TROPHY-U-01, a phase II open-label study of sacituzumab govitecan in patients with metastatic urothelial carcinoma progressing after platinum-based chemotherapy and checkpoint inhibitors: updated safety and efficacy outcomes.

BACKGROUND: Sacituzumab govitecan (SG) is a Trop-2-directed antibody-drug conjugate containing cytotoxic SN-38, the active metabolite of irinotecan. SG received accelerated US Food and Drug Administration approval for locally advanced (LA) or metastatic urothelial carcinoma (mUC) previously treated with platinum-based chemotherapy and a checkpoint inhibitor, based on cohort 1 of the TROPHY-U-01 study. Mutations in the uridine diphosphate glucuronosyltransferase 1A1 (UGT1A1) gene are associated with increased adverse events (AEs) with irinotecan-based therapies. Whether UGT1A1 status could impact SG toxicity and efficacy remains unclear. PATIENTS AND METHODS: TROPHY-U-01 (NCT03547973) is a multicohort, open-label, phase II registrational study. Cohort 1 includes patients with LA or mUC who progressed after platinum- and checkpoint inhibitor-based therapies. SG was administered at 10 mg/kg intravenously on days 1 and 8 of 21-day cycles. The primary endpoint was objective response rate (ORR) per central review; secondary endpoints included progression-free survival, overall survival, and safety. Post hoc safety analyses were exploratory with descriptive statistics. Updated analyses include longer follow-up. RESULTS: Cohort 1 included 113 patients. At a median follow-up of 10.5 months, ORR was 28% (95% CI 20.2% to 37.6%). Median progression-free survival and overall survival were 5.4 months (95% CI 3.5-6.9 months) and 10.9 months (95% CI 8.9-13.8 months), respectively. Occurrence of grade ≥3 treatment-related AEs and treatment-related discontinuation were consistent with prior reports. UGT1A1 status was wildtype (∗1|∗1) in 40%, heterozygous (∗1|∗28) in 42%, homozygous (∗28|∗28) in 12%, and missing in 6% of patients. In patients with ∗1|∗1, ∗1|∗28, and ∗28|∗28 genotypes, any grade treatment-related AEs occurred in 93%, 94%, and 100% of patients, respectively, and were managed similarly regardless of UGT1A1 status. CONCLUSIONS: With longer follow-up, the ORR remains high in patients with heavily pretreated LA or mUC. Safety data were consistent with the known SG toxicity profile. AE incidence varied across UGT1A1 subgroups; however, discontinuation rates remained relatively low for all groups.

Fiber-based sources of coherent MIR radiation: key advances and future prospects (invited).

The mid-infrared (MIR) represents a large portion of the electromagnetic spectrum that is progressively being exploited for an enormous number of applications. Thermal imaging cameras, dental and skin resurfacing lasers, and narcotics detectors at airports are all mainstream examples involving the MIR, but potential applications of MIR technologies are much larger. Accessing the unique opportunities afforded by the MIR is critically dependent on the specific characteristics of MIR emitting sources that become available. In this review, we survey an important enabling technology to the opening up of MIR science and applications, namely that driven by fiber-based sources of coherent MIR radiation. In this review paper, we describe many of the key advances in the innovation and development of such sources over the past few decades and discuss many of the underlying science and technology issues that have resulted in specific recent source achievements, especially in light of new applications enabled by these new source capabilities. We also discuss a few specific anticipated future needs and some potentially disruptive approaches to future MIR fiber source development.

Luminescent ion-doped transparent glass ceramics for mid-infrared light sources [invited].

Glass ceramics (GCs), which consist essentially of a homogeneous solid state dispersion of nanocrystals (NCs) embedded in a chemically inert and mechanically robust glass matrix, appear to be an extremely promising class of solid state materials that can be easily tailored into arbitrary shapes, including a new generation of optical fibers, for efficient incoherent and coherent sources of mid-infrared (MIR) light emission. This unique capability not only stems from the fact that one can tailor the underlying glass matrix for optimal macroscopic physical properties and ultrahigh transparency at the wavelengths of interest (resulting in appropriate "transparent glass ceramics" or TGCs), but also stems from the fact that one can embed these matrices with size and structure-tailored NCs, which in turn can be doped with relatively high concentrations of MIR emitting rare-earth or transition metal ions. This potential is tantamount to the localization of these highly efficient MIR ionic emitters into carefully selected and highly favorable "process-engineered" custom crystalline host "nanocages," while insulating the ionic emitters from the emission-quenching glass host matrix, the latter being chosen largely because of its highly favorable macroscopic bulk properties, including its ductility and formability into near-arbitrary shapes (at appropriate temperatures). Such MIR TGCs appear to be very promising for numerous photonics applications, including compact and relatively efficient waveguide sensors, broadband incoherent MIR light sources, superluminescent light sources, advanced fiber-optic devices, and broadly wavelength-tunable and ultrashort pulse mode-locked fiber and bulk solid-state lasers. In this paper, we review past achievements in this field, starting with an overview of TGCs, followed by discussions of currently preferred methods of fabrication, characterization, and optimization of suitably doped oxyfluoride, tellurite, and chalcogenide TGCs and of our projections of anticipated future developments in this field at both the materials and device levels.

