Use of zero-valent iron biosand filters to reduce Escherichia coli O157:H12 in irrigation water applied to spinach plants in a field setting.

AIMS: Zero-valent iron (ZVI) filters may provide an efficient method to mitigate the contamination of produce crops through irrigation water. METHODS: A field-scale system was utilized to evaluate the effectiveness of a biosand filter (S), a biosand filter with ZVI incorporated (ZVI) and a control (C, no treatment) in decontaminating irrigation water. An inoculum of c.8·5log CFU100ml(-1) of Escherichia coli O157:H12 was introduced to all three column treatments in 20-l doses. Filtered waters were subsequently overhead irrigated to 'Tyee' spinach plants. Water, spinach plant and soil samples were obtained on days 0, 1, 4, 6, 8, 10, 13 and 15 and analysed for E. coli O157:H12 populations. RESULTS: ZVI filters inactivated c.6logCFU100ml(-1) E. coli O157:H12 during filtration on day 0, significantly (P<0·05) more than S filter (0·49CFU100ml(-1)) when compared to control on day 0 (8·3log CFU100ml(-1)). On day 0, spinach plants irrigated with ZVI-filtered water had significantly lower E. coli O157 counts (0·13logCFUg(-1)) than spinach irrigated with either S-filtered (4·37logCFUg(-1)) or control (5·23logCFUg(-1)) water. Soils irrigated with ZVI-filtered water contained E. coli O157:H12 populations below the detection limit (2logCFUg(-1)), while those irrigated with S-filtered water (3·56logCFUg(-1)) were significantly lower than those irrigated with control (4·64logCFUg(-1)). CONCLUSIONS: ZVI biosand filters were more effective in reducing E. coli O157:H12 populations in irrigation water than sand filters. SIGNIFICANCE AND IMPACT OF THE STUDY: Zero-valent ion treatment may be a cost-effective mitigation step to help small farmers reduce risk of foodborne E. coli infections associated with contamination of leafy greens.

[DLys(6)]-luteinizing hormone releasing hormone-curcumin conjugate inhibits pancreatic cancer cell growth in vitro and in vivo.

Pancreatic ductal adenocarcinomas are invariably lethal, and developing effective treatments that have minimal side effects is a challenge. Previous studies from our laboratory have shown that conjugates of cell membrane disrupting lytic peptides and luteinizing hormone releasing hormone (LHRH) target and destroy human prostate and breast cancer cells in xenografts in the nude mouse model (Hansel et al., Mol Cell Endocrinol 2007;260-262:183-9; Hansel et al., Mol Cell Endocrinol 2007;269:26-33), which express LHRH receptors. The objectives of our study were to synthesize a bioconjugate of LHRH analog ([DLys(6)]-LHRH) and a dietary microchemical (curcumin) and test the hypothesis that [DLys(6)]-LHRH-curcumin targets and inhibits pancreatic cancer cell growth in vitro and in vivo. In in vitro studies, we determined by confocal microscopy, flow cytometry analysis and reverse transcriptase-polymerase chain reaction that MIAPaCa-2, Panc-1 and BxPC-3 pancreatic cancer cell lines express LHRH receptors. [DLys(6)]-LHRH-curcumin inhibited cell proliferation of pancreatic cancer cell lines and induced apoptotic cell death (p < 0.05). Apoptosis was induced by cleavage of polyadenosine-5'-diphosphate-ribose-polymerase and caspase-3. The activity of [DLys(6)]-LHRH-curcumin was equal to free curcumin at equimolar concentrations in vitro. Unlike curcumin itself, the [DLys(6)]-LHRH-curcumin conjugate is water soluble which allows its intravenous administration. In two in vivo studies, [DLys(6)]-LHRH-curcumin given intravenously caused a significant (p < 0.01) reduction in tumor weights and volumes, and free curcumin given by gavage at an equal dose failed to cause a significant reduction in tumor weights and volumes in the nude mouse pancreatic cancer model. [DLys(6)]-LHRH-curcumin treatment enhanced apoptosis compared to [DLys(6)]-LHRH and vehicle-treated controls in tumor tissue. In conclusion, [DLys(6)]-LHRH-curcumin may be useful in treating pancreatic cancer.

