Transition Metal Complexes with Appended Benzimidazole Groups for Sensing Dihydrogenphosphate.

Four new complexes [Ru(bpy)2(bbib)](PF6)2, [Ru(phen)2(bbib)](PF6)2, [Re(CO)3(bbib)(py)](PF6) and [Ir(ppy)2(bbib)](PF6) [where bbib = 4,4'-bis(benzimidazol-2-yl)-2,2'-bipyridine] have been prepared and their photophysical properties determined. Their behaviour has been studied with a variety of anions in acetonitrile, DMSO and 10% aquated DMSO. Acetate and dihydrogenphosphate demonstrate a redshift in the bbib ligand associated absorptions suggesting that the ligand is strongly interacting with these anions. The 3MLCT emissive state is sensitive to the introduction of small quantities of anion (sub-stoichiometric quantities) and significant quenching is typically observed with acetate, although this is less pronounced in the presence of water. The emissive behaviour with dihydrogenphosphate is variable, showing systematic changes as anion concentration increases with several distinct interactions evident . 1H NMR and 31P NMR titrations in a 10% D2O - D6-DMSO mixture suggest that with dihydrogenphosphate, the imidazole group able to act as both a proton acceptor and donor. It appears that all four complexes can form a {[complex]2-H2PO4} "dimer", a one-to-one species (which the X-ray crystallography study suggests is dimeric in the solid-state), and a complex with a combined bis(dihydrogenphosphate) complex anion. The speciation relies on complex equilibria dependent on several factors including the complex charge, the hydrophobicity of the associated ligands, and the solvent.

Protein destabilisation by ruthenium(II) tris-bipyridine based protein-surface mimetics.

Highly functionalised ruthenium(II) tris-bipyridine receptor 1 which acts as a selective sensor for equine cytochrome c (cyt c) is shown to destabilise the native protein conformation by around 25 °C. Receptors 2 and 3 do not exert this effect confirming the behaviour is a specific effect of molecular recognition between 1 and cyt c, whilst the absence of a destabilising effect on 60% acetylated cyt c demonstrates the behaviour of 1 to be protein specific. Molecular recognition also modifies the conformational properties of the target protein at room temperature as evidenced by ion-mobility spectrometry (IMS) and accelerated trypsin proteolysis.

The use of electrospray mass spectrometry to determine speciation in a dynamic combinatorial library for anion recognition.

The composition of a dynamic mixture of similar 2,2'-bipyridine complexes of iron(II) bearing either an amide (5-benzylamido-2,2'-bipyridine and 5-(2-methoxyethane)amido-2,2'-bipyridine) or an ester (2,2'-bipyridine-5-carboxylic acid benzylester and 2,2'-bipyridine-5-carboxylic acid 2-methoxyethane ester) side chain have been evaluated by electrospray mass spectroscopy in acetonitrile. The time taken for the complexes to come to equilibrium appears to be dependent on the counteranion, with chloride causing a rapid redistribution of two preformed heteroleptic complexes (of the order of 1 hour), whereas the time it takes in the presence of tetrafluoroborate salts is in excess of 24 h. Similarly the final distribution of products is dependent on the anion present, with the presence of chloride, and to a lesser extent bromide, preferring three amide-functionalized ligands, and a slight preference for an appended benzyl over a methoxyethyl group. Furthermore, for the first time, this study shows that the distribution of a dynamic library of metal complexes monitored by ESI-MS can adapt following the introduction of a different anion, in this case tetrabutylammonium chloride to give the most favoured heteroleptic complex despite the increasing ionic strength of the solution.

Examination of the silver colloid binding behavior of disulfide-tethered bipyridine ligands and their fac-tricarbonylrheniumI complexes.

The syntheses of 2,2'-bipyridin-5-ylmethyl-5-(1,2-dithiolan-3-yl)pentanoate (L1) and N-(2,2'-bipyridin-5-ylmethyl)-5-(1,2-dithiolan-3-yl)pentanamide (L2) and their neutral fac carbonylrhenium(I) complexes [Re(L1)(CO)(3)Br] and [Re(L2)(CO)(3)Br] are reported. The electronic absorption and emission spectra of the complexes are similar to the spectrum of the reference compound [Re(bipy)(CO)(3)Br] and correlate well with the density functional theory calculations undertaken. The surface-enhanced Raman spectroscopy (SERS) spectra (excited at both 532 and 785 nm) of the ligands and complexes were examined and compared to the spectrum of ethyl 5-(1,2-dithiolan-3-yl)pentanoate (L3), revealing that there is very little contribution to the spectra of these species from the dithiolated alkyl chains. The spectra are dominated by the characteristic peaks of a metalated 2,2'-bipyridyl group, arising from the silver colloid/ion complexation, and the rhenium center. The rhenium complexes show weak SERS bands related to the CO stretches and a broad band at 510 cm(-1) assigned to Re-CO stretching. Concentration-dependent studies, measured by the relative intensity of several assigned peaks, indicate that, as the surface coverage increases, the bipyridine moiety lifts off the surface. In the case of L1 and L2, this gives rise to complexes with silver at low concentration, enhancing the signals observed, while for the tricarbonylbromorhenium complexes of these ligands, the presence of the disulfide tether allows an enhancement in the limits of detection of these surface-borne species of 20 times in the case of [ReL2(CO)(3)Br] over [Re(bipy)(CO)(3)Br].

