A naphthalene diimide G-quadruplex ligand inhibits cell growth and down-regulates BCL-2 expression in an imatinib-resistant gastrointestinal cancer cell line.

Gastro-intestinal tumours (GISTs) are driven by aberrant expression of the c-KIT oncoprotein. They can be effectively treated by the kinase inhibitor imatinib, which locks the c-KIT kinase domain into an inactive conformation. However resistance to imatinib, driven by active-site mutations, is a recurrent clinical challenge, which has been only partly met by the subsequent development of second and third-generation c-KIT inhibitors. It is reported here that a tetra-substituted naphthalene diimide derivative, which is a micromolar inhibitor of cell growth in a wild-type patient-derived GIST cell line, has a sub-micromolar activity in two distinct patient-derived imatinib-resistant cell lines. The compound has been previously shown to down-regulate expression of the c-KIT protein in a wild-type GIST cell line. It does not affect c-KIT protein expression in a resistant cell line to the same extent, whereas it profoundly down-regulates the expression of the anti-apoptopic protein BCL-2. It is proposed that the mechanism of action involves targeting quadruplex nucleic acid structures, and in particular those in the BCL-2 gene and its RNA transcript. The BCL-2 protein is up-regulated in the GIST-resistant cell line, and is strongly down-regulated after treatment. The compound strongly stabilises a range of G-quadruplexes including a DNA one from the BCL-2 promoter and an RNA quadruplex from its 5'-UTR region. A reporter assay construct incorporating the 5'-UTR quadruplex sequence demonstrates down-regulation of BCL-2 expression.

Macrocyclic naphthalene diimides as G-quadruplex binders.

The synthesis, biological and molecular modeling evaluation of a series of macrocyclic naphthalene diimides is reported. The present investigation expands on the study of structure-activity relationships of prototype compound 2 by constraining the molecule into a macrocyclic structure with the aim of improving its G-quadruplex binding activity and selectivity. The new derivatives, compounds 4-7 carry spermidine- and spermine-like linkers while in compound 8 the inner basic nitrogen atoms of spermine have been replaced with oxygen atoms. The design strategy has led to potent compounds stabilizing both human telomeric (F21T) and c-KIT2 quadruplex sequences, and high selectivity for quadruplex in comparison to duplex DNA. Antiproliferative effects of the new derivatives 4-8 have been evaluated in a panel of cancer cell lines and all the tested compounds showed activity in the low micromolar or sub-micromolar range of concentrations. In order to rationalize the molecular basis of the DNA G-quadruplex versus duplex recognition preference, docking and molecular dynamics studies have been performed. The computational results support the observation that the main driving force in the recognition is due to electrostatic factors.

Crystal structure of a promoter sequence in the B-raf gene reveals an intertwined dimer quadruplex.

The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported promoter quadruplexes had initially suggested that in common with these a monomeric quadruplex was to be expected. The structure has a distorted G·C·G·C base quartet at one end and four flipped-out adenosine nucleosides at the other. The only loops in the structure are formed by the cytosine and by the three adenosines within the sequence, with all of the guanosines participating in G-quartet formation. Solution UV and circular dichroism data are in accord with a stable quadruple arrangement being formed. 1D NMR data, together with gel electrophoresis measurements, are consistent with a dimer being the dominant species in potassium solution. A single-chain intramolecular quadruplex has been straightforwardly constructed using molecular modeling, by means of a six-nucleotide sequence joining 3' and 5' ends of each strand in the dimer. A human genomic database search has revealed a number of sequences containing eight or more consecutive short G-tracts, suggesting that such intramolecular quadruplexes could be formed within the human genome.

Optimization of anti-proliferative activity using a screening approach with a series of bis-heterocyclic G-quadruplex ligands.

Using a phenotypic screening and SAR optimization approach, a phenyl-bis-oxazole derivative has been identified with anti-proliferative activity, optimized with the use of a panel of cancer cell lines. The lead compound was synthesized by means of a short and effective two-step synthesis using Pd-catalyzed direct arylation. The compound stabilizes several quadruplex DNA sequences including a human telomeric DNA and one from the promoter of the HSP90 gene, although the structure-activity relationships of the series are not obviously related to the quadruplex binding.