A novel contactless technique to measure water waves using a single photon avalanche diode detector array.

Commonly deployed measurement systems for water waves are intrusive and measure a limited number of parameters. This results in difficulties in inferring detailed sea state information while additionally subjecting the system to environmental loading. Optical techniques offer a non-intrusive alternative, yet documented systems suffer a range of problems related to usability and performance. Here, we present experimental data obtained from a 256 × 256 Single Photon Avalanche Diode (SPAD) detector array used to measure water waves in a laboratory facility. 12 regular wave conditions are used to assess performance. Picosecond resolution time-of-flight measurements are obtained, without the use of dye, over an area of the water surface and processed to provide surface elevation data. The SPAD detector array is installed 0.487 m above the water surface and synchronized with a pulsed laser source with a wavelength of 532 nm and mean power <1 mW. Through analysis of the experimental results, and with the aid of an optical model, we demonstrate good performance up to a limiting steepness value, ka, of 0.11. Through this preliminary proof-of-concept study, we highlight the capability for SPAD-based systems to measure water waves within a given field-of-view simultaneously, while raising potential solutions for improving performance.

Hyperactivation of p21(ras) and the hematopoietic-specific Rho GTPase, Rac2, cooperate to alter the proliferation of neurofibromin-deficient mast cells in vivo and in vitro.

Mutations in the NF1 tumor suppressor gene cause neurofibromatosis type I (NF1), a disease characterized by the formation of cutaneous neurofibromas infiltrated with a high density of degranulating mast cells. A hallmark of cell lines generated from NF1 patients or Nf1-deficient mice is their propensity to hyperproliferate. Neurofibromin, the protein encoded by NF1, negatively regulates p21(ras) activity by accelerating the conversion of Ras-GTP to Ras-GDP. However, identification of alterations in specific p21(ras) effector pathways that control proliferation in NF1-deficient cells is incomplete and critical for understanding disease pathogenesis. Recent studies have suggested that the proliferative effects of p21(ras) may depend on signaling outputs from the small Rho GTPases, Rac and Rho, but the physiologic importance of these interactions in an animal disease model has not been established. Using a genetic intercross between Nf1(+/)- and Rac2(-)(/)- mice, we now provide genetic evidence to support a biochemical model where hyperactivation of the extracellular signal-regulated kinase (ERK) via the hematopoietic-specific Rho GTPase, Rac2, directly contributes to the hyperproliferation of Nf1-deficient mast cells in vitro and in vivo. Further, we demonstrate that Rac2 functions as mediator of cross-talk between phosphoinositide 3-kinase (PI-3K) and the classical p21(ras)-Raf-Mek-ERK pathway to confer a distinct proliferative advantage to Nf1(+/)- mast cells. Thus, these studies identify Rac2 as a novel mediator of cross-talk between PI-3K and the p21(ras)-ERK pathway which functions to alter the cellular phenotype of a cell lineage involved in the pathologic complications of a common genetic disease.

Genetic and biochemical evidence that haploinsufficiency of the Nf1 tumor suppressor gene modulates melanocyte and mast cell fates in vivo.