Using opportunistic screening with abdominal CT to identify osteoporosis and osteopenia in patients with diabetes.

Opportunistic osteoporosis screening involves measuring the attenuation of L1 vertebrae on abdominal computed tomography (CT), which correlates with DXA T-score. We found that this approach is useful for detecting low bone mass in patients with diabetes and propose L1 attenuation ≤ 135 Hounsfield units (HU) as a threshold for which DXA should be strongly considered. INTRODUCTION: Attenuation of the L1 vertebrae on computer tomography (CT) images done for other reasons ("Opportunistic Osteoporosis Screening") has been found to correlate well with DXA-derived T-score. However, the method and the thresholds have never been tested specifically in those with diabetes mellitus (DM), in whom the fracture risk is greater than explained by BMD. METHODS: In a retrospective study of subjects with DM who had both abdominal CT and DXA within 6 months of each other, we compared L1 attenuation and DXA T-score to define the sensitivity and specificity of thresholds previously established in the general population. RESULTS: There were 313 subjects among whom 18 (5.8%) had prior major osteoporotic fracture (MOF). Subjects with MOF had lower T-scores (- 2.3 ± 1.4 vs. - 0.9 ± 1.4, p < 0.001) and L1 attenuation (104 HU ± 46 vs. 149 HU ± 47, p < 0.001) than non-fracture subjects. L1 attenuation ≤ 160 HU was 91% sensitive for osteoporosis, while ≤ 110 HU was 80% specific. For a higher T-score of ≤ - 1.5, L1 attenuation ≤ 135 HU showed balanced sensitivity and specificity (65% and 69%, respectively). CONCLUSION: Opportunistic osteoporosis screening with abdominal CT is useful in determining the need for DXA screening in subjects with diabetes. We propose L1 attenuation ≤ 135 HU as a reasonable threshold for detecting the T-score of ≤ - 1.5, which is likely associated with increased fragility in DM.

Potential of in situ SSF laccase produced from Ganoderma lucidum RCK 2011 in biobleaching of paper pulp.

Production of laccase from Ganoderma lucidum RCK 2011 under solid-state fermentation (SSF) conditions was optimized using response surface methodology, resulting in an approximate eightfold increase compared to that in the unoptimized media. Further, the enzyme produced under SSF as whole fermented substrate (in situ SSF laccase) was found to be more stable than the in vitro enzyme (harvested by downstreaming processing of fermented wheat bran). Interestingly, the biobleaching potentials of both in situ and in vitro SSF laccases were comparable, saving 25% chlorine dioxide for achieving similar pulp brightness as obtained in the pulp treated chemically. The reduction in the demand of chlorine dioxide in the pulp bleaching sequence subsequently decreased the levels of adsorbable organic halogen (AOX) in the resulting effluents of the process by 20% compared to the effluents obtained from chemical bleaching sequence. Therefore, direct application of in situ SSF laccase in pulp biobleaching will be environmentally friendly as well as economical and viable for implementation in paper mills.

Association of trabecular bone score (TBS) and prior fracture differs among minorities in NHANES 2005-2008.

