Thyroid hormone-regulated brain mitochondrial genes revealed by differential cDNA cloning.

Thyroid hormone (T3) plays a critical role in the development of the central nervous system and its deficiency during the early neonatal period results in severe brain damage. However the mechanisms involved and the genes specifically regulated by T3 during brain development are largely unknown. By using a subtractive hybridization technique we have isolated a number of cDNAs that represented mitochondrial genes (12S and 16S rRNAs and cytochrome c oxidase subunit III). The steady state level of all three RNAs was reduced in hypothyroid animals during the postnatal period and T3 administration restored control levels. During fetal life the level of 16S rRNA was decreased in the brain of hypothyroid animals, suggesting a prenatal effect of thyroid hormone on brain development. Since T3 does not affect the amount of mitochondrial DNA, the results suggest that the effect of T3 is at transcriptional and/or postranscriptional level. In addition, the transcript levels for two nuclear-encoded mitochondrial cytochrome c oxidase subunits: subunits IV and VIc were also decreased in the brains of hypothyroid animals. Hypothyroidism-induced changes in mitochondrial RNAs were followed by a concomitant 40% decrease in cytochrome c oxidase activity. This study shows that T3 is an important regulator of mitochondrial function in the neonatal brain and, more importantly, provides a molecular basis for the specific action of this hormone in the developing brain.

Spotlight on the relevance of mtDNA in cancer.

The potential role of the mitochondrial genome has recently attracted interest because of its high mutation frequency in tumors. Different aspects of mtDNA make it relevant for cancer's biology, such as it encodes a limited but essential number of genes for OXPHOS biogenesis, it is particularly susceptible to mutations, and its copy number can vary. Moreover, most ROS in mitochondria are produced by the electron transport chain. These characteristics place the mtDNA in the center of multiple signaling pathways, known as mitochondrial retrograde signaling, which modifies numerous key processes in cancer. Cybrid studies support that mtDNA mutations are relevant and exert their effect through a modification of OXPHOS function and ROS production. However, there is still much controversy regarding the clinical relevance of mtDNA mutations. New studies should focus more on OXPHOS dysfunction associated with a specific mutational signature rather than the presence of mutations in the mtDNA.

Mitochondrial gene expression and respiratory enzyme activities in cardiac diseases.

Respiratory enzyme activities and steady-state level of two mitochondrial-encoded transcripts were quantified in heart muscle biopsies from patients suffering various types of cardiomyopathies unrelated to mitochondrial primary disorders. We have found that although the mitochondrial DNA copy number and the concentration of COI and ND4 transcripts remain fairly constant, there is an important increase (up to 6-fold) in respiratory enzyme activities affecting to several oxidative phosphorylation complexes. Idiopathic dilated cardiomyopathy shows the greatest increase, followed by ischemic heart and ventricular hypertrophy due to aortic stenosis. The results suggest an energetic compensatory mechanism in the heart muscle, in the absence of mitochondrial proliferation or activation of mitochondrial gene expression.

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Drosophila melanogaster mitochondrial DNA: gene organization and evolutionary considerations.

The sequence of a 8351-nucleotide mitochondrial DNA (mtDNA) fragment has been obtained extending the knowledge of the Drosophila melanogaster mitochondrial genome to 90% of its coding region. The sequence encodes seven polypeptides, 12 tRNAs and the 3' end of the 16S rRNA and CO III genes. The gene organization is strictly conserved with respect to the Drosophila yakuba mitochondrial genome, and different from that found in mammals and Xenopus. The high A + T content of D. melanogaster mitochondrial DNA is reflected in a reiterative codon usage, with more than 90% of the codons ending in T or A, G + C rich codons being practically absent. The average level of homology between the D. melanogaster and D. yakuba sequences is very high (roughly 94%), although insertion and deletions have been detected in protein, tRNA and large ribosomal genes. The analysis of nucleotide changes reveals a similar frequency for transitions and transversions, and reflects a strong bias against G + C on both strands. The predominant type of transition is strand specific.

Mutation analysis in 16 patients with mtDNA depletion.

