Coordinate developmental regulation of purine catabolic enzyme expression in gastrointestinal and postimplantation reproductive tracts.

Using histochemical detection, we have visualized in situ the complete metabolic pathway for the degradation of purine nucleotides. From the tongue to the ileum, diverse epithelial cell types lining the lumen of the mouse gastrointestinal (GI) tract strongly coexpress each of the five key purine catabolic enzymes. Dramatic increases in the expression of each enzyme occurred during postnatal maturation of the GI tract. Using in situ hybridization, an intense accumulation of adenosine deaminase (ADA) mRNA was detected only within GI epithelial cells undergoing postmitotic differentiation. In a similar manner, at the developing maternal-fetal interface, high level expression of the purine catabolic pathway also occurred in a unique subset of maternal decidual cells previously known to express high levels of alkaline phosphatase and ADA. This induction occurred almost immediately after implantation in the periembryonic maternal decidual cells, shortly thereafter in antimesometrial decidual cells, and later in cells of the placental decidua basalis: all of which contain cell types thought to be undergoing programmed cell death. The expression of the pathway at the site of embryo implantation appears to be critical because its pharmacologic inhibition during pregnancy has been found to be embryolethal or teratogenic. Purine destruction at these nutritional interfaces (placenta and gastrointestinal tract) seem to override any potential economy of purine salvage, and may represent biochemical adaptation to nucleic acid breakdown occurring in the context of dietary digestion or extensive programmed cell death.

Collagen proline hydroxylase in wound healing, granuloma formation, scurvy, and growth.

Compared to homologous tissues from adult animals, rapidly growing embryonic and fetal tissues contain large amounts of collagen proline hydroxylase. Lung and skin from scorbutic guinea pigs contain one-third as much enzyme as normal tissues do. A rapid increase in proline hydroxylase occurs on the 2nd day of formation of granuloma after injection of carrageenan and on the 4th day of wound healing. The increase in enzyme activity is associated with the onset of collagen biosynthesis and deposition.

Location of the second gene required for expression of the leukemia-associated mouse antigens G IX .

Some mouse strains express G(IX) antigen on their thymocytes; others do not. Expression depends on two genes, Gv-1 and Gv-2, in linkage groups IX and I, respectively. Cells producing leukemia virus, however, express G(IX) antigen regardless of their inherited Gv-1 and Gv-2 genotype.

Adenosine deaminase messenger RNAs in lymphoblast cell lines derived from leukemic patients and patients with hereditary adenosine deaminase deficiency.

Hereditary deficiency of adenosine deaminase (ADA) usually causes profound lymphopenia with severe combined immunodeficiency disease. Cells from patients with ADA deficiency contain less than normal, and sometimes undetectable, amounts of ADA catalytic activity and ADA protein. The molecular defects responsible for hereditary ADA deficiency are poorly understood. ADA messenger RNAs and their translation products have been characterized in seven human lymphoblast cell lines derived as follows: GM-130, GM-131, and GM-2184 from normal adults; GM-3043 from a partially ADA deficient, immunocompetent !Kung tribesman; GM-2606 from an ADA deficient, immunodeficient child; CCRF-CEM and HPB-ALL from leukemic children. ADA messenger (m)RNA was present in all lines and was polyadenylated. The ADA synthesized by in vitro translation of mRNA from each line reacted with antisera to normal human ADA and was of normal molecular size. There was no evidence that posttranslational processing of ADA occurred in normal, leukemic, or mutant lymphoblast lines. Relative levels of specific translatable mRNA paralleled levels of ADA protein in extracts of the three normal and two leukemic lines. However, unexpectedly high levels of ADA specific, translatable mRNA were found in the mutant GM-2606 and GM-3043 lines, amounting to three to four times those of the three normal lines. Differences in the amounts of ADA mRNA and rates of ADA synthesis appear to be of primary importance in maintaining the differences in ADA levels among lymphoblast lines with structurally normal ADA. ADA deficiency in at least two mutant cell lines is not caused by deficient levels of translatable mRNA, and unless there is some translational control of this mRNA, the characteristic cellular ADA deficiency is most likely secondary to synthesis and rapid degradation of a defective ADA protein.