Neurofibromatosis type 1 (NF1) is a common autosomal-dominant disorder characterized by cutaneous neurofibromas infiltrated with large numbers of mast cells, melanocyte hyperplasia, and a predisposition to develop malignant neoplasms. NF1 encodes a GTPase activating protein (GAP) for Ras. Consistent with Knudson's "two hit" model of tumor suppressor genes, leukemias and malignant solid tumors in NF1 patients frequently demonstrate somatic loss of the normal NF1 allele. However, the phenotypic and biochemical consequences of heterozygous inactivation of Nf1 are largely unknown. Recently neurofibromin, the protein encoded by NF1, was shown to negatively regulate Ras activity in Nf1-/- murine myeloid hematopoietic cells in vitro through the c-kit receptor tyrosine kinase (dominant white spotting, W). Since the W and Nf1 locus appear to function along a common developmental pathway, we generated mice with mutations at both loci to examine potential interactions in vivo. Here, we show that haploinsufficiency at Nf1 perturbs cell fates in mast cells in vivo, and partially rescues coat color and mast cell defects in W(41) mice. Haploinsufficiency at Nf1 also increased mast cell proliferation, survival, and colony formation in response to Steel factor, the ligand for c-kit. Furthermore, haploinsufficiency was associated with enhanced Ras-mitogen-activated protein kinase activity, a major downstream effector of Ras, via wild-type and mutant (W(41)) c-kit receptors. These observations identify a novel interaction between c-kit and neurofibromin in vivo, and offer experimental evidence that haploinsufficiency of Nf1 alters both cellular and biochemical phenotypes in two cell lineages that are affected in individuals with NF1. Collectively, these data support the emerging concept that heterozygous inactivation of tumor suppressor genes may have profound biological effects in multiple cell types.

Weight loss from maximum body weight and mortality: the Third National Health and Nutrition Examination Survey Linked Mortality File.

OBJECTIVE: The aim of this longitudinal study is to examine the relationship between weight loss from maximum body weight, body mass index (BMI), and mortality in a nationally representative sample of men and women. DESIGN: Longitudinal cohort study. SUBJECTS: In all, 6117 whites, blacks, and Mexican-Americans 50 years and over at baseline who survived at least 3 years of follow-up, from the Third National Health and Nutrition Examination Survey Linked Mortality Files (1988-1994 with passive mortality follow-up through 2000), were included. MEASUREMENTS: Measured body weight and self-reported maximum body weight obtained at baseline. Weight loss (maximum body weight minus baseline weight) was categorized as <5%, 5-<15%, and >or=15%. Maximum BMI (reported maximum weight (kg)/measured baseline height (m)(2)) was categorized as healthy weight (18.5-24.9), overweight (25.0-29.9), and obese (>or=30.0). RESULTS: In all, 1602 deaths were identified. After adjusting for age, race, smoking, health status, and preexisting illness, overweight men with weight loss of 15% or more, overweight women with weight loss of 5-<15%, and women in all BMI categories with weight loss of 15% or more were at increased risk of death from all causes compared with those in the same BMI category who lost <5%; hazard ratios ranged from 1.46 to 2.70. Weight loss of 5-<15% reduced risk of death from cardiovascular diseases among obese men. CONCLUSIONS: Weight loss of 15% or more from maximum body weight is associated with increased risk of death from all causes among overweight men and among women regardless of maximum BMI.

First Report of Tobacco ringspot virus in Joe-Pye Weed (Eupatorium purpureum) in Mississippi.