The influence of positional isomerism on G-quadruplex binding and anti-proliferative activity of tetra-substituted naphthalene diimide compounds.

The synthesis together with biophysical and biological evaluation of a series of tetra-substituted naphthalene diimide (ND) compounds, are presented. These compounds are positional isomers of a recently-described series of quadruplex-binding ND derivatives, in which the two N-methyl-piperidine-alkyl side-chains have now been interchanged with the positions of side-chains bearing a range of end-groups. Molecular dynamics simulations of a pair of positional isomers are in accord with the quadruplex stabilization and biological data for these compounds. Analysis of structure-activity data indicates that for compounds where the side-chains are not of equivalent length then the positional isomers described here tend to have improved cell proliferation potency and in some instances, superior quadruplex stabilization ability.

Thioester derivatives of the natural product psammaplin A as potent histone deacetylase inhibitors.

There has been significant interest in the bioactivity of the natural product psammaplin A, most recently as a potent and isoform selective HDAC inhibitor. Here we report our preliminary studies on thioester HDAC inhibitors derived from the active monomeric (thiol) form of psammaplin A, as a means to improve compound delivery into cells. We have discovered that such compounds exhibit both potent cytotoxicity and enzymatic inhibitory activity against recombinant HDAC1. The latter effect is surprising since previous SAR suggested that modification of the thiol functionality should detrimentally affect HDAC potency. We therefore also report our preliminary studies on the mechanism of action of this observed effect.

Sequences in the HSP90 promoter form G-quadruplex structures with selectivity for disubstituted phenyl bis-oxazole derivatives.

The HSP90 protein is an important target in cancer. We report here that stable quadruplex DNAs can be formed from a promoter sequence in the HSP90 gene, on the basis of melting, circular and NMR studies, and show that these can be selectively targeted by non-macrocyclic quadruplex-stabilizing phenyl bis-oxazole derivatives. These do not bind significantly to duplex DNA and show low stabilization of the human telomeric quadruplex. These results suggest an approach to targeting HSP90 at the DNA level.

Bioactive compounds from Carissa spinarum.

In our continuing efforts to find new antiherpetic agents from plants, an extract prepared from the stems of Carissa spinarum L. was found to possess appreciable activity against herpes simplex viruses (HSV I and II). A chemical study of this plant was then initiated, and this led to the isolation of 12 compounds, including a coumarin, two cardiac glycosides and nine lignans. These isolated compounds were evaluated for several biological activities, including antiherpetic, cytotoxic, antioxidant and antibacterial effects. The cardiac glycoside evomonoside was found to be the only antiherpetic principle, showing moderate activity against herpes simplex virus types I and II in the inactivation method. The lignans (-)-carinol, (-)-carissanol and (-)-nortrachelogenin exhibited cytotoxicity against breast (MCF7) and lung (A549) cancer cells. Moderate anti-DPPH free radical activity was observed for all the lignans. None of the isolates showed antibacterial activity.

Targeting pancreatic cancer with a G-quadruplex ligand.

The integrity of telomeres in most cancer cells is maintained by the action of the telomerase enzyme complex, which catalyzes the synthesis of telomeric DNA repeats in order to replace those lost during replication. Telomerase is especially up-regulated in metastatic cancer and is thus emerging as a major therapeutic target. One approach to telomerase inhibition involves the sequestration of the single-stranded 3' ends of telomeric DNA into higher-order quadruplex structures. We have recently shown that tetra-substituted naphthalene diimide compounds are potent quadruplex-stabilizing molecules with telomerase inhibitory activity in cells. We show here that one such compound, BMSG-SH-3, which has been optimized by computer modeling, has significant in vivo antitumor activity against a model for pancreatic cancer, a cancer that is especially resistant to current therapies. A large reduction in telomerase activity in treated tumors was observed and the naphthalene diimide compound was found to be selectively localized in the treated tumors. We find that the expression of the therapeutically important chaperone protein HSP90, a regulator of telomerase is also reduced in vivo by BMSG-SH-3 treatment. The compound is a potent stabilizer of two G-quadruplex sequences found in the promoter region of the HSP90 gene, as well as a G-quadruplex from human telomeric DNA. It is proposed that the simultaneous targeting of these quadruplexes may be an effective anti-tumor strategy.