Biochemical and immunological properties of human terminal deoxynucleotidyl transferase purified from blasts of acute lymphoblastic and chronic myelogenous leukemia.

Terminal deoxynucleotidyl transferase was purified to homogeneity from the blasts of eight patients with leukemia and compared with purified transferase from normal human and calf thymus. In two cases phenylmethanesulfonylfluoride was added during purification to reduce proteolysis. Comparative kinetic analyses of the purified enzymes indicated no differences in catalytic properties. There was substantial variation in the molecular structure of terminal transferase on denaturing polyacrylamide gels: (a) a protein that migrated as a single polypeptide with M(r) = 62,000 was isolated from two patients with acute lymphoblastic leukemia and from MOLT-4 cells; (b) a protein that migrated as a single polypeptide with M(r) = 42,500 was isolated from two patients with acute lymphoblastic leukemia; (c) a protein that migrated as a single polypeptide with M(r) = 42,500 was isolated from two patients with chronic myelogenous leukemia in blast crisis; (d) a protein that migrated as two non-identical subunits of M(r) = 27,000 and 10,000, respectively, was isolated from two additional patients with chronic myelogenous leukemia in blast crisis. The subunit structure of d is characteristic of the homogeneous enzymes purified from human and calf thymus. Neutralizing and precipitating antibodies to terminal transferase from human lymphoblasts and calf thymus have been produced in rabbits and goats. Antisera directed against either human or calf antigens neutralize enzymatic activity and precipitate all forms of human terminal transferase. The multiple human forms give reactions of antigenic identity by immunodiffusion, but differ antigenically from the calf enzyme. The multiple forms of terminal transferase could represent physiological processing, artifactual degradation, or isozymes coded by several genes.

Adenosine deaminase (ADA) deficiency due to deletion of the ADA gene promoter and first exon by homologous recombination between two Alu elements.

In 15-20% of children with severe combined immunodeficiency (SCID), the underlying defect is adenosine deaminase (ADA) deficiency. The goal of this study was to determine the precise molecular defect in a patient with ADA-deficient SCID whom we previously have shown to have a total absence of ADA mRNA and a structural alteration of the ADA gene. By detailed Southern analysis, we now have determined that the structural alteration is a deletion of approximately 3.3 kb, which included exon 1 and the promoter region of the ADA gene. DNA sequence analysis demonstrates that the deletion created a novel, complete Alu repeat by homologous recombination between two existing Alu repeats that flanked the deletion. The 26-bp recombination joint in the Alu sequence includes the 10-bp "B" sequence homologous to the RNA polymerase III promoter. This is the first example of homologous recombination involving the B sequence in Alu repeats. Similar recombination events have been identified involving Alu repeats in which the recombination joint was located between the A and B sequences of the polymerase III split promoter. The nonrandom location of these events suggests that these segments may be hot spots for recombination.

Overproduction of adenine deoxynucleosides and deoxynucletides in adenosine deaminase deficiency with severe combined immunodeficiency disease.

The deoxynucleotide, dATP, is elevated 50- to 1,000-fold above normal in erythrocytes, lymphocytes, and bone marrow from a child with adenosine deaminase deficiency and severe combined immunodeficiency disease. The child, when 17 mo of age, was also excreting approximately 30 mg of deoxyadenosine per day in urine (normal is less than 0.1 mg/day). Urinary excretion of uric acid was decreased. Elevated dATP levels in lymphocytes and bone marrow, and increased urinary excretion of deoxyadenosine, persisted despite hypertransfusion of the child with irradiated erythrocytes from a donor with normal adenosine deaminase. Overproduction of deoxynucleotides by increased salvage of adenosine appears to be the primary metabolic abnormality in patients with adenosine de aminase deficiency.

