First Report of Narcissus late season yellows virus, Narcissus latent virus, and Narcissus mosaic virus in daffodil (Narcissus pseudonarcissus) in the United States.

Daffodils (family Amaryllidaceae, genus Narcissus) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants (Narcissus pseudonarcissus) were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.

Draft Genome Resources for the Phytopathogenic Fungi Monilinia fructicola, M. fructigena, M. polystroma, and M. laxa, the Causal Agents of Brown Rot.

Fungi in the genus Monilinia cause brown rot disease of stone and pome fruits. Here, we report the draft genome assemblies of four important phytopathogenic species: M. fructicola, M. fructigena, M. polystroma, and M. laxa. The draft genome assemblies were 39 Mb (M. fructigena), 42 Mb (M. laxa), 43 Mb (M. fructicola), and 45 Mb (M. polystroma) with as few as 550 contigs (M. laxa). These are the first draft genome resources publicly available for M. laxa, M. fructigena, and M. polystroma.

Advanced Breast Cancer Guidelines in Latin America: Assessment, Adaptation, and Implementation of Fifth Advanced Breast Cancer Consensus Guidelines.

PURPOSE: As the fifth international consensus on advanced breast cancer (ABC5) established guidelines for the management of this disease, the aim of this article was to present the applicability of the consensus recommendations and to generate knowledge to improve access. METHODS: Sixty-one recommendation statements were selected and discussed by 15 breast cancer experts from Latin America (LA). After the discussion, the level of consensus was determined through a vote. In addition to this, the level of access to each of the recommendations presented, according to the country and health system, was exposed. RESULTS: Latin American experts had a high level of agreement with the ABC5 consensus recommendations (range, 83%-100%). Twelve of 61 statements are not available for all patients in LA. Among the limitations to access, the following ones are described: limited access to certain technologies (stereotactic body radiotherapy, positron emission tomography-computed tomography), the high costs of drugs that limits access to treatment with CDK4/6 inhibitors, pertuzumab, or poly(ADP-ribose) polymerase inhibitors, and the lack of molecular tests for access to therapeutic targets, as well as the difficult geography and cultural diversity of our continent. CONCLUSION: Despite the great relevance of the recommendations of the ABC5 consensus guidelines, we highlight that we still need to improve access for all patients, regardless of the country or health system they are in, for which we call to action to policy makers and patient groups to improve clinical outcomes of patients with advanced breast cancer in our region.

Complete Genome Sequence of a Tomato Brown Rugose Fruit Virus Isolated in the United States.

The complete genome sequence of a U.S. isolate of a Tomato brown rugose fruit virus (ToBRFV) (CA18-01) was obtained through Illumina and MinION sequencing. The U.S. ToBRFV isolate shared a high nucleic acid sequence identity (>99%) with known ToBRFV isolates. Phylogenetic analysis revealed a tight cluster for ToBRFV isolates throughout the world, suggesting a short evolutionary history.

Mobile Intensive Care Unit versus Hospital walk-in patients, in the treatment of first episode ST- elevation myocardial infarction.

OBJECTIVE: To determine the impact of the attention given by emergency medical services teams working in mobile intensive care units (MICU) versus patients arriving at the hospital under their own means with ST-elevation myocardial infarction (STEMI) event in terms of time to reperfusion (TR), mortality at 30 days and six months. METHODS: We retrospectively studied 634 consecutive patients with STEMI who underwent primary a percutaneous coronary intervention from January 1st 2015 to December 31st 2018 in a single centre. Depending on the first medical contact patients were classified into two groups, MICU versus walk-in patients. We extracted data on patients' characteristics, symptoms, treatments, times to reperfusion and mortality. RESULTS: In our study 634 patients were included, of whom 59.0% were initially attended by the MICU. Differences were seen between the two groups in time delays to the first medical contact (120.0 vs 63.0 min; p < 0.001) and TR (208.0 Vs 150.0 min; p < 0.001). Patients attended by the MICUs presented a shorter ICU and hospital stay. The lowest 30-day mortality rate was observed in MICU group: 9.0% in contrast with 4.5%, p = 0.03; remaining after 6 months. The multivariable analysis showed that the initial attention given by MICU to STEMI patients was a protective agent against mortality [OR: 0.32 (0.11-0.90); p = 0.03]. CONCLUSION: Initial attention of the patients with STEMI by doctor-on-board-MICU and available 24 h a day 7 days a week as part of a regional network (CORECAM), was associated with a decrease in the ischemia time, hospital stay and mortality of these patients in our environment.