Rational design of acridine-based ligands with selectivity for human telomeric quadruplexes.

Structure-based modeling methods have been used to design a series of disubstituted triazole-linked acridine compounds with selectivity for human telomeric quadruplex DNAs. A focused library of these compounds was prepared using click chemistry and the selectivity concept was validated against two promoter quadruplexes from the c-kit gene with known molecular structures, as well as with duplex DNA using a FRET-based melting method. Lead compounds were found to have reduced effects on the thermal stability of the c-kit quadruplexes and duplex DNA structures. These effects were further explored with a series of competition experiments, which confirmed that binding to duplex DNA is very low even at high duplex:telomeric quadruplex ratios. Selectivity to the c-kit quadruplexes is more complex, with some evidence of their stabilization at increasing excess over human telomeric quadruplex DNA. Selectivity is a result of the dimensions of the triazole-acridine compounds, and in particular the separation of the two alkyl-amino terminal groups. Both lead compounds also have selective inhibitory effects on the proliferation of cancer cell lines compared to a normal cell line, and one has been shown to inhibit the activity of the telomerase enzyme, which is selectively expressed in tumor cells, where it plays a role in maintaining telomere integrity and cellular immortalization.

Tetrasubstituted naphthalene diimide ligands with selectivity for telomeric G-quadruplexes and cancer cells.

A series of tetrasubstituted naphthalene diimide compounds with N-methylpiperazine end groups has been synthesized and evaluated as G-quadruplex ligands. They have high affinity and selectivity for telomeric G-quadruplex DNA over duplex DNA. CD studies show that they induce formation of a parallel G-quadruplex topology. They inhibit the binding of hPOT1 and topoisomerase IIIα to telomeric DNA and inhibit telomerase activity in MCF7 cells. The compounds have potent activity in a panel of cancer cell lines, with typical IC(50) values of ∼0.1 µM, and up to 100-fold lower toxicity in a normal human fibroblast cell line.

Biaryl polyamides as a new class of DNA quadruplex-binding ligands.

We report a novel class of biaryl polyamides highly selective for G-quadruplex DNA, and with significant cytotoxicity in several cancer cell lines; they form planar U-shaped structures that match the surface area dimensions of a terminal G-quartet in quadruplex structures rather than the grooves of duplex DNA.

Bioactive pyridine-N-oxide disulfides from Allium stipitatum.

From Allium stipitatum, three pyridine-N-oxide alkaloids (1-3) possessing disulfide functional groups were isolated. The structures of these natural products were elucidated by spectroscopic means as 2-(methyldithio)pyridine-N-oxide (1), 2-[(methylthiomethyl)dithio]pyridine-N-oxide (2), and 2,2'-dithio-bis-pyridine-N-oxide (3). The proposed structure of 1 was confirmed by synthetic S-methylthiolation of commercial 2-thiopyridine-N-oxide. Compounds 1 and 2 are new natural products, and 3 is reported for the first time from an Allium species. All compounds were evaluated for activity against fast-growing species of Mycobacterium, methicillin-resistant Staphylococcus aureus, and a multidrug-resistant (MDR) variants of S. aureus. Compounds 1 and 2 exhibited minimum inhibitory concentrations (MICs) of 0.5-8 microg/mL against these strains. A small series of analogues of 1 were synthesized in an attempt to optimize antibacterial activity, although the natural product had the most potent in vitro activity. In a whole-cell assay at 30 microg/mL, 1 was shown to give complete inhibition of the incorporation of (14)C-labeled acetate into soluble fatty acids, indicating that it is potentially an inhibitor of fatty acid biosynthesis. In a human cancer cell line antiproliferative assay, 1 and 2 displayed IC(50) values ranging from 0.3 to 1.8 microM with a selectivity index of 2.3 when compared to a human somatic cell line. Compound 1 was evaluated in a microarray analysis that indicated a similar mode of action to menadione and 8-quinolinol by interfering with the thioredoxin system and up-regulating the production of various heat shock proteins. This compound was also assessed in a mouse model for in vivo toxicity.