Eupatorium purpureum L. (joe-pye weed, sweet joe-pye weed, and sweetscented joe-pye weed) is a wildflower perennial plant native to the eastern United States. In May 2006, virus-like symptoms including systemic chlorosis, mottling, and downward rolling of leaf blades were observed in a joe-pye weed plant located on the Mississippi State University campus. Young symptomatic leaves were ground in 0.1 M phosphate buffer, pH 7.2, and the slurry was inoculated on leaves of several herbaceous hosts grown in a greenhouse. Systemic symptoms were observed 1 to 2 weeks postinoculation in Cucumis sativus (chlorotic spots followed by systemic ringspot and leaf deformation), Chenopodium quinoa (necrotic lesions/leaf deformation), Nicotiana benthamiana (mosaic/line patterns), and N. rustica (necrotic ring spots). Electron microscopy of partially purified preparations from infected joe-pye weed and cucumber plants revealed the presence of intact and empty isometric viral particles of approximately 30 nm in diameter resembling nepoviruses or comoviruses. The original joe-pye weed plant and artificially infected herbaceous plants were tested by ELISA (Agdia Inc., Elkhart, IN) for several nepoviruses/comoviruses and found to be positive for Tobacco ringspot virus (TRSV; genus Nepovirus, family Comoviridae). Total RNA extracted from the original virus source plant was reverse transcribed using oligodT primer and submitted to PCR with the primer set TRS-F (5'TATCCCTATGTGCTTGAGAG3') and TRS-R (5'CATAGACCACCAGAGTCACA3') designed from the published sequences in GenBank of the RNA 1 of Tobacco ringspot virus. A specific 766-bp PCR product was cloned and sequenced. Sequence analysis showed that the virus from the joe-pye weed shared 94% nucleotide identity (98% at amino acid level) with a "bud blight" isolate of TRSV (Accession No U50869) (2) in the sequenced genome portion and slightly lower (90 to 92%) with other sequenced isolates of the same virus, thus further confirming the identity of the virus. In 2008 and 2009, TRSV was detected in an additional 16 symptomatic specimens of the same host collected from six distinct locations in Mississippi. Our results show that E. purpureum is a new host for TRSV. Considering that the related plant species E. capillifolium (small dogfennel) was already reported as a host of TRSV in North Carolina (1), this suggests that these two common plants may represent additional reservoirs of this virus in the region. References: (1) M. C. Rush and G. V. Gooding. Phytopathology 60:1756, 1970, (2) P. A. Zalloua et al. Virology 219:1, 1996.

Amyloidosis increase is not attenuated by long-term calorie restriction or related to neuron density in the prefrontal cortex of extremely aged rhesus macaques.

As human lifespan increases and the population ages, diseases of aging such as Alzheimer's disease (AD) are a major cause for concern. Although calorie restriction (CR) as an intervention has been shown to increase healthspan in many species, few studies have examined the effects of CR on brain aging in primates. Using postmortem tissue from a cohort of extremely aged rhesus monkeys (22-44 years old, average age 31.8 years) from a longitudinal CR study, we measured immunohistochemically labeled amyloid beta plaques in Brodmann areas 32 and 46 of the prefrontal cortex, areas that play key roles in cognitive processing, are sensitive to aging and, in humans, are also susceptible to AD pathogenesis. We also evaluated these areas for cortical neuron loss, which has not been observed in younger cohorts of aged monkeys. We found a significant increase in plaque density with age, but this was unaffected by diet. Moreover, there was no change in neuron density with age or treatment. These data suggest that even in the oldest-old rhesus macaques, amyloid beta plaques do not lead to overt neuron loss. Hence, the rhesus macaque serves as a pragmatic animal model for normative human aging but is not a complete model of the neurodegeneration of AD. This model of aging may instead prove most useful for determining how even the oldest monkeys are protected from AD, and this information may therefore yield valuable information for clinical AD treatments.

Dietary restriction retards the age-associated loss of rat striatal dopaminergic receptors.

In male Wistar rats subjected to dietary restriction by alternate days of feeding and fasting the normal age-associated loss of striatal dopamine receptors in the brain was substantially retarded. The mean survival time of the rats on the restricted diet was increased by approximately 40 percent compared to control rats given free access to food. Dopamine receptor concentrations in striata of 24-month-old rats that had been on a restricted diet since weaning were 50 percent higher than those of control animals of the same age, and essentially comparable to 3- and 6-month-old control rats.

Acquisition of conditioned taste aversion is impaired in the amyloid precursor protein/presenilin 1 mouse model of Alzheimer's disease.