Sixteen unrelated Southern European patients with the mitochondrial depletion syndrome (MDS) were analyzed for mutations in the TK2 and DGUOK genes. Three novel mutations were identified in TK2 (R183G, R254X, and 142insG). When we analyzed additional genes involved in the dNTPs pool, such as SLC25A19 (DNC) and NT5M (d-NT2), we did not detect mutations. The current study suggest that scanning the TK2, DGUOK, SLC25A19, and NT5M genes is likely to help about 10% of MDS families in terms of genetic counseling. Also, our findings indicate that genotype-phenotype correlations are not straightforward in MDS.

Animal mitochondrial biogenesis and function: a regulatory cross-talk between two genomes.

Mitochondria play a pivotal role in cell physiology, producing the cellular energy and other essential metabolites as well as controlling apoptosis by integrating numerous death signals. The biogenesis of the oxidative phosphorylation system (OXPHOS) depends on the coordinated expression of two genomes, nuclear and mitochondrial. As a consequence, the control of mitochondrial biogenesis and function depends on extremely complex processes that require a variety of well orchestrated regulatory mechanisms. It is now clear that in order to provide cells with the correct number of structural and functional differentiated mitochondria, a variety of intracellular and extracellular signals including hormones and environmental stimuli need to be integrated. During the last few years a considerable effort has been devoted to study the factors that regulate mtDNA replication and transcription as well as the expression of nuclear-encoded mitochondrial genes in physiological and pathological conditions. Although still in their infancy, these studies are starting to provide the molecular basis that will allow to understand the mechanisms involved in the nucleo-mitochondrial communication, a cross-talk essential for cell life and death.

A double mutation (A8296G and G8363A) in the mitochondrial DNA tRNA (Lys) gene associated with myoclonus epilepsy with ragged-red fibers.

OBJECTIVE: To define potential pathogenic mitochondrial DNA (mtDNA) point mutations in a patient with myoclonus epilepsy with ragged-red fibers (MERRF) syndrome. BACKGROUND: MERRF syndrome is typically associated with point mutations in the mtDNA tRNALys gene. METHODS: We performed morphologic, biochemical, and genetic analysis of muscle samples from the patient and four relatives. Molecular genetic studies included sequencing, PCR, and restriction enzyme analysis on whole muscle, blood, and single muscle fibers. RESULTS: Muscle biopsy showed cytochrome c oxidase (COX), negative ragged-red fibers (RRF), and a defect of complex I of the mitochondrial respiratory chain. We found an A8296G transition and a G8363A mutation in the mtDNA tRNALYs gene. The A8296G was almost homoplasmic in muscle and blood from the propositus and his oligosymptomatic maternal relatives. The G8363A mutation was heteroplasmic and more abundant in muscle than in blood, and its proportion correlated with clinical severity. Single muscle fiber analysis showed significantly higher levels of G8363A genomes in COX-negative than in normal fibers, and almost homoplasmic levels of mutant A8296G mtDNA in both COX-negative and normal fibers. The two mutations affect highly conserved nucleotides and were not found in controls. CONCLUSIONS: The G8363A mutation is pathogenic; the co-occurrence of the A8296G mutation is of unclear significance and is likely to be a rare polymorphism.

Mitochondrial dysfunction associated with a mutation in the Notch3 gene in a CADASIL family.

BACKGROUND: Cerebral autosomal arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is characterized by recurrent subcortical ischemic strokes and dementia caused by mutations in the Notch3 gene. In Drosophila melanogaster, Notch signaling has a pleiotropic effect, affecting most tissues of the organism during development. OBJECTIVE: To characterize a potential mitochondrial dysfunction associated with mutations in the Notch3 gene. METHODS: Biochemical, histochemical, molecular, and genetic analyses were performed on muscle biopsy specimens and fibroblasts obtained from patients of a Spanish family with CADASIL. Additional biochemical and molecular analyses of the N(55e11) mutant of D. melanogaster were performed. RESULTS: In muscle biopsy specimens, a significant decrease was found in the activity of complex I (NADH [reduced form of nicotinamide adenine dinucleotide] dehydrogenase), and in one patient, histochemical analysis showed the presence of ragged-red fibers with abnormal cytochrome c oxidase staining. Reduced fibroblast activity of complex V (ATP synthase) was found. Supporting data on patients with CADASIL, it was found that the mutation N(55e11) in Drosophila decreases the activity of mitochondrial respiratory complexes I and V. CONCLUSIONS: Mitochondrial respiratory chain activity responds, directly or indirectly, to the Notch signaling pathway. Mitochondrial dysfunction in patients with CADASIL may be an epiphenomenon, but results of this study suggest that the pathophysiology of the disease could include a defect in oxidative phosphorylation.