The dichotomy in the DNA-binding behaviour of ruthenium(II) complexes bearing benzoxazole and benzothiazole groups.

The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy=2,2'-bipyridine and bbob=bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb=bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'-bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the Delta isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Lambda-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the Delta isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.

mer and fac isomerism in tris chelate diimine metal complexes.

In this perspective, we highlight the issue of meridional (mer) and facial (fac) orientation of asymmetrical diimines in tris-chelate transition metal complexes. Diimine ligands have long been the workhorse of coordination chemistry, and whilst there are now good strategies to isolate materials where the inherent metal centered chirality is under almost complete control, and systematic methodologies to isolate heteroleptic complexes, the conceptually simple geometrical isomerism has not been widely investigated. In systems where the two donor atoms are significantly different in terms of the σ-donor and π-accepting ability, the fac isomer is likely to be the thermodynamic product. For the diimine complexes with two trigonal planar nitrogen atoms there is much more subtlety to the system, and external factors such as the solvent, lattice packing and the various steric considerations play a delicate role in determining the observed and isolable product. In this article we discuss the possibilities to control the isomeric ratio in labile systems, consider the opportunities to separate inert complexes and discuss the observed differences in their spectroscopic properties. Finally we report on the ligand orientation in supramolecular systems where facial coordination leads to simple regular structures such as helicates and tetrahedra, but the ability of the ligand system to adopt a mer orientation enables self-assembled structures of considerable beauty and complexity.

The isolation and secondary functionalisation of fac-tris-2,2'-bipyridine complexes of ruthenium(II).

fac-Ruthenium(II) tris-(5-carboxy-2,2'-bipyridine) has been synthesised as a single geometric isomer for the first time, and proves to be a good 'building-block' to introduce new functionality with retention of the isomeric integrity.

Molecular Architecture of Polynuclear Ruthenium Bipyridyl Complexes with Controlled Metal Helicity.

The synthesis of di- and trinuclear ruthenium(II) complexes is reported, where each metal center has a tris(bidentate) octahedral coordination sphere with predetermined stereochemistry. New members of the "Chiragen" ligand series, consisting of two linked chiral 4,5-pineno-2,2'-bipyridine groups, have been prepared, with small spacer units between the coordination centers (-(CH(2))(n)() {n = 0, 3} and -CH(2)(bpy)CH(2)-). X-ray structural data were obtained for the ligand Chiragen[3]. (Crystal data: orthorhombic, space group P2(1)2(1)2(1), a = 12.229(1) Å, b = 12.790(1) Å, c = 20.215(1) Å, V = 3161.8(4) Å(3), Z = 4.) Combination of the ligands with Ru(bpy)(2)Cl(2) (where bpy is 2,2'-bipyridine) led to a mixture of diastereomers, while the use of enantiomerically pure Delta- or Lambda-[Ru(bpy)(2)(py)(2)](dibenzoyltartrate) or Delta-Ru(CG[m-xyl])Cl(2) led to almost complete stereoselectivity in the products. Circular dichroism spectra show that the complexes are composed of one helical diastereomer, with the expected absolute configuration predetermined by the chiral building block used. Additionally, (1)H-NMR spectroscopy indicates C(2) point group symmetry for the structures in solution, confirming the absence of DeltaLambda diastereomers.

Ruthenium cryptates with an unusual selectivity for nitrate.

The synthesis of two new tripodal complexes [Ru(L3)](PF(6))(2) and [Ru(L4)](PF(6))(2), encapsulating a ruthenium(II) cation, has been successfully achieved and the products fully characterized, including by X-ray structural determination. The smaller cavity, built around a tris(2-aminoethyl)amido scaffold demonstrated only moderate and predictable interactions with a range of anions and no significant spectroscopic change with nitrate, chloride and bromide, although dihydrogen phosphate did result in an almost stoichiometric precipitation. The expansion of the cavity to include the more rigid 1,3,5-benzenetricarbonylamide group creates a larger cavity, which shows a decrease in the emission on the introduction of chloride, bromide, hydrogen sulfate and nitrate salts, with the (1)H NMR titrations giving a surprisingly high binding affinity for nitrate over the smaller and simpler halides.

Raman spectroscopy for forensic examination of ß-ketophenethylamine "legal highs": reference and seized samples of cathinone derivatives.