Research into the underlying mechanisms of cognitive dysfunction in Alzheimer's disease (AD) has relied traditionally on tasks such as the water maze which evaluate spatial learning and memory. Since non-spatial forms of memory are also disrupted by AD, it is critical to establish other paradigms capable of investigating these deficits. Utilizing a non-spatial learning task, acquisition of conditioned taste aversion (CTA) was evaluated in a mouse model of AD. This line of transgenic mice encode a mutated allele of the human amyloid precursor protein (APP) and presenilin 1 (PS1) genes and exhibit extensive amyloid plaque deposition in the brain by 6-7 mo of age. Compared with wild-type mice, 10-17 month old APP/PS1 mice failed to acquire CTA to saccharin. Mice that only possessed one of the two mutations were able to acquire CTA to the saccharin. In 2-5 month old APP/PS1 mice acquisition of CTA was disrupted despite the lack of extensive plaque deposition. However, further analysis indicated a potential gender difference in both the CTA deficit and onset of plaque deposition with females showing greater conditioned aversion.

Differential gender effects of a reduced-calorie diet on systemic inflammatory and immune parameters in nonhuman primates.

BACKGROUND AND OBJECTIVE: Dietary manipulation, including caloric restriction, has been shown to impact host response capabilities significantly, particularly in association with aging. This investigation compared systemic inflammatory and immune-response molecules in rhesus monkeys (Macaca mulatta). MATERIAL AND METHODS: Monkeys on continuous long-term calorie-restricted diets and a matched group of animals on a control ad libitum diet, were examined for systemic response profiles including the effects of both gender and aging. RESULTS: The results demonstrated that haptoglobin and alpha1-antiglycoprotein levels were elevated in the serum of male monkeys. Serum IgG responses to Campylobacter rectus, Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis were significantly elevated in female monkeys. While only the antibody to Fusobacterium nucleatum was significantly affected by the calorie-restricted diet in female monkeys, antibody levels to Prevotella intermedia, C. rectus and Treponema denticola demonstrated a similar trend. CONCLUSION: In this investigation, only certain serum antibody levels were influenced by the age of male animals, which was seemingly related to increasing clinical disease in this gender. More generally, analytes were modulated by gender and/or diet in this oral model system of mucosal microbial challenge.

Working hypothesis to redefine endothelial progenitor cells.

Since 1997, postnatal vasculogenesis has been purported to be an important mechanism for neoangiogenesis via bone marrow (BM)-derived circulating endothelial progenitor cells (EPCs). Based on this paradigm, EPCs have been extensively studied as biomarkers to assess severity of cardiovascular disease and as a cell-based therapy for several human cardiovascular disorders. In the majority of studies to date, EPCs were identified and enumerated by two primary methodologies; EPCs were obtained and quantified following in vitro cell culture, or EPCs were identified and enumerated by flow cytometry. Both methods have proven controversial. This review will attempt to outline the definition of EPCs from some of the most widely cited published reports in an effort to provide a framework for understanding subsequent studies in this rapidly evolving field. We will focus this review on studies that used cell culture techniques to define EPCs.

Overnight sleep duration and obesity in 2-5 year-old American Indian children.

BACKGROUND: Sleep has emerged as a potentially modifiable risk factor for obesity in children. OBJECTIVES: The purpose of this investigation was to evaluate the association between overnight sleep duration and obesity among American Indian (AI) children ages 2-5 years. METHODS: Data were examined from the baseline assessment of children enrolling in the Healthy Children, Strong Families study, which is a randomized lifestyle intervention trial in five diverse rural and urban AI communities nationally among children ages 2-5 years. Multivariable models were built to assess the relationship between sleep duration and BMI z-score while controlling for potential sociodemographic and behavioural covariates. RESULTS: Three hundred and ninety-eight children had sufficient data to be included in analysis. In multivariable models controlling for potential covariates, overnight sleep duration was significantly and inversely associated with BMI z-score (B = -0.158, t = -1.774, P = 0.006). Similarly, when controlling for covariates, children who slept 12 or more hours had significantly lower BMI z-scores compared with those who slept 8 to 10 h (P = 0.018) or less than 8 h (P = 0.035); the difference between 12+ hours and 10 to 12-h groups did not reach statistical significance (P = 0.073) but supported a linear relationship between overnight sleep duration and BMI. Weekday-to-weekend variability in overnight sleep duration was not associated with BMI z-score (B = 0.010, t = 0.206, P = 0.837). CONCLUSIONS: Overnight sleep duration is independently and inversely related to BMI z-score among AI children ages 2-5 years, even when controlling for important sociodemographic and obesogenic lifestyle factors. This represents the first report, to our knowledge, of sleep duration as a risk factor for obesity among AI children.

The nitrogen concentration effect on Ce doped SiOxNy emission: towards optimized Ce3+ for LED applications.

Ce-Doped SiOxNy films are deposited by magnetron reactive sputtering from a CeO2 target under a nitrogen reactive gas atmosphere. Visible photoluminescence measurements regarding the nitrogen gas flow reveal a large emission band centered at 450 nm for a sample deposited under a 2 sccm flow. Special attention is paid to the origin of such an emission at high nitrogen concentration. Different emitting centers are suggested in Ce doped SiOxNy films (e.g. band tails, CeO2, Ce clusters, Ce3+ ions), with different activation scenarios to explain the luminescence. X-ray photoelectron spectroscopy (XPS) reveals the exclusive presence of Ce3+ ions whatever the nitrogen or Ce concentrations, while transmission electron microscopy (TEM) shows no clusters or silicates upon high temperature annealing. With the help of photoluminescence excitation spectroscopy (PLE), a wide excitation range from 250 nm up to 400 nm is revealed and various excitations of Ce3+ ions are proposed involving direct or indirect mechanisms. Nitrogen concentration plays an important role in Ce3+ emission by modifying Ce surroundings, reducing the Si phase volume in SiOxNy and causing a nephelauxetic effect. Taking into account the optimized nitrogen growth parameters, the Ce concentration is analyzed as a new parameter. Under UV excitation, a strong emission is visible to the naked eye with high Ce3+ concentration (6 at%). No saturation of the photoluminescence intensity is observed, confirming again the lack of Ce cluster or silicate phase formation due to the nitrogen presence.

Circulating polyribophosphate in Hemophilus influenzae, type b meningitis. Correlation with clinical course and antibody response.

In systemic infections caused by Hemophilus influenzae, type b, the capsular polysaccharide, polyribophosphate, is released into the circulation. Polyribophosphate was quantitated in serial serum and cerebrospinal fluid samples from 45 children with H. influenzae, type b meningitis by means of a radiolabeled antigen-binding inhibition assay. Polyribophosphate was regularly found in acute serum and cerebrospinal fluid samples and could be detected in unbound form for periods of 1-30 days after initiation of effective therapy. Complexes of polyribophosphate dissociable with acid and pepsin were detected in serum samples from 17 patients, in one case for a period of 145 days after hospitalization. Polyribophosphate levels and patterns of clearance were studied in relation to hospital course and antibody response. Patients with prolonged antigenemia had protracted fevers and severe neurological symptoms during hospitalization, frequently with focal complications.Antipolyribophosphate antibody responses were detected during the first 100 days of convalescence by radioimmunoassay in 79% of the patients studied, including 60% of the children 1 yr or less in age. The intensity of antibody response although clearly related to the age of the patient, was more reliably predicted by the efficiency of antigen clearance. Antibody responses were uniformly of low magnitude in patients with prolonged antigenemia, irrespective of age. Paients who failed to develop antibody to polyribophosphate after meningitis also exhibited impaired antigen clearance. These studies suggest that mechanisms necessary for clearance of polyribophosphate may influence the development and intensity of the humoral immune response and raise the possibility of developmental deficiencies in the clearance system in infants and children.

Calorie restriction in nonhuman primates: assessing effects on brain and behavioral aging.