A new mtDNA mutation in the tRNA(Leu(UUR)) gene associated with ocular myopathy.

We studied a patient with ptosis, ophthalmoparesis, and exercise intolerance who showed in her muscle biopsy ragged-red fibers and combined defects of the complexes I and IV of the mitochondrial respiratory chain. Molecular analysis revealed a T3273C transition in the mitochondrial DNA tRNA(Leu(UUR)) gene. The mutation was heteroplasmic and very abundant in muscle from the proposita, less abundant in her other tissues studied, and still less abundant in blood from her maternal relatives. Single muscle fiber analysis showed significantly higher levels of mutant genomes in ragged-red fibers than in normal fibers. The T3273C mutation affects a strictly conserved base pair in the anticodon stem and was not found in controls, thus satisfying the accepted criteria for pathogenicity.

Identification of a proximal promoter region critical for the expression of the beta-F1-ATPase gene during Drosophila melanogaster development.

We have studied the spatio-temporal pattern of expression of the gene encoding the H(+) adenosine triphosphate (ATP) synthase beta subunit (beta-F1-ATPase) during Drosophila melanogaster development. The beta-F1-ATPase mRNA is stored in the egg; as development proceeds it is distributed in most embryonic cellular territories, including the mesoderm, and in late embryos it is highly abundant in the ventral cord and midgut. Using a combination of transfection assays in Schneider cells and P-element transformation in flies, we have identified a proximal 5' upstream region of 258 bp essential for the transcriptional activity of the gene during D. melanogaster embryogenesis that is virtually inactive in adult tissues. Electrophoretic mobility shift assays using specific DNA fragments from the 258-bp region detect in embryonic nuclear extracts a complex set of DNA binding proteins that are largely absent in adults. The transcription factor CF2-II has been identified as a potential candidate in the regulation of the beta-F1-ATPase gene.

Microgravity effects on Drosophila melanogaster behavior and aging. Implications of the IML-2 experiment.

Earlier Space experiments had indicated that young male Drosophila flies exposed to microgravity showed an acceleration in aging. In a 14.5-day Space Shuttle Flight we sent 300 young male flies with the purpose of confirming these findings and to establish whether changes in the behavior of the flies were responsible for the effect in accordance with the proposal that alterations in mitochondrial metabolism may be involved in the aging response. By repeatedly video-recording, we have found a very marked increase in the locomotor activity of the fruitflies in Space. The males showed an accelerated aging response upon recovery, both in terms of physiological vitality assays (mating and negative geotaxis) and of life-span curves. The involvement of mitochondrial metabolism is also suggested by the finding of a greater decrease in mitochondrial 16S ribosomal RNA in the microgravity exposed flies than in ground controls. On the other hand, a parallel 1 x g centrifuge control did not show such differences in the life-span curves when compared to flies exposed to a similar centrifugation on the ground. Drosophila females also increased their locomotor activity but did not show differential changes in the life-span curves. These results are discussed in terms of the current mechanisms of aging in multicellular eukaryotic organisms.

Preservation of viable biological samples for experiments in space laboratories.