TRAP-LIG, a modified telomere repeat amplification protocol assay to quantitate telomerase inhibition by small molecules.

The telomerase enzyme is implicated in a large proportion of human cancers. Its major function is to maintain the length of telomeric DNA by synthesizing telomeric DNA repeats, and its enzymatic activity is assayed by means of the telomere repeat amplification protocol (TRAP) assay. We show here that this assay is unable to reliably determine the ability of small molecules to inhibit the enzyme because they interfere with the PCR step of the assay, resulting in a major overestimation of their activity. We report a modified TRAP assay that incorporates the addition of an intermediate step, enabling ligand to be removed from the final PCR process using a commercially available oligonucleotide purification kit, so that more reliable estimates of telomerase inhibition can be made.

Tri- and tetra-substituted naphthalene diimides as potent G-quadruplex ligands.

A series of tri- and tetra-substituted naphthalene diimides have been designed and synthesized. Several compounds show exceptional affinity for telomeric G-quadruplex DNA in classical and competition FRET assays and SPR studies. They inhibit telomerase in the TRAP assay, and show potent senescence-based short-term anti-proliferative effects on MCF7 and A549 cancer cell lines, and localize in the nucleus and particularly the nucleolus of MCF7 cells.

Cr (VI) inhibits DNA, RNA and protein syntheses in hepatocytes: involvement of glutathione reductase, reduced glutathione and DT-diaphorase.

In patients with orthopaedic implants, metallic particles have been shown to be disseminated widely throughout the body, particularly in the liver, spleen and lymph nodes. Levels of metal particles and ions in distant organs were highest in patients with loose, corroded prostheses, and when stainless steel and cobalt chrome alloy corrode, chromium is released predominantly as Cr (VI), a toxic ion. This manuscript investigates the interaction of Cr (VI) with liver cells in terms of inhibition of macromolecular synthesis, and the contribution of reduced glutathione (GSH), DT-diaphorase and glutathione reductase (GRd) to the toxicity of Cr (VI). Cr (VI) caused concentration dependent inhibition of protein, DNA and RNA synthesis in hepatocytes. GRd and to a lesser extent DT-diaphorase activities were involved in the generation of toxic intermediates. GRd activity was markedly inhibited during the reduction of Cr (VI), and GSH levels decreased. The concentrations of Cr (VI) found to inhibit macromolecular syntheses in this study are clinically relevant: it is therefore important to develop implants with minimum wear potential.

Targeting Multiple Effector Pathways in Pancreatic Ductal Adenocarcinoma with a G-Quadruplex-Binding Small Molecule.

Human pancreatic ductal adenocarcinoma (PDAC) involves the dysregulation of multiple signaling pathways. A novel approach to the treatment of PDAC is described, involving the targeting of cancer genes in PDAC pathways having over-representation of G-quadruplexes, using the trisubstituted naphthalene diimide quadruplex-binding compound 2,7-bis(3-morpholinopropyl)-4-((2-(pyrrolidin-1-yl)ethyl)amino)benzo[ lmn][3,8]phenanthroline-1,3,6,8(2 H,7 H)-tetraone (CM03). This compound has been designed by computer modeling, is a potent inhibitor of cell growth in PDAC cell lines, and has anticancer activity in PDAC models, with a superior profile compared to gemcitabine, a commonly used therapy. Whole-transcriptome RNA-seq methodology has been used to analyze the effects of this quadruplex-binding small molecule on global gene expression. This has revealed the down-regulation of a large number of genes, rich in putative quadruplex elements and involved in essential pathways of PDAC survival, metastasis, and drug resistance. The changes produced by CM03 represent a global response to the complexity of human PDAC and may be applicable to other currently hard-to-treat cancers.