Dietary caloric restriction (CR) is the only intervention repeatedly demonstrated to retard the onset and incidence of age-related diseases, maintain function, and extend both lifespan and health span in mammals, including brain and behavioral function. In 70 years of study, such beneficial effects have been demonstrated in rodents and lower animals. Recent results emerging from ongoing studies of CR in humans and nonhuman primates suggest that many of the same anti-disease and anti-aging benefits observed in rodent studies may be applicable to long-lived species. Results of studies in rhesus monkeys indicate that CR animals (30% less than controls) are healthier than fully-fed counterparts based on reduced incidence of various diseases, exhibit significantly better indices of predisposition to disease and may be aging at a slower rate based on analysis of selected indices of aging. The current review discusses approaches taken in studies of rhesus monkeys to analyze age-related changes in brain and behavioral function and the impact of CR on these changes. Approaches include analyses of gross and fine locomotor performance as well as brain imaging. In a related study it was observed that short-term CR (6 months) in adult rhesus monkeys can provide protection against a neurotoxic insult. Increasing interest in the CR paradigm will expand its role in demonstrating how nutrition can modulate the rate of aging and the mechanisms responsible for this modulation.

Five-year survival from breast cancer in Western Australia over a decade.

The aim of the present study was to investigate whether 5-year survival of patients with breast cancer in Western Australia has improved over time. We used a population-based study conducted in the State of Western Australia, to identify all cases of invasive breast cancer cases diagnosed in 1989, 1994 and 1999. Information on presentation, investigation and management was extracted from medical records of each case and status at 5 years after date of diagnosis was determined. Comparison of 5-year overall survival for women diagnosed in the three calendar years, and hazard ratios for survival calculated for prognostic variables were measured. We found that survival from breast cancer has improved in Western Australia since 1989. Earlier diagnosis, living in the Perth metropolitan area and use of breast-conserving surgery are associated with better survival, irrespective of year of diagnosis. Further research needs to be carried out to determine the reason for this improvement.

Factors affecting compost tea as a potential source of Escherichia coli and Salmonella on fresh produce.

Compost tea (CT) is an unheated on-farm infusion of compost used as a spray or soil drench to promote plant growth and control foliar and root diseases. Because food safety involves all aspects from farm to fork, CT should meet basic microbiological criteria for water quality. This report describes the effects of two CT production processes, aerated and nonaerated, on growth and survival of foodborne pathogens and fecal coliforms. Seven commercially available nutrients used to supplement CT were tested individually and in combination for their effects on the growth of Escherichia coli and Salmonella. Compost containing 10(1) to 10(3) CFU/g initial concentrations of E. coli O157:H7 and Salmonella Enteritidis were used to assess growth and survival responses to aerated CT (36-h preparations) and nonaerated CT (8.5-day preparations). Pathogen and fecal coliform populations were undetectable by 8.5 days in nonaerated CT without nutrient supplements. E. coli O157:H7 decreased to below detection levels in aerated CT at 36 h without the use of supplements. In contrast, the addition of commercially formulated mixtures or combinations of nutrient supplements resulted in growth of E. coli O157: H7, Salmonella, and fecal coliforms by 1 to 4 log CFU/g in both aerated and nonaerated CT. When nutrient supplements were added, aerated CT sustained higher concentrations of E. coli O157:H7, Salmonella, and fecal coliforms than did nonaerated CT. Thus, addition of supplements supports growth of human pathogens from very low initial concentrations in both aerated and nonaerated CT and should be avoided when CT is used on fresh produce.

The impact of hunting on tropical mammal and bird populations.

Hunting is a major driver of biodiversity loss, but a systematic large-scale estimate of hunting-induced defaunation is lacking. We synthesized 176 studies to quantify hunting-induced declines of mammal and bird populations across the tropics. Bird and mammal abundances declined by 58% (25 to 76%) and by 83% (72 to 90%) in hunted compared with unhunted areas. Bird and mammal populations were depleted within 7 and 40 kilometers from hunters' access points (roads and settlements). Additionally, hunting pressure was higher in areas with better accessibility to major towns where wild meat could be traded. Mammal population densities were lower outside protected areas, particularly because of commercial hunting. Strategies to sustainably manage wild meat hunting in both protected and unprotected tropical ecosystems are urgently needed to avoid further defaunation.