Biochemical and functional abnormalities in lymphocytes from an adenosine deaminase-deficient patient during enzyme replacement therapy.

Biochemical and immunological properties of lymphocytes were measured repetitively over a period of 40 mo during enzyme replacement by transfusion in a child with adenosine deaminase (ADA) deficiency and severe combined immunodeficiency disease. Catalytically defective ADA protein is present in the child's cells. ADA activity in his lymphocytes is 7 nmol/min per 10(8) cells with 51 ng of ADA protein/10(8) cells by radioimmunoassay. ADA activities in normal cord and adult lymphocytes average 193 and 92 nmol/min per 10(8) cells, respectively, with 429 and 223 ng of ADA protein/10(8) cells. Deoxy(d)ATP accumulates in the patient's erythrocytes and lymphocytes. Transfusion of irradiated packed erythrocytes partially corrects the metabolic defects. Frank metabolic relapse occurs if transfusions are discontinued for several months. The amounts of dATP in erythrocytes and lymphocytes averaged 13 and 2 times normal, respectively, during periods when transfusions were administered every 2-4 wk. Deoxyguanosine triphosphate and deoxycytidine triphosphate in lymphocytes were normal on 11 occasions, but deoxyribosylthymine triphosphate was ninefold increased. On 11 occasions dATP was measured in lymphocytes and erythrocytes isolated simultaneously. There was a positive, but statistically insignificant, correlation between amounts of dATP in the two types of cells (r = 0.25,P > 0.1). The absolute peripheral lymphocyte count was correlated with the activity of ADA in circulating erythrocytes and with the response of lymphocytes to phytohemagglutinin (r = 0.64, P < 0.01; r = 0.49, P < 0.05). Response of lymphocytes to stimulation by phytohemagglutinin in vitro and absolute peripheral lymphocyte counts were not significantly correlated with levels of dATP in the erythrocyte or lymphocyte during periods of intensive therapy. Although there was objective improvement during enzyme replacement, the child remained immunodeficient and biochemically abnormal.

Terminal deoxynucleotidyltransferase distribution in neoplastic and hematopoietic cells.

In the present study, terminal deoxynucleotidyltransferase was examined in the peripheral blood and (or) bone marrow of 115 children with a variety of neoplastic, hematologic, and other unrelated disorders. Terminal deoxynucleotidyltransferase activity was present at 4.08+/-0.74 U/108 cells in 23 morphologicall normal bone marrow samples from childhood controls. Terminal transferase was present at greater than 23 U/108 nucleated cells and at greater than31 U/108 blasts in the bone marrow of all children with acute lymphoblastic leukemia studied at initial diagnosis and at disease relapse. Terminal deoxynucleotidyltransferase was detectable at low levels, less than 7.5 U/108 cells, in all remission marrow smaples. Bone marrow terminal transferase activity was markedly elevated in all untreated acute lymphoblastic leukemia patients, whereas low levels which were difficult to interpret were present in the peripheral blood samples of two patients at diagnosis and six patients at relapse who had low absolute lymphoblast counts. Because of greater variation in the lymphoblast content of peripheral blood, bone marrow assays are more reliable in detecting disease activity. Marrow terminal deoxynucleotidyltransferase values obtained during the active phase of acute lymphoblastic leukemia were significantly greater than those found in other types of leukemia, bone marrow malignancies, and hematologic disorders. Terminal transferase determinations in blast cells of two patients with leukemic conversion of non-Hodgkin's lymphoma and in tumor cells from one patient with Burkitt's lymphoma were within the control range. These dat further define the usefulness of terminal deoxynucleotidyltrnasferase assay in the differentiation and classication of hematologic malignancies.

Structure of adenosine deaminase mRNAs from normal and adenosine deaminase-deficient human cell lines.

