVR1-R: 5'-GGATAGACGTCTGGTTGATTTTG), and Tobacco ring spot virus (TRSVR1-1255F: 5'-GAGTGTTGTGCAATTATCT-GCATA and TRSVR1-1844R: 5'-CAAAGATGCCAAGAAAAGTTGCAAG). A 295-bp fragment of a grapevine actin cDNA (primers VvACT-F: 5'-ATCTCCATGTCAACCAAACTGAG and VvACT-R: 5'-GACAGAATGAGCAAGGAAATCAC) was used as a positive control for RT-PCR. The samples tested negative for GFLV, TRSV, or GLRaV-1 with our primer sets. However, four of the samples were positive for GLRaV-2, and 12 positive for GLRaV-3, as evidenced by the detection of PCR fragments of expected sizes (404 and 344 bp, respectively). All samples positive for GLRaV-2 were from a single field, whereas samples positive for GLRaV-3 were from both vineyards examined. The identities of GLRaV-2 and -3 were further confirmed by directly sequencing one GLRaV-2 and two GLRaV-3 (one from each location) PCR fragments from both ends. The 404 bp GLRaV-2-specific fragment shared 95 to 98% sequence identity with various GLRaV-2 isolates whose sequences were deposited at the GenBank. Similarly, the two 344-bp GLRaV-3 fragments share a 95 to 97% identity with known GLRaV-3 isolates. Notably, the sequences of the two GLRaV-3-specific fragments derived from two vineyards are not identical (97% identity), suggesting these two isolates might have different origins. As these viruses are known to be recalcitrant to mechanical transmission, we did not attempt to transmit these viruses to healthy plants. In summary, our results report for the first time the detection of GLRaV-2 and -3 in Ohio, suggesting that these two viruses are associated with the observed leaf roll symptoms, hence should be part of an effective management plan for grapevine viral diseases in the state. References: (1) C. Louime et al. Eur. J. Sci. Res. 22:232, 2008. (2) S. Lunden and W. Qiu. Plant Dis. 96:462, 2012. (3) A. M. Sharma et al. PLoS One 6:e26227, 2011.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA