Association between CYP2C9 and VKORC1 genetic polymorphisms and efficacy and safety of warfarin in Chinese patients.

OBJECTIVES: Genetic variation has been a major contributor to interindividual variability of warfarin dosage requirement. The specific genetic factors contributing to warfarin bleeding complications are largely unknown, particularly in Chinese patients. In this study, 896 Chinese patients were enrolled to explore the effect of CYP2C9 and VKORC1 genetic variations on both the efficacy and safety of warfarin therapy. METHODS AND RESULTS: Univariate analyses unveiled significant associations between two specific single nucleotide polymorphisms rs1057910 in CYP2C9 and rs9923231 in VKORC1 and stable warfarin dosage ( P  < 0.001). Further, employing multivariate logistic regression analysis adjusted for age, sex and height, the investigation revealed that patients harboring at least one variant allele in CYP2C9 exhibited a heightened risk of bleeding events compared to those with the wild-type genotype (odds ratio = 2.16, P  = 0.04). Moreover, a meta-analysis conducted to consolidate findings confirmed the associations of both CYP2C9 (rs1057910) and VKORC1 (rs9923231) with stable warfarin dosage. Notably, CYP2C9 variant genotypes were significantly linked to an increased risk of hemorrhagic complications ( P  < 0.00001), VKORC1 did not demonstrate a similar association. CONCLUSION: The associations found between specific genetic variants and both stable warfarin dosage and bleeding risk might be the potential significance of gene detection in optimizing warfarin therapy for improving patient efficacy and safety.

Analysis of pathogenic variants in 605 Chinese children with non-syndromic cardiac conotruncal defects based on targeted sequencing.

OBJECTIVE: Deleterious genetic variants comprise one cause of cardiac conotruncal defects (CTDs). Genes associated with CTDs are gradually being identified. In the present study, we aimed to explore the profile of genetic variants of CTD-associated genes in Chinese patients with non-syndromic CTDs. METHODS: Thirty-nine CTD-related genes were selected after reviewing published articles in NCBI, HGMD, OMIM, and HPO. In total, 605 patients with non-syndromic CTDs and 300 healthy controls, all of Han ethnicity, were recruited. High-throughput targeted sequencing was used to detect genetic variants in the protein-coding regions of genes. We performed rigorous variant-level filtrations to identify potentially damaging variants (Dvars) using prediction programs including CADD, SIFT, PolyPhen-2, and MutationTaster. RESULT: Dvars were detected in 66.7% (26/39) of the targeted CTD-associated genes. In total, 11.07% (67/605) of patients with non-syndromic CTDs were found to carry one or more Dvars in targeted CTD-associated genes. Dvars in FOXH1, TBX2, NFATC1, FOXC2, and FOXC1 were common in the CTD cohort (1.5% [9/605], 1.2% [7/605], 1.2% [7/605], 1% [6/605], and 0.5% [3/605], respectively). CONCLUSION: Targeted exon sequencing is a cost-effective approach for the genetic diagnosis of CTDs. Our findings contribute to an understanding of the genetic architecture of non-syndromic CTDs.

De novo disruptive heterozygous MMP21 variants are potential predisposing genetic risk factors in Chinese Han heterotaxy children.

BACKGROUND: Heterotaxy syndrome (HTX) is caused by aberrant left-right patterning early in embryonic development, which results in abnormal positioning and morphology of the thoracic and abdominal organs. Currently, genetic testing discerns the underlying genetic cause in less than 20% of sporadic HTX cases, indicating that genetic pathogenesis remains poorly understood. In this study, we aim to garner a deeper understanding of the genetic factors of this disease by documenting the effect of different matrix metalloproteinase 21 (MMP21) variants on disease occurrence and pathogenesis. METHODS: Eighty-one HTX patients with complex congenital heart defects and 89 healthy children were enrolled, and we investigated the pathogenetic variants related to patients with HTX by exome sequencing. Zebrafish splice-blocking Morpholino oligo-mediated transient suppression assays were performed to confirm the potential pathogenicity of missense variants found in these patients with HTX. RESULTS: Three MMP21 heterozygous non-synonymous variants (c.731G > A (p.G244E), c.829C > T (p.L277F), and c.1459A > G (p.K487E)) were identified in three unrelated Chinese Han patients with HTX and complex congenital heart defects. Sanger sequencing confirmed that all variants were de novo. Cell transfection assay showed that none of the variants affect mRNA and protein expression levels of MMP21. Knockdown expression of mmp21 by splice-blocking Morpholino oligo in zebrafish embryos revealed a heart looping disorder, and mutant human MMP21 mRNA (c.731G > A, c.1459A > G, heterozygous mRNA (wild-type&c.731G > A), as well as heterozygous mRNA (wild-type& c.1459A > G) could not effectively rescue the heart looping defects. A patient with the MMP21 p.G244E variant was identified with other potential HTX-causing missense mutations, whereas the patient with the MMP21 p.K487E variant had no genetic mutations in other causative genes related to HTX. CONCLUSION: Our study highlights the role of the disruptive heterozygous MMP21 variant (p.K487E) in the etiology of HTX with complex cardiac malformations and expands the current mutation spectrum of MMP21 in HTX.

Predisposition to atrioventricular septal defects may be caused by SOX7 variants that impair interaction with GATA4.

Atrioventricular septal defects (AVSD) are a complicated subtype of congenital heart defects for which the genetic basis is poorly understood. Many studies have demonstrated that the transcription factor SOX7 plays a pivotal role in cardiovascular development. However, whether SOX7 single nucleotide variants are involved in AVSD pathogenesis is unclear. To explore the potential pathogenic role of SOX7 variants, we recruited a total of 100 sporadic non-syndromic AVSD Chinese Han patients and screened SOX7 variants in the patient cohort by targeted sequencing. Functional assays were performed to evaluate pathogenicity of nonsynonymous variants of SOX7. We identified three rare SOX7 variants, c.40C > G, c.542G > A, and c.743C > T, in the patient cohort, all of which were found to be highly conserved in mammals. Compared to the wild type, these SOX7 variants had increased mRNA expression and decreased protein expression. In developing hearts, SOX7 and GATA4 were highly expressed in the region of atrioventricular cushions. Moreover, SOX7 overexpression promoted the expression of GATA4 in human umbilical vein endothelial cells. A chromatin immunoprecipitation assay revealed that SOX7 could directly bind to the GATA4 promoter and luciferase assays demonstrated that SOX7 activated the GATA4 promoter. The SOX7 variants had impaired transcriptional activity relative to wild-type SOX7. Furthermore, the SOX7 variants altered the ability of GATA4 to regulate its target genes. In conclusion, our findings showed that deleterious SOX7 variants potentially contribute to human AVSD by impairing its interaction with GATA4. This study provides novel insights into the etiology of AVSD and contributes new strategies to the prenatal diagnosis of AVSD.

Nonframeshifting indel variations in polyalanine repeat of HOXD13 gene underlies hereditary limb malformation for two Chinese families.

BACKGROUND: Polydactyly and syndactyly are the most common hereditary limb malformations. Molecular genetic testing is of great significance for hereditary limb malformations, which can establish prognosis and recurrence risk of surgical intervention. METHODS: The present study aimed to identify the genetic etiologies of a three-generation family with postaxial polydactyly and a four-generation family with postaxial syndactyly. Whole exome sequencing was used, followed by standard mutation screening procedure, Sanger sequencing and bioinformatics analysis. RESULTS: Two nonframeshifting insertion/deletion (indel) mutations in HOXD13 (c.206_207ins AGCGGCGGCTGCGGCGGCGGCGGC:p.A68insAAAAAAAA or c.171_182delGGCGGCGGCGGC: p.56_60delAAAA) were successfully identified as the pathogenic mutation. The two nonframeshifting indel mutations led to truncation or expansion of homopolymeric alanine (Poly-Ala) repeats of HOXD13 proteins. Sequence alignment of HOXD13 protein among many different species for Poly-Ala position is highly conserved. Hypothetical three-dimensional (3-D) structural analysis further showed mutant HOXD13 proteins (p.A68insAAAAAAAA and p.56_60delAAAA) converted the disordered fragment into a short ß-strand (residues 63-68 or residues 64-68), thereby forming a conformational change. CONCLUSIONS: The present study identified two nonframeshifting mutations of HOXD13 polyalanine repeat location in two Chinese families with postaxial polydactyly or postaxial syndactyly. Our results also provide new insights into genetic counseling and clinical management.

15q11.2 deletion is enriched in patients with total anomalous pulmonary venous connection.

INTRODUCTION: CNV is a vital pathogenic factor of congenital heart disease (CHD). However, few CNVs have been reported for total anomalous pulmonary venous connection (TAPVC), which is a rare form of CHD. Using case-control study, we identified 15q11.2 deletion associated with TAPVC. We then used a TAPVC trio as model to reveal possible molecular basis of 15q11.2 microdeletion. METHODS: CNVplex and Chromosomal Microarray were used to identify and validate CNVs in samples from 231 TAPVC cases and 200 healthy controls from Shanghai Children's Medical Center. In vitro cardiomyocyte differentiation of induced pluripotent stem cells from peripheral blood mononuclear cells for a TAPVC trio with paternal inherited 15q11.2 deletion was performed to characterise the effect of the deletion on cardiomyocyte differentiation and gene expression. RESULTS: The 15q11.2 microdeletion was significantly enriched in patients with TAPVC compared with healthy control (13/231 in patients vs 0/200 in controls, p=5.872×10-2, Bonferroni adjusted) using Fisher's exact test. Induced pluripotent stem cells from the proband could not differentiate into normal cardiomyocyte. Transcriptomic analysis identified a number of differentially expressed genes in the 15q11.2 deletion carriers of the family. TAPVC disease-causing genes such as PITX2, NKX2-5 and ANKRD1 showed significantly higher expression in the proband compared with her healthy mother. Knockdown of TUBGCP5 could lead to abnormal cardiomyocyte differentiation. CONCLUSION: We discovered that the 15q11.2 deletion is significantly associated with TAPVC. Gene expression profile that might arise from 15q11.2 deletion for a TAPVC family was characterised using cell experiments.

Identification of a novel ANO5 missense mutation in a Chinese family with familial florid osseous dysplasia.

Familial florid osseous dysplasia (FFOD) is an autosomal dominant disorder of connective tissue, characterized by lobulated cementum-like masses scattered throughout the jaws and the alveolar process. This study aimed to identify the genetic etiology of a three-generation Chinese family affected with FFOD. A novel missense mutation p.C356W in anoctamin 5 (ANO5) gene was successfully identified as the pathogenic mutation by whole-exome sequencing (WES). The p.C356W mutation is located in the first loop between the first and second transmembrane domain of ANO5 protein. Sequence alignment of ANO5 protein among many different species revealed that this position is highly conserved. The p.C356W mutation may damage the predicted protein stability of ANO5 by altering the structure of several extracellular loops of ANO5 and affecting the formation of the disulfide bond, thereby disrupting the correct folding of ANO5 protein. Thus, the amino acid at position 356 appears to play a key role in the protein structural stability and function of ANO5 protein. Our results may also provide new insights into the cause and diagnosis of FFOD and may have implications for genetic counseling and clinical management.

Identification of TBX2 and TBX3 variants in patients with conotruncal heart defects by target sequencing.

BACKGROUND: Conotruncal heart defects (CTDs) are heterogeneous congenital heart malformations that result from outflow tract dysplasia; however, the genetic determinants underlying CTDs remain unclear. Increasing evidence demonstrates that dysfunctional TBX2 and TBX3 result in outflow tract malformations, implying that both of them are involved in CTD pathogenesis. We screened for TBX2 and TBX3 variants in a large cohort of CTD patients (n = 588) and population-matched healthy controls (n = 300) by target sequencing and genetically analyzed the expression and function of these variants. RESULTS: The probably damaging variants p.R608W, p.T249I, and p.R616Q of TBX2 and p.A192T, p.M65L, and p.A562V of TBX3 were identified in CTD patients, but none in controls. All altered amino acids were highly conserved evolutionarily. Moreover, our data suggested that mRNA and protein expressions of TBX2 and TBX3 variants were altered compared with those of the wild-type. We screened PEA3 and MEF2C as novel downstream genes of TBX2 and TBX3, respectively. Functional analysis revealed that TBX2R608W and TBX2R616Q variant proteins further activated HAS2 promoter but failed to activate PEA3 promoter and that TBX3A192T and TBX3A562V variant proteins showed a reduced transcriptional activity over MEF2C promoter. CONCLUSIONS: Our results indicate that the R608W and R616Q variants of TBX2 as well as the A192T and A562V variants of TBX3 contribute to CTD etiology; this was the first association of variants of TBX2 and TBX3 to CTDs based on a large population.

Rare Copy Number Variations Might Not be Involved in the Molecular Pathogenesis of PA-IVS in an Unselected Chinese Cohort.

Congenital heart defect (CHD) is one of the most common birth defects in China, while pulmonary atresia with intact ventricular septum (PA-IVS) is the life-threatening form of CHD. Numerous previous studies revealed that rare copy number variants (CNVs) play important roles in CHD, but little is known about the prevalence and role of rare CNVs in PA-IVS. In this study, we conducted a genome-wide scanning of rare CNVs in an unselected cohort consisted of 54 Chinese patients with PA-IVS and 20 patients with pulmonary atresia with ventricular septal defect (PA-VSD). CNVs were identified in 6/20 PA-VSD patients (30%), and three of these CNVs (15%) were considered potentially pathogenic. Two pathogenic CNVs occurred at a known CHD locus (22q11.2) and one likely pathogenic deletion located at 13q12.12. However, no rare CNVs were detected in patients with PA-IVS. Potentially pathogenic CNVs were more enriched in PA-VSD patients than in PA-IVS patients (p = 0.018). No rare CNVs were detected in patients with PA-IVS in our study. PA/IVS might be different from PA/VSD in terms of genetics as well as anatomy.

Accurate diagnosis of spinal muscular atrophy and 22q11.2 deletion syndrome using limited deoxynucleotide triphosphates and high-resolution melting.

BACKGROUND: Copy number variation (CNV) has been implicated in the genetics of multiple human diseases. Spinal muscular atrophy (SMA) and 22q11.2 deletion syndrome (22q11.2DS) are two of the most common diseases which are caused by DNA copy number variations. Genetic diagnostics for these conditions would be enhanced by more accurate and efficient methods to detect the relevant CNVs. METHODS: Competitive PCR with limited deoxynucleotide triphosphates (dNTPs) and high-resolution melting (HRM) analysis was used to detect 22q11.2DS, SMA and SMA carrier status. For SMA, we focused on the copy number of SMN1 gene. For 22q11.2DS, we analyzed CNV for 3 genes (CLTCL1, KLHL22, and PI4KA) which are located between different region-specific low copy repeats. CFTR was used as internal reference gene for all targets. Short PCR products with separated Tms were designed by uMelt software. RESULTS: One hundred three clinical patient samples were pretested for possible SMN1 CNV, including carrier status, using multiplex ligation-dependent probe amplification (MLPA) commercial kit as gold standard. Ninety-nine samples consisting of 56 wild-type and 43 22q11.2DS samples were analyzed for CLTCL1, KLHL22, and PI4KA CNV also using MLPA. These samples were blinded and re-analyzed for the same CNVs using the limited dNTPs PCR with HRM analysis and the results were completely consistent with MLPA. CONCLUSIONS: Limited dNTPs PCR with HRM analysis is an accurate method for detecting SMN1 and 22q11.2 CNVs. This method can be used quickly, reliably, and economically in large population screening for these diseases.

A loss-of-function mutation p.T52S in RIPPLY3 is a potential predisposing genetic risk factor for Chinese Han conotruncal heart defect patients without the 22q11.2 deletion/duplication.

BACKGROUND: Conotruncal heart defect (CTD) is a complex congenital heart disease with a complex and poorly understood etiology. The transcriptional corepressor RIPPLY3 plays a pivotal role in heart development as a negative regulator of the key cardiac transcription factor TBX1. A previous study showed that RIPPLY3 contribute to cardiac outflow tract development in mice, however, the relationship between RIPPLY3 and human cardiac malformation has not been reported. METHODS: 615 unrelated CTD Chinese Han patients were enrolled, we excluded the 22q11.2 deletion/duplication using a modified multiplex ligation-dependent probe amplification method-CNVplex®, and investigated the variants of RIPPLY3 in 577 patients without the 22q11.2 deletion/duplication by target sequencing. Functional assays were performed to testify the potential pathogenicity of nonsynonymous variants found in these CTD patients. RESULTS: Four rare heterozygous nonsynonymous variants (p.P30L, p.T52S, p.D113N and p.V179D) were identified in four CTD patients, the variant NM_018962.2:c.155C>G (p.T52S) is referred as rs745539198, and the variant NM_018962.2:c.337G>A (p.D113N) is referred as rs747419773. However, variants p.P30L and p.V179D were not found in multiple online human gene variation databases. Western blot analysis and immunofluorescence showed that there were no significant difference between wild type RIPPLY3 and these four variants. Luciferase assays revealed that the p.T52S variant altered the inhibition of TBX1 transcriptional activity in vitro, and co-immunoprecipitation assays showed that the p.T52S variant reduced the physical interaction of RIPPLY3 with TBX1. In addition to the results from pathogenicity prediction tools and evolutionary protein conservation, the p.T52S variant was thought to be a potentially deleterious variant. CONCLUSION: Our results provide evidence that deleterious variants in RIPPLY3 are potential molecular mechanisms involved in the pathogenesis of human CTD.

Intracellular osteopontin negatively regulates toll-like receptor 4-mediated inflammatory response via regulating GSK3ß and 4EBP1 phosphorylation.

Toll-like receptors (TLRs) play an important role in host defense against invading pathogens. By initiating a signal transduction cascade, TLRs lead to the release of pro-inflammatory cytokines. However, the inappropriate activation of TLR signaling could result in inflammatory disorders or autoimmune diseases. Osteopontin (OPN) has been reported to be an inflammatory cytokine participating in cell-mediated immunity. However, the role of OPN in TLR-mediated immune responses is poorly understood. In the present study, OPN-deficient (OPN-/-) macrophages exhibited significantly higher levels of pro-inflammatory cytokines after stimulation with lipopolysaccharide (LPS). Our study also demonstrated that the intracellular OPN (iOPN) isoform acted as a negative regulator to inhibit LPS-induced inflammatory responses. Compared to WT macrophages, OPN-/- macrophages had lower Akt phosphorylation levels and higher GSK3ß phosphorylation levels, which were downregulated by p-Akt. Moreover, as a down-stream target of Akt, 4EBP1 was hypo-phosphorylated in OPN-/- macrophages compared to 4EBP1 in WT macrophages. These findings reveal that iOPN can regulate GSK3ß and 4EBP1 phosphorylation to inhibit TLR4-mediated inflammatory responses.

Mutational screening of GLI3, SHH, preZRS, and ZRS in 102 Chinese children with nonsyndromic polydactyly.

BACKGROUND: Polydactyly is a group of congenital limb malformations that show high degree of phenotypic variability and genetic heterogeneity. RESULTS: In the present study, four genomic regions (exons of GLI3, SHH, and noncoding sequences of preZRS and ZRS) involved in hedgehog (Hh) signaling pathway were sequenced for 102 unrelated Chinese children with nonsyndromic polydactyly. Two GLI3 variants (c.2844 G > G/A; c.1486C > C/T) and four preZRS variants (chr7:156585336 A>G; chr7:156585421 C>A; chr7: 156585247 G>C; chr7:156585420 A > C) were observed in 2(2.0%) and 6(5.9%) patients, respectively. These variants are not over-represented in the Chinese healthy population. All the 8 cases showed preaxial polydactyly in hands. Additionally, no specific patterns of malformation predicted mutations in other candidate genes or sequences. CONCLUSIONS: This is the first report of the assessment of the frequency of GLI3/SHH/preZRS/ZRS in Chinese patients to show any higher possibility of mutations or variants for the 4 genes or sequences in China. Developmental Dynamics 246:392-402, 2017. © 2017 Wiley Periodicals, Inc.

Exome Sequencing Identified a Novel FBN2 Mutation in a Chinese Family with Congenital Contractural Arachnodactyly.

Congenital contractural arachnodactyly (CCA) is an autosomal dominant disorder of connective tissue. CCA is characterized by arachnodactyly, camptodactyly, contrature of major joints, scoliosis, pectus deformities, and crumpled ears. The present study aimed to identify the genetic cause of a three-generation Chinese family with CCA. We successfully identified a novel missense mutation p.G1145D in the fibrillin-2 (FBN2) gene as the pathogenic mutation by whole exome sequencing (WES). The p.G1145D mutation occurs in the 12th calcium-binding epidermal growth factor-like (cbEGF) domain. The p.G1145D mutation caused a hydrophobic to hydrophilic substitution, altering the amino acid property from neutral to acidic. Three-dimensional structural analysis showed that this mutation could alter the conformation of the residue side chain, thereby producing steric clashes with spatially adjacent residues, disrupting the formation of H bonds and causing folding destabilization. Therefore, this amino acid appears to play an important role in the structure and function of FBN2. Our results may also provide new insights into the cause and diagnosis of CCA and may have implications for genetic counseling and clinical management.

Three novel missense mutations in the filamin B gene are associated with isolated congenital talipes equinovarus.

Congenital talipes equinovarus (CTEV) is one of the most common musculoskeletal disorders. Genetic factors have been suggested to be an important contributor to its pathogenesis. Some genes, including PITX1, TBX4, and RBM10, have been associated with CTEV. We aimed to determine the disease-causing mutations in Chinese patients with isolated CTEV. Genomic DNA was extracted from peripheral blood samples of a three-generation pedigree and 53 sporadic patients with CTEV. Whole-exome sequencing and Sanger sequencing were used to identify and validate disease-causing mutations, respectively. A putative pathogenic mutation c.4717G>T (p.D1573Y) in the filamin B (FLNB) gene, which co-segregated with CETV, was identified in the pedigree. Two additional novel missense mutations in the same gene [c.1897A>G (p.M633V) and c.2195A>G (p.Y732C)] were identified from the 53 sporadic patients. Plasmids expressing wild-type or mutant constructs were transfected into HEK293T cells to determine whether these amino acid substitutions affect protein activity. All three (M633V, Y732C, and D1573Y) affected FLNB protein expression and led to cytoplasmic focal accumulation. Our results provide evidence for the involvement of FLNB in the pathogenesis of isolated CTEV and have expanded the clinical spectrum of FLNB mutations.

Exome sequencing reveals a novel nonsense mutation of GLI3 in a Chinese family with 'non-syndromic' pre-axial polydactyly.

Polydactyly is a clinically and genetically heterogeneous disorder. In the current report, we present a five-generation Chinese family with non-syndromic pre-axial polydactyly with thumb polydactyly (pre-axial polydactyly type I (PPD-I)) as a major clinical feature. Using whole-exome sequencing (WES), a novel nonsense mutation c.714T>A (p.Y238*) of the glioma-associated oncogene family zinc-finger 3 gene (GLI3) was identified as the pathogenic mutation for this family. Our study has, for the first time, suggested the possible contribution of GLI3 in the patheogenesis of PPD-I, and demonstrated that WES provided an applicable diagnostic tool for identifying mutations in disorders with highly genetical heterogeneity such as polydactyly.

A novel missense mutation of TNNI2 in a Chinese family cause distal arthrogryposis type 1.

The distal arthrogryposis (DA) syndromes are a group of disorders characterized by congenital contractures of limbs. According to phenotypical characteristics, DA syndromes have been clinically classified into 10 types. Currently, at least nine disease causing genes have been identified for different types of DA. Here, we report a 3-generation Chinese pedigree with three DA affected members. We performed whole exome sequencing on two affected and one unaffected individuals of this family and successfully identified a novel missense mutation in TNNI2 as the pathogenic mutation. The TNNI2 gene encodes a subunit of the troponin complex, a contractile machinery of the muscle. The mutation p.F178C that could change the H-bond formation of a neighboring residue occurs at a highly conserved position, suggesting that this variation probably affects the TNNI2 protein function. Our study also demonstrates the power of whole exome sequencing in causal mutation identification for phenotypically variable and genetically heterogeneous disorders.

A modified multiplex ligation-dependent probe amplification method for the detection of 22q11.2 copy number variations in patients with congenital heart disease.