The structure of human adenosine deaminase mRNA from normal and mutant lymphoblasts was examined by sequence analysis of a cDNA for normal mRNA and electrophoretic analyses of DNA fragments generated by S1 endonuclease cleavage of mRNA-cDNA hybrids. The 1,533-base sequence of the cloned cDNA represents the complete mRNA sequence with the possible exception of some of the 5' untranslated region. S1 nuclease analyses of hybrids between cloned cDNA and normal adenosine deaminase mRNA confirmed that a 76-base sequence in a previously examined adenosine deaminase cDNA is an intron. S1 nuclease analyses of mRNAs from seven mutant cell lines demonstrated that four of the mutants, those in the GM-2471, GM-2756, GM-4258, and GM-2606 cells, contain small defects, such as single-base changes, that are not detectable by the S1 nuclease technique. Three of the mRNAs, those in GM-3043, GM-2294, and GM-2825A cells, do contain defects detectable with S1 nuclease. These defects differ from each other and have been mapped to specific regions of the mRNA. Some or all of these defective mRNAs are postulated to result from anomalous RNA processing.

A central role for a single c-Myb binding site in a thymic locus control region.

Locus control regions (LCRs) are powerful assemblies of cis elements that organize the actions of cell-type-specific trans-acting factors. A 2.3-kb LCR in the human adenosine deaminase (ADA) gene first intron, which controls expression in thymocytes, is composed of a 200-bp enhancer domain and extended flanking sequences that facilitate activation from within chromatin. Prior analyses have demonstrated that the enhancer contains a 28-bp core region and local adjacent augmentative cis elements. We now show that the core contains a single critical c-Myb binding site. In both transiently cotransfected human cells and stable chromatin-integrated yeast cells, c-Myb strongly transactivated reporter constructs that contained polymerized core sequences. c-Myb protein was strongly evident in T lymphoblasts in which the enhancer was active and was localized within discrete nuclear structures. Fetal murine thymus exhibited a striking concordance of endogenous c-myb expression with that of mouse ADA and human ADA LCR-directed transgene expression. Point mutation of the c-Myb site within the intact 2.3-kb LCR severely attenuated enhancer activity in transfections and LCR activity in transgenic thymocytes. Within the context of a complex enhancer and LCR, c-Myb can act as an organizer of thymocyte-specific gene expression via a single binding site.

Dissecting a locus control region: facilitation of enhancer function by extended enhancer-flanking sequences.

Using transgenic mice, we have defined novel gene regulatory elements, termed "facilitators." These elements bilaterally flank, by up to 1 kb, a 200-bp T-cell-specific enhancer domain in the human adenosine deaminase (ADA) gene. Facilitators were essential for gene copy-proportional and integration site-independent reporter expression in transgenic thymocytes, but they had no effect on the enhancer in transfected T cells. Both segments were required. Individual segments had no activity. A lack of facilitator function caused positional susceptibility and prevented DNase I-hypersensitive site formation at the enhancer. The segments were required to be at opposed ends of the enhancer, and they could not be grouped together. Reversing the orientation of a facilitator segment caused a partial loss of function, suggesting involvement of a stereospecific chromatin structure. trans-acting factor access to enhancer elements was modeled by exposing nuclei to a restriction endonuclease. The enhancer domain was accessible to the 4-cutter DpnII in a tissue- and cell-type-specific fashion. However, unlike DNase I hypersensitivity and gene expression, accessibility to the endonuclease could occur without the facilitator segments, suggesting that an accessible chromatin domain is an intermediate state in the activational pathway. These results suggest that facilitators (i) are distinct from yet positionally constrained to the enhancer, (ii) participate in a chromatin structure transition that is necessary for the DNase I hypersensitivity and the transcriptional activating function of the enhancer, and (iii) act after cell-type-specific accessibility to the enhancer sequences is established by factors that do not require the facilitators to be present.

Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression.

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

Metabolism of cigarette smoke condensates by human and rat homogenates to form mutagens detectable by Salmonella typhimurium TA1538.