Anticoagulation Therapy by Age and Embolic Risk for Nonvalvular Atrial Fibrillation in Mexico, an Upper-Middle-Income Country: The CARMEN-AF Registry.

Background: Documenting the patterns of oral anticoagulation therapy (OAT) is essential to prevent thromboembolic complications of nonvalvular atrial fibrillation (NVAF). Objective: To report the patterns of OAT according to age and thromboembolic risk in patients included in CARMEN-AF, a nationwide registry of NVAF in Mexico, an upper middle-income country. Material and methods: There were 1,423 consecutive patients ≥18 years old and with at least one thromboembolic risk factor enrolled in the CARMEN-AF Registry at their regular clinical visit during a three-year period. They were analyzed according to 1) age, 2) AF type, and 3) CHA2DS2-VASc score. Results: Overall, 16.4% of patients did not receive antithrombotic treatment, 19.4% received antiplatelet drugs (APD), 29.2% vitamin K antagonists (VKA), and 34.6% direct oral anticoagulants (DOAC). With increasing age, the proportion of subjects treated with VKA decreased significantly from 36.2% in subjects <65 years to 22.5% in those ≥75 years old (P <0.0001). Concomitantly, an increase in both APD and no antithrombotic treatment was observed with increasing age. DOAC were prescribed equally among all age groups (34.2% in <65, 36.0% in 65-74, and 33.9% in ≥75). According to the type of AF, VKA use was more common in patients with permanent AF (32.7%). A lower use of DOAC was observed in high thromboembolic risk subjects (33.6% in CHA2DS2-VASc ≥2) compared with the moderate risk group (41% in CHA2DS2-VASc = 1). Conclusions: VKA use for NVAF in Mexico decreased in relation to increasing age. The proportion of DOAC therapy was the same in all age groups. Nevertheless, elderly patients with high thromboembolic risk received a suboptimal thromboprophylaxis. These data could help to improve gaps in the implementation of global guidelines. Clinical trial registration: http://www.clinicaltrials.gov. Unique identifier: NCT02334852. Highlights: CARMEN-AF is a nationwide multi-centric registry seeking to bridge the data gap on anticoagulation therapy for NVAF in Mexico.Elderly patients are more prone to receive suboptimal OAT for NVAF.DOAC were less frequently used in high thromboembolic risk patients (CHA2DS2-VASc ≥2).

Clinicopathological predictors of long-term benefit in breast cancer treated with neoadjuvant chemotherapy.