BACKGROUND: Copy number variations (CNVs) of chromosomal region 22q11.2 are associated with a subset of patients with congenital heart disease (CHD). Accurate and efficient detection of CNV is important for genetic analysis of CHD. The aim of the study was to introduce a novel approach named CNVplex®, a high-throughput analysis technique designed for efficient detection of chromosomal CNVs, and to explore the prevalence of sub-chromosomal imbalances in 22q11.2 loci in patients with CHD from a single institute. RESULTS: We developed a novel technique, CNVplex®, for high-throughput detection of sub-chromosomal copy number aberrations. Modified from the multiplex ligation-dependent probe amplification (MLPA) method, it introduced a lengthening ligation system and four universal primer sets, which simplified the synthesis of probes and significantly improved the flexibility of the experiment. We used 110 samples, which were extensively characterized with chromosomal microarray analysis and MLPA, to validate the performance of the newly developed method. Furthermore, CNVplex® was used to screen for sub-chromosomal imbalances in 22q11.2 loci in 818 CHD patients consecutively enrolled from Shanghai Children's Medical Center. In the methodology development phase, CNVplex® detected all copy number aberrations that were previously identified with both chromosomal microarray analysis and MLPA, demonstrating 100% sensitivity and specificity. In the validation phase, 22q11.2 deletion and 22q11.2 duplication were detected in 39 and 1 of 818 patients with CHD by CNVplex®, respectively. Our data demonstrated that the frequency of 22q11.2 deletion varied among sub-groups of CHD patients. Notably, 22q11.2 deletion was more commonly observed in cases with conotruncal defect (CTD) than in cases with non-CTD (P<0.001). With higher resolution and more probes against selected chromosomal loci, CNVplex® also identified several individuals with small CNVs and alterations in other chromosomes. CONCLUSIONS: CNVplex® is sensitive and specific in its detection of CNVs, and it is an alternative to MLPA for batch screening of pathogenetic CNVs in known genomic loci.

Investigation of Somatic NKX2-5 Mutations in Chinese Children with Congenital Heart Disease.

The purposes of this study are to investigate somatic NKX2-5 mutations in Chinese children with congenital heart disease (CHD) and assess the reliability of somatic mutation detection in formalin-fixed, paraffin-embedded (FFPE) tissues. The study cohort included frozen and FFPE cardiac tissues as well as blood samples from 85 Chinese children with CHD who had the cardiac operations. The right atrial appendage far from the diseased heart was used as normal control. Genomic DNA was isolated from cardiac tissues and blood samples using TIANamp Blood DNA kit. Two exons and exon-intron boundaries of NKX2-5 were amplified by polymerase chain reaction (PCR) and sequenced by dideoxynucleotide chain termination approach. The acquired sequences were aligned with GenBank sequences to identify the sequence variations. No somatic mutation in the NKX2-5 gene was observed in both frozen and FFPE cardiac tissues in 85 Chinese children with CHD. Nonetheless, a common single nucleotide polymorphism (SNP), c.63 A > G (E21E), was identified in all the three kinds of DNA samples with the same allele frequency 82.3%. Moreover, another common SNP c.606 G > C (L202L) was found in 2.3% of our patients. There were no significant differences in the allele frequencies of two SNPs between the cardiac diseased tissues and right atrial appendage (P > 0.05). PCR artefact as mutations was not found in the FFPE tissues stored for one year. Our findings demonstrate that somatic NKX2-5 mutations do not represent an important aetiologic pathway in Chinese children with congenital heart disease.

Chromosome microarray testing for patients with congenital heart defects reveals novel disease causing loci and high diagnostic yield.

BACKGROUND: Congenital heart defects (CHD), as the most common congenital anomaly, have been reported to be frequently associated with pathogenic copy number variants (CNVs). Currently, patients with CHD are routinely offered chromosomal microarray (CMA) testing, but the diagnostic yield of CMA on CHD patients has not been extensively evaluated based on a large patient cohort. In this study, we retrospectively assessed the detected CNVs in a total of 514 CHD cases (a 422-case clinical cohort from Boston Children's Hospital (BCH) and a 92-case research cohort from Shanghai Children's Medical Center (SCMC)) and conducted a genotype-phenotype analysis. Furthermore, genes encompassed in pathogenic/likely pathogenic CNVs were prioritized by integrating several tools and public data sources for novel CHD candidate gene identification. RESULTS: Based on the BCH cohort, the overall diagnostic yield of CMA testing for CHD patients was 12.8(pathogenic CNVs)-18.5% (pathogenic and likely pathogenic CNVs). The diagnostic yield of CMA for syndromic CHD was 14.1-20.6% (excluding aneuploidy cases), whereas the diagnostic yield for isolated CHD was 4.3-9.3%. Four recurrent genomic loci (4q terminal region, 15q11.2, 16p12.2 and Yp11.2) were more significantly enriched in cases than in controls. These regions are considered as novel CHD loci. We further identified 20 genes as the most likely novel CHD candidate genes through gene prioritization analysis. CONCLUSION: The high clinical diagnostic yield of CMA in this study provides supportive evidence for CMA as the first-line genetic diagnostic tool for CHD patients. The CNVs detected in our study suggest a number of CHD candidate genes that warrant further investigation.