Nineteen fractions of whole condensate of smoke from the University of Kentucky Reference Cigarette IRI were tested for mutagenicity in vitro using a bacterial indicator system. As little as 25 mug of the active fractions were mutagenic toward histidine-requiring Salmonella typhimurium TA1538, if the condensates were incubated in the presence of rat or human liver homogenates of lung were relatively inactive. Homogenates from livers of rats that had been treated with 3-methylcholanthrene converted condensates to mutagens more efficiently than did liver homogenates from man or from normal or phenobarbital-treated rats. Use of homogenates from animals treated with 3-methylcholanthrene gave much more reproducible results in smoke fraction assays because larger numbers of revertants were obtained, and dose-response curves were linear over the range 25 to 250 mug condensate. The linear dose-response curves permitted quantitative comparison of the various fractions. The mutagenicity per mg of basic fractions of whole smoke condensate is very high and that of neutral polycyclic hydrocarbons is very low. Because of the exquisite preferential sensitivity of the TA1538 test system to polycyclic amines and insensitively to alkyl polycyclics, there is a poor quantitative correlation between mutagenicity and carcinogenicity, as measured by skin painting or in vitro cell transformation. There is substantial evidence that many carcinogens are mutagens but that most of these compounds require metabolism before they are biologically active. If further development improves the sensitivity of the bacterial testing system to mutagenic derivatives of alkyl polycyclic and heteropolycyclic hydrocarbons, it may provide a convenient, rapid, quantitative, and inexpensive bioassay for the detection of potentially carcinogenic substances in tobacco smoke condensates.

Effects of cigarette smoking on aryl hydrocarbon hydroxylase activity in lungs and tissues of inbred mice.

Inbred strains of mice have been classified as aromatic hydrocarbon responsive or nonresponsive depending upon whether the parenteral administration of these substances increases hepatic aryl hydrocarbon hydroxylase (AHH) activity. Aromatic hydrocarbon responsiveness is controlled by genes at a small number of loci. Using 3-methylcholanthrene as inducing agent, strains A/J, C3H/HeJ, and C57BL/6J have been classified as responsive, whereas strains AKR/J, DBA/2J, and SWR/J are nonresponsive. Inhalation of cigarette smoke by both hepatic responsive and nonresponsive mice induces AHH activity in lung, but not in liver, stomach, small intestine, or kidney. The responsive strains have significantly higher levels of basal and induced AHH in the lung than do the hepatic nonresponsive strains. However, because of the especially low basal activity of AHH in lungs of hepatic nonresponsive strains, the ratio of AHH activity in animals treated with cigarette smoke to that in untreated animals is higher in nonresponsive than in responsive strains. AHH activity in lungs is fully induced within 6 to 12 hr after smoke inhalation and remains at the same level whether animals are treated 1 day or daily for 4 week;. AHH in lung returns to basal levels within 5 days after cessation of smoking.

Serial observations on terminal deoxynucleotidyl transferase activity and lymphoblast surface markers in acute lymphoblastic leukemia.

Terminal deoxynucleotidyl transferase activity and cell surface markers were measured in peripheral lymphoid cells from 27 children with acute lymphoblastic leukemia in various phases of their disease. Lymphoblasts from untreated patients had smooth surface ultrastructure but heterogeneous surface receptors. Greater than 60% of lymphoblasts from 4 to 7 untreated patients formed rosettes with sheep red blood cells. Transferase activity was variable, ranging from 8 to 210 units/10(8) blasts, but it was consistently elevated at diagnosis and in relapse. Transferase levels did not correlate with the presence of lymphoblast surface receptors. During induction therapy transferase activity decreased rapidly, but it remained elevated in peripheral lymphoid cells even when blasts were not detectable in peripheral blood smears. Patients in remission had normal surface receptors and undetectable or minimally elevated levels of transferase. Terminal transferase activity may be a sensitive biochemical marker for a primitive cell population and may be important in the evaluation of therapeutic effectiveness in acute lymphoblastic leukemia.