Trisubstituted acridines as G-quadruplex telomere targeting agents. Effects of extensions of the 3,6- and 9-side chains on quadruplex binding, telomerase activity, and cell proliferation.

The synthesis is reported of a group of 3,6,9-trisubstituted acridine compounds as telomeric quadruplex-stabilizing ligands with systematic variations at the 3-, 6-, and 9-positions. A new microwave-assisted methodology has been developed for trisubstituted acridine synthesis. Structure-activity relationships are reported using surface plasmon resonance and a fluorescence melting assay to examine quadruplex binding, together with a telomerase inhibition assay. These reveal relationships between G-quadruplex stabilization and telomerase inhibition and optimal 3,6- and 9-substituent side-chain lengths for maximal activity. Qualitative molecular modeling using molecular dynamics simulations has been undertaken on four quadruplex-DNA complexes. Long-term exposure of MCF7 cancer cells to a subset of the most active compounds, at doses lower than the IC(50) values, showed that one compound produced a marked decrease in population growth, accompanied by senescence, which is consistent with telomere targeting by this agent.

Indolo[3,2-c]quinoline G-quadruplex stabilizers: a structural analysis of binding to the human telomeric G-quadruplex.

A library of 5-methylindolo[3,2-c]quinolones (IQc) with various substitution patterns of alkyldiamine side chains were evaluated for G-quadruplex (G4) binding mode and efficiency. Fluorescence resonance energy transfer melting assays showed that IQcs with a positive charge in the heteroaromatic nucleus and two weakly basic side chains are potent and selective human telomeric (HT) and gene promoter G4 stabilizers. Spectroscopic studies with HT G4 as a model showed that an IQc stabilizing complex involves the binding of two IQc molecules (2,9-bis{[3-(diethylamino)propyl]amino}-5-methyl-11H-indolo[3,2-c]quinolin-5-ium chloride, 3 d) per G4 unit, in two non-independent but equivalent binding sites. Molecular dynamics studies suggest that end-stacking of 3 d induces a conformational rearrangement in the G4 structure, driving the binding of a second 3 d ligand to a G4 groove. Modeling studies also suggest that 3 d, with two three-carbon side chains, has the appropriate geometry to participate in direct or water-mediated hydrogen bonding to the phosphate backbone and/or G4 loops, assisted by the terminal nitrogen atoms of the side chains. Additionally, antiproliferative studies showed that IQc compounds 2 d (2-{[3-(diethylamino)propyl]amino}-5-methyl-11H-indolo[3,2-c]quinolin-5-ium chloride) and 3 d are 7- to 12-fold more selective for human malignant cell lines than for nonmalignant fibroblasts.

KRAS oncogene repression in colon cancer cell lines by G-quadruplex binding indolo[3,2-c]quinolines.

KRAS is one of the most frequently mutated oncogenes in human cancer, yet remaining undruggable. To explore a new therapeutic strategy, a library of 5-methyl-indolo[3,2-c]quinoline derivatives (IQc) with a range of alkyldiamine side chains was designed to target DNA and RNA G-quadruplexes (G4) in the promoter and 5'-UTR mRNA of the KRAS gene. Biophysical experiments showed that di-substituted IQc compounds are potent and selective KRAS G4 stabilizers. They preferentially inhibit the proliferation of KRAS mutant cancer cell lines (0.22 < IC50 < 4.80 µM), down-regulate KRAS promoter activity in a luciferase reporter assay, and reduce both KRAS mRNA and p21(KRAS) steady-state levels in mutant KRAS colon cancer cell lines. Additionally, IQcs induce cancer cell death by apoptosis, explained in part by their capacity to repress KRAS expression. Overall, the results suggest that targeting mutant KRAS at the gene level with G4 binding small molecules is a promising anticancer strategy.