Standard viable preservation methods for biological samples using low temperatures have been investigated concerning their storage capabilities under higher temperature levels than usual. For a representative set of organism classes (plants, mammalian cells, arthropods and aquatic invertebrates), the minimum appropriate storage conditions have been identified by screening storage temperatures at -196 degrees, -80 degrees, -20 degrees, +4 degrees, +20 degrees/25 degrees C for periods from 2 days to 4 weeks. For storage below 0 degree C, as a typical cryopreservative, dimethylsulfoxide (DMSO) was used. For some samples, the addition of trehalose (as cryopreservative) and the use of a nitrogen atmosphere were investigated. After storage, the material was tested for vitality. The findings demonstrated that acceptable preservation can be achieved under higher storage temperatures than are typically applied. Small, dense cultured plant cells survive for 21 d when moderately cooled (+4 degrees to -20 degrees C); addition of trehalose enhances viability at -20 degrees C. For mammalian cells, the results show that human lymphocytes can be preserved for 3 d at 25 degrees C, 7 d at 4 degrees C and 28 d at -80 degrees C. Friend leukaemia virus transformed cells can be stored for 3 d at 25 degrees C, 14 d at 4 degrees C and 28 d at -80 degrees C. Hybridoma cells can be kept 7 d at 4 degrees C and 28 d at -20 degrees C or -80 degrees C. Model arthropod systems are well preserved for 2 weeks if maintained at lower temperatures that vary depending on the species and/or stage of development; e.g., 12 degrees C for Drosophila imagoes and 4-6 degrees C for Artemia nauplii. For aquatic invertebrates such as sea urchins, embryonic and larval stages can be preserved for several weeks at +6 degrees C, whereas sperm and eggs can best be stored at + 4 degrees C for up to 5 d at maximum. These results enhance the range of feasible space experiments with biological systems. Moreover, for typical terrestrial preservation methods, considerable modification potential is identified.

Artemia mitochondrial genome: molecular biology and evolutive considerations.

During the last two decades an increasing amount of information has been accumulated regarding the gene structure and organization of the mitochondrial genome from various organisms. Many studies carried out mainly in mammals, have contributed to the knowledge of the basic elements involved in the replication and transcription of mitochondrial DNA. However, very little is known about these processes in invertebrates. In this review we discuss our current knowledge of the animal mitochondrial genetic system and briefly summarize the structure of the Artemia mitochondrial genome, the characteristics of its transcriptional machinery and how its expression is controlled during early development, in relation with what is known in other organisms. Artemia is the only crustacean where the mtDNA has been studied at this level of detail up to date.

Microgravity effects on Drosophila melanogaster development and aging: comparative analysis of the results of the Fly experiment in the Biokosmos 9 biosatellite flight.

The results are presented of the exposure of Drosophila melanogaster to microgravity conditions during a 15-day biosatellite flight, Biokosmos 9, in a joint ESA-URSS project. The experimental containers were loaded before launch with a set of Drosophila melanogaster Oregon R larvae so that imagoes were due to emerge half-way through the flight. A large number of normally developed larvae were recovered from the space-flown containers. These larvae were able to develop into normal adults confirming earlier results that Drosophila melanogaster of a wild-type constitution can develop normally in the absence of gravity. However, microgravity exposure clearly enhances the number of growing embryos laid by the flies and possibly slows down the developmental pace of the microgravity-exposed animals. Due to some problems in the experimental set-up, this slowing down needs to be verified in future experiments. No live adult that had been exposed to microgravity was recovered from the experiment, so that no life span studies could be carried out, but adult males emerged from the recovered embyros showed a slight shortening in life span and a lower performance in other experimental tests of aging. This agrees with the results of previous experiments performed by our groups.

Arthropod model systems for studying complex biological processes in the space environment.

Three arthropod systems are discussed in relation to their complementary and potential use in Space Biology. In a next biosatellite flight, Drosophila melanogaster pre-adapted during several months to different g levels will be flown in an automatic device that separates parental from first and second generations. In the same flight, flies will be exposed to microgravity conditions in an automatic unit in which fly motility can be recorded. In the International Microgravity Laboratory-2, several groups of Drosophila embryos will be grown in Space and the motility of a male fly population will be video-recorded. In the Biopan, an ESA exobiology facility that can be flown attached to the exterior of a Russian biosatellite, Artemia dormant gastrulae will be exposed to the space environment in the exterior of the satellite under a normal atmosphere or in the void. Gastrulae will be separated in hit and non-hit populations. The developmental and aging response of these animals will be studied upon recovery. With these experiments we will be able to establish whether exposure to the space environment influences arthropod development and aging, and elaborate on some of the cellular mechanisms involved which should be tested in future experiments.

[Studies of pathogenicity and characterization of molecular phenotype caused by mutations in human mitochondrial DNA]. / Estudios de patogenicidad y caracterización del fenotipo molecular provocado por mutaciones en el ADN mitocondrial humano.