Phase I clinical investigation of 9-beta-D-arabinofuranosyl-2-fluoroadenine 5'-monophosphate (NSC 312887), a new purine antimetabolite.

9-beta-D-Arabinofuranosyl-2-fluoroadenine 5'-monophosphate (NSC 312887) is a new purine antimetabolite that has been evaluated in a Phase I clinical trial. The schedule of administration consisted of a single i.v. infusion over a period of 30 min once each day for 5 consecutive days, repeated at 4-week intervals. Thirteen patients received 30 courses of the drug in a dose range of 18 to 40 mg/sq m/day. Granulocytopenia and thrombocytopenia were dose limiting. Repeated courses produced similar degrees of granulocytopenia, but in 7 of 7 patients receiving 2 or more courses, the degree of thrombocytopenia was less severe during the first than during subsequent courses. Myelosuppression in humans was more severe than predicted from the mouse model. Lymphopenia was profound at all dose levels, but reversed within 3 weeks. Somnolence occurred during infusion in 8 of 13 patients, but quickly cleared after the infusion was completed. The infused drug was rapidly dephosphorylated in plasma and then cleared so there was no cumulation of drug in plasma when it was rapidly infused once each day in these doses. Phase II studies of 9-beta-D-arabinofuranosyl-2-fluoroadenine 5'-monophosphate are planned at a starting dose of 18 mg/ sq m/day for patients with prior chemotherapy or radiotherapy and 25 mg/sq m/day for those without prior therapy, as a single dose on each of 5 consecutive days repeated at 21- to 28-day intervals.

DNA polymerase, thymidine kinase and DNA synthesis in erythropoietic mouse spleen cells separated on bovine serum albumin gradients.

A single dose of erythropoietin stimulates DNA synthesis in the spleen of the polycythemic mouse with the maximum effect occurring 48 h after the hormone is administered. The increase in DNA synthesis is accompanied by morphologic evidence of increased erythropoiesis and by increases in the activities per cell of both thymidine kinase and cytoplasmic high molecular weight DNA polymerase-alpha. The activity of low molecular weight DNA polymerase-beta does not change significantly. Spleen cells from mice which had received either erythropoietin or saline 48 h previously were separated into 7 density classes on discontinuous bovine serum albumin gradients. Following the administration of erythropoietin, thymidine incorporation and thymidine kinase activity showed the greatest relative increases per nucleated cell in layers 3, 4 and 5 of the gradient. DNA polymerase-alpha showed the greatest increase in cells of the denser layers 5, 6 and 7. Each layer contained normoblasts and lymphocytes. The less well differentiated erythroid elements constituted a larger proportion of cells in layers of lower density. Increases in the rates of thymidine incorporation were better correlated with increases in thymidine kinase activity than with increases in DNA polymerase activities. Measurement of iron incorporation into heme confirm the morphological impression that the cell type responsible for increased thymidine incorporation and increased DNA polymerase-alpha activity is the young normblast.

Genetic relationship between aryl hydrocarbon hydroxylase inducibility and chemical carcinogen induced skin ulceration in mice.

Inbred strains of mice show differential skin inflammatory reactivity following the topical application of polycyclic hydrocarbons. Strains also differ in the extent to which hepatic aryl hydrocarbon hydroxylase activity is induced by these compounds. Differential inflammatory response and hydroxylase inducibility are genetically controlled by alleles at the In and Ahh loci, respectively. Genetic analyses and strain surveys indicate that the In and Ahh loci are identical, or very closely linked.

Quinacrine fluorescent chromosome analysis of the Snell translocation in the mouse.

The chromosomes involved in the T(2;4)Sn (formerly designated T(5;8) Sn) or Snell translocation in the mouse have been identified as numbers 2 and 4 by analysis of the fluorescent banding patterns of quinacrine mustard-stained chromosomes in primary cultures from heterozygous and homozygous embryos.