AIM: To investigate the survival impact of clinicopathological factors, including pathological complete response (pCR) and tumor-infiltrating lymphocytes (sTIL) levels according to subtypes, in breast cancer (BC) patients who received neo-adjuvant chemotherapy (NAC). METHODS: We evaluated 435 BC patients who presented and received NAC at the Instituto Nacional de Enfermedades Neoplasicas from 2003 to 2014. sTIL was analyzed as the proportion of tumor stroma occupied by lymphocytes, and was prospectively evaluated on hematoxylin and eosin-stained sections of the preNAC core biopsy. pCR was considered in the absence of infiltrating cancer cells in primary tumor and axillary lymph nodes. Analysis of statistical association between clinical pathological features, sTIL, pCR and survival were carried out using SPSSvs19. RESULTS: Median age was 49 years (range 24-84 years) and the most frequent clinical stage was IIIB (58.3%). Luminal A, Luminal B, HER2-enriched and (triple-negative) TN phenotype was found in 24.6%, 37.9%, 17.7% and 19.8%, respectively. pCR was observed in 11% and median percentage of sTIL was 40% (2%-95%) in the whole population. pCR was associated to Ct1-2 (P = 0.045) and to high sTIL (P = 0.029) in the whole population. There was a slight trend towards significance for sTIL (P = 0.054) in Luminal A. sTIL was associated with grade III (P < 0.001), no-Luminal A subtype (P < 0.001), RE-negative (P < 0.001), PgR-negative (P < 0.001), HER2-positive (P = 0.002) and pCR (P = 0.029) in the whole population. Longer disease-free survival was associated with grade I-II (P = 0.006), cN0 (P < 0.001), clinical stage II (P = 0.004), ER-positive (P < 0.001), PgR-positive (P < 0.001), luminal A (P < 0.001) and pCR (P = 0.002). Longer disease-free survival was associated with grade I-II in Luminal A (P < 0.001), N0-1 in Luminal A (P = 0.045) and TNBC (P = 0.01), clinical stage II in Luminal A (P = 0.003) and TNBC (P = 0.038), and pCR in TNBC (P < 0.001). Longer overall survival was associated with grade I-II (P < 0.001), ER-positive (P < 0.001), PgR-positive (P < 0.001), Luminal A (P < 0.001), cN0 (P = 0.002) and pCR (P = 0.002) in the whole population. Overall survival was associated with clinical stage II (P = 0.017) in Luminal A, older age (P = 0.042) in Luminal B, and pCR in TNBC (P = 0.005). CONCLUSION: Predictive and prognostic values of clinicopathological features, like pCR and sTIL, differ depending on the evaluated molecular subtype.

VirusDetect: An automated pipeline for efficient virus discovery using deep sequencing of small RNAs.

Accurate detection of viruses in plants and animals is critical for agriculture production and human health. Deep sequencing and assembly of virus-derived small interfering RNAs has proven to be a highly efficient approach for virus discovery. Here we present VirusDetect, a bioinformatics pipeline that can efficiently analyze large-scale small RNA (sRNA) datasets for both known and novel virus identification. VirusDetect performs both reference-guided assemblies through aligning sRNA sequences to a curated virus reference database and de novo assemblies of sRNA sequences with automated parameter optimization and the option of host sRNA subtraction. The assembled contigs are compared to a curated and classified reference virus database for known and novel virus identification, and evaluated for their sRNA size profiles to identify novel viruses. Extensive evaluations using plant and insect sRNA datasets suggest that VirusDetect is highly sensitive and efficient in identifying known and novel viruses. VirusDetect is freely available at http://bioinfo.bti.cornell.edu/tool/VirusDetect/.

Synergistic interactions of begomoviruses with Sweet potato chlorotic stunt virus (genus Crinivirus) in sweet potato (Ipomoea batatas†L.).

Three hundred and ninety-four sweet potato accessions from Latin America and East Africa were screened by polymerase chain reaction (PCR) for the presence of begomoviruses, and 46 were found to be positive. All were symptomless in sweet potato and generated leaf curling and/or chlorosis in Ipomoea setosa. The five most divergent isolates, based on complete genome sequences, were used to study interactions with Sweet potato chlorotic stunt virus (SPCSV), known to cause synergistic diseases with other viruses. Co-infections led to increased titres of begomoviruses and decreased titres of SPCSV in all cases, although the extent of the changes varied notably between begomovirus isolates. Symptoms of leaf curling only developed temporarily in combination with isolate StV1 and coincided with the presence of the highest begomovirus concentrations in the plant. Small interfering RNA (siRNA) sequence analysis revealed that co-infection of SPCSV with isolate StV1 led to relatively increased siRNA targeting of the central part of the SPCSV genome and a reduction in targeting of the genomic ends, but no changes to the targeting of StV1 relative to single infection of either virus. These changes were not observed in the interaction between SPCSV and the RNA virus Sweet potato feathery mottle virus (genus Potyvirus), implying specific effects of begomoviruses on RNA silencing of SPCSV in dually infected plants. Infection in RNase3-expressing transgenic plants showed that this protein was sufficient to mediate this synergistic interaction with DNA viruses, similar to RNA viruses, but exposed distinct effects on RNA silencing when RNase3 was expressed from its native virus, or constitutively from a transgene, despite a similar pathogenic outcome.