Raman spectra of a representative range of ß-ketophenethylamine (ß-KP), the rapidly growing family of cathinone-related "legal high" recreational drugs, have been recorded. These spectra showed characteristic changes that were associated with the pattern of substitution on the aromatic rings, for example, the compounds carrying substituents at the 4- position could be distinguished from 3,4-methylenedioxy "ecstasy" derivatives. They also showed small but detectable changes with differences in substitution on the ethylamine substituent. These features allowed the ß-KPs present in seized casework samples to be identified. The seized samples typically contained only small amounts of bulking agents, which meant that the band intensities of these components within averaged data were very small. In contrast, grid sampling normally gave at least some spectra which had a higher than average proportion of the bulking agent(s), which allowed them to also be identified. This study therefore demonstrates that Raman spectroscopy can be used both to provide a rapid, non-destructive technique for identification of this class of drugs in seized samples and to detect minor constituents, giving a composition profile which can be used for drugs intelligence work.

Diastereoselective assembly of pentanuclear circular helicates.

Reaction of a ligand which contains two N-donor and O-donor tridentate domains separated by a 1,3-phenylene spacer unit with Zn(2+) ions results in a pentanuclear circular helicate [Zn(5)(L)(5)](10+) and this structure persists in both the solid and solution state. The formation of this high nuclearity species is governed by unfavourable steric interactions between the phenyl units which destabilize the simple linear helicate. Incorporation of enantiopure units within the ligand strand controls the diastereoselectivity with up to 80% d.e.

Protein surface recognition using geometrically pure Ru(II) tris(bipyridine) derivatives.

This manuscript illustrates that the geometric arrangement of protein-binding groups around a ruthenium(II) core leads to dramatic differences in cytochrome c (cyt c) binding highlighting that it is possible to define synthetic receptors with shape complementarity to protein surfaces.

Substituted dipyridophenazine complexes of Cr(III): synthesis, enantiomeric resolution and binding interactions with calf thymus DNA.

[Cr(phen)(2)(X(2)dppz)](3+) {X = H, Me, or F} have been synthesised, characterised, and chromatographically resolved into their constituent Delta and Lambda enantiomers. The DNA-binding interactions of each of the racemic complexes were investigated, with the results of linear dichroism, thermal denaturation, and emission quenching studies indicative of intercalative binding to CT-DNA with a significant electrostatic contribution. UV/Vis absorption titrations suggest strong DNA binding by each of the racemic complexes, with the methylated analogue [Cr(phen)(2)(Me(2)dppz)](3+) exhibiting the largest equilibrium binding constant. Emission quenching and UV-Vis titrations of the enantiomers of [Cr(phen)(2)(dppz)](3+) imply similar binding affinities for the Delta and Lambda isomers, although significant differences between the circular dichroism spectra of the enantiomers in the presence of DNA connote differences in binding orientation and/or conformation between the two.

The comparison of fac and mer ruthenium(ii) trischelate complexes in anion binding.

The synthesis of three new homoleptic trischelate ruthenium(ii) complexes bearing new 2,2'-bipyridine ligands, 5,5'-dibenzylamido-2,2'-bipyridine () and 5-benzylamido-2,2'-bipyridine (L1) has been achieved. In the case of [Ru(L2)(3)](2+), the mer and fac isomers have been separated. (1)H NMR spectroscopic anion binding studies indicate that the two C(3)-symmetric pockets provided by [Ru(L1)(3)](2+) is conducive to receive a range of anions, although this is not readily reflected in the photophysical behaviour. The fac-isomer of [Ru(L2)(3)](2+) does appear to have an enhancement in the binding interactions over the mer form with dihydrogenphosphate salts, although the difference is much less marked with the spherical chloride ions. From X-ray crystallographic evidence, the ability to hold water in the "anion" binding cleft can inhibit the strength of the interactions with anions, giving rise to the observed selectivity for directional oxoanions such as dihydrogen phosphate.

Anion detection driven by a surprising internal hydrogen-bonding association in a dinuclear rhenium(I) complex.

A neutral dinuclear rhenium(I) bipyridinetricarbonyl bromide complex has been investigated with a range of anions, giving a remarkable binding affinity for dihydrogenphosphate. These studies highlight that anion sensing can be achieved with structurally simple species provided that the compound adopts an unconventional conformation, through, for example, intramolecular hydrogen bonding in solution.

Benzothiazole bipyridine complexes of ruthenium(II) with cytotoxic activity.

A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.

New stepwise approach to inert heterometallic triple-stranded helicates.

The new tripodal fac-functionalized building block, fac-ruthenium(II) tris-(5-hydroxymethyl-2,2'-bipyridine), has been synthesized as a single geometric isomer and used as starting point in the isolation of a kinetically inert heterometallic helicate by the stepwise inclusion of additional 2,2'-bipyridine chelating groups followed by a second metal ion. This stepwise synthetic methodology gives access to a new range of chiral nanoscale structures inaccessible by traditional self-assembly procedures.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents.

The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.