Mitochondrial DNA evolves and accumulates mutations more rapidly than nuclear DNA. These nucleotide variation may produce neutral polymorphisms or affect to functional conserved positions being very deleterious. On the other hand the relation between the type of mutation (genotype) and the observed clinical symptoms (phenotype) is nowadays practically unknown. Therefore it is very important to demonstrate clearly that the new described mutations are pathogenic and understanding the molecular mechanisms responsible for the energetic metabolism dysfunction produced by these mutations at cellular level. In the last years several procedures have been developed, including in situ hybridization, single-fiber PCR and the use of patient myoblast, fibroblast and lymphoblast cell culture lines. Specially relevant is the cybrid technology that allow repopulate a cell line depleted of mtDNA with mitochondria obtained from patient fibroblasts, producing transmitochondrial cell lines. The use of these methodology in the last few years has been very important to understand the pathogenic mechanism of some of the classical mutations associated to mitochondrial pathology.

[Human mitochondrial genetic system]. / Sistema genético mitocondrial humano.

The mitochondria are subcellular organelles devoted to energy production in form of ATP that contain their own genetic system. Mitochondrial DNA codify a small, but extremely important, number of polypeptides of the respiratory chain. The other mitochondrial proteins are encoded in the nucleus. Therefore, mitochondrial biogenesis require the coordinated expression of nuclear and mitochondrial genetic systems. The gene arrangement in mitochondrial DNA is extremely compact with the tRNA genes interspersed with the rRNA and protein-coding genes. This organization has its precise counterpart in the mode of expression and distinctive structural features of the RNAs. Both mitochondrial DNA strands are transcribed as a whole in the form of three polycistronic molecules that are later cut by specific enzymes that recognize the 5' and 3' end of the tRNA sequences, to produced the mature rRNA, mRNA and tRNA. The mitochondrial coded mRNAs are translated into proteins by a mitochondrial specific protein-synthesizing machinery. The genetics of the mitochondrial DNA differs from that of the nuclear DNA in several features. In particular, the mitochondrial genome is inherited from the mother that transmit their mitochondrial DNA to all her offsprings. Another characteristic of this genome is its tendency to mutate more frequently than the nuclear DNA. This provides a powerful tool for studying the evolution of man.

The beta subunit of the Drosophila melanogaster ATP synthase: cDNA cloning, amino acid analysis and identification of the protein in adult flies.

The cDNA encoding the Drosophila melanogaster beta subunit of H+ ATP synthase has been cloned and sequenced. The predicted mature protein is highly homologous to the equivalent beta subunits of other organisms and is preceded by a signal peptide of 31 amino acids, that although not conserved at primary sequence level has the characteristics of leader peptides present in other mitochondrial proteins. We have raised polyclonal antibodies that specifically recognize the beta H+ ATP synthase subunit present in Drosophila melanogaster protein extracts. This is the first time that a gene of the ATP synthase complex has been characterized in the invertebrate phyla.

Genomic organization and developmental pattern of expression of the engrailed gene from the brine shrimp Artemia.

We report the isolation and characterization of an engrailed gene in the crustacean Artemia franciscana. The Artemia gene spans a genomic region of 15 kilobases and the coding sequence is interrupted by two introns. It appears to be the only gene of the engrailed family present in the Artemia genome. The predicted engrailed-like protein is 349 amino acids long and contains several domains including the homeodomain, well conserved when compared to other proteins of the engrailed family. Based on sequence comparisons we have detected, in the Artemia engrailed protein, several features which are in common with the Drosophila and Bombyx engrailed proteins. It also has some features specific for invected proteins. Therefore, this gene appears to have diverged from an ancestral gene common to both the engrailed and invected insect genes. Whole-mount in situ hybridization experiments show that the expression of this gene in postembryonic development of Artemia is restricted to the posterior part of at least the thoracic and maxillary segments. The pattern is generated sequentially from a growth zone organized in columns of cells close to the caudal region of the larvae. Cell proliferation in the growth zone follows an interspersed pattern without evidence of early lineage restrictions. The engrailed expression is detected in the growth zone before any segmentation is visible and continues to be expressed in a posterior location in the segments that are morphologically defined. Initially expressed in isolated cells, it spreads into rows broadening to two-three cells as segments mature. The evidence presented here is compatible with the hypothesis that intercellular signaling mechanisms are in part responsible of the early activation of selector genes.