The study investigates the association of trabecular bone score (TBS) and fractures among minority populations. In NHANES 2005-2008, TBS was associated with history of fractures in Caucasian subjects but demonstrated somewhat weaker associations in African American and Mexican American women. INTRODUCTION: Trabecular bone score (TBS), a textural analysis of the lumbar spine DXA image, predicts fractures well in Caucasian (CA) and Asian populations but is less well studied in African American (AA) and Mexican American (MA) subjects. It is not clear whether TBS is associated with or is predictive of fragility in these racial/ethnic groups. METHODS: We analyzed data from subjects from NHANES 2005-2008 over the age of 40 who had TBS: 1178 CA, 467 AA, and 397 MA women and 1200 CA, 502 AA, and 386 MA men. TBS was categorized into normal, ≥ 1.310, partially degraded < 1.310, and > 1.230, or degraded, ≤ 1.230. History of fracture was assessed by questionnaire. RESULTS: Among women, there was an increasing prevalence of fracture with worsening TBS category. However, when controlling for age, BMI, and low T-score, the association between TBS category and previous fracture was only significant in CA women (OR 1.49 per worsening category, 95% CI 1.20-1.85). In men, there was also an increase in the prevalence of fracture with worsening TBS category in all races/ethnicities. When controlling for age, BMI, and low T-score, the association between TBS category and previous fracture was only significant in CA men (OR 1.47 per worsening category, 95% CI 1.10-1.95), though analysis was somewhat limited by small fracture numbers. CONCLUSIONS: The association of fracture and TBS varies by race/ethnicity and gender with weaker association observed in AA and MA women. More research is needed to define the proper use of TBS for predicting fractures in minority groups.

African Americans have lower TBS than whites among densitometry patients at a Chicago academic center.

Trabecular bone score, an indirect measure of bone structure, may differ between ethnicities. We found that African Americans had lower trabecular bone score than do whites referred for densitometry, even when controlling for age and abdominal soft tissue thickness. PURPOSE: Trabecular bone score (TBS), an indirect measure of bone structure, has been shown to predict fractures in predominantly white populations. Analysis of NHANES data revealed lower TBS in African Americans than in whites. However, it is not clear if this is true in patients referred for densitometry (where fracture risk stratification is most pertinent) or if ethnic differences in TBS may be related to differences in abdominal soft tissue (tissue thickness), which was not controlled for in the NHANES study. METHODS: We retrospectively analyzed all BMD scans obtained at a university hospital in Chicago between 2011 and 2016. RESULTS: There were 3187 women (51 % African American) and 675 men (32 % African American). African American women were older (69.6 ± 10.4 vs. 64.8 ± 1.3) and heavier (BMI 28.3 ± 4.7 vs. 25.4 ± 4.5) than whites were, while men were of similar age and BMI. African American women had higher T-scores at all sites (the lowest of T-scores, termed LowT, -1.5 ± 1.2 vs. -1.9 ± 1.0, p < 0.001) but lower TBS than white women even when adjusting for age and tissue thickness (1.231 ± 0.130 versus 1.251 ± 0.130, p < 0.001). While LowT was higher in African American men (-1.1 ± 1.2 vs. -1.5 ± 1.4, p < 0.001), TBS was lower than in white men even after adjusting for age and tissue thickness (1.232 ± 0.144 vs. 1.275 ± 0.144, p < 0.001). CONCLUSIONS: African Americans had lower TBS than whites did, even with adjustment for age and tissue thickness. Ethnic differences in TBS should be considered when assessing fracture risk in clinical practice.

Pharmacological Reperfusion Therapy with Tenecteplase in 7,668 Indian Patients with ST Elevation Myocardial Infarction - A Real World Indian Experience.

OBJECTIVE: This real-world, observational, prescription event monitoring study was conducted to evaluate safety and efficacy of indigenous tenecteplase (TNK-tPA) in Indian patients presenting with ST elevation myocardial infarction (STEMI). METHODS: This is a multi-centric, observational, prescription event monitoring study. Data was collected for 7,668 patients from 1,307 investigator sites across India from January 2011 to February 2016. RESULTS: Overall, 76.71% patients were hypertensive, 47.97% patients were diabetic, 42.01% had dyslipidemia, 24.35% had ischemic heart disease and 40.82% patients were smokers. The overall rate for achieving clinically successful thrombolysis by TNK was 93.34%. Delayed administration of tenecteplase yielded lower success rate (84.66%) as against those patients who received tenecteplase within 3 hours of symptoms (94.34%). 93.2% patients had chest pain resolution after pharmacological fibrinolysis. Overall 91.1% patients had 50% resolution of ST elevation at 90 minutes and mean time for 50% ST resolution was 72.06 minutes. Overall 53 patients died (mortality of 0.69%) before discharge. The incidence of bleeding (excluding stroke) was 1.77%, any stroke without ICH was 0.18% and any ICH was 0.38%. CONCLUSION: The findings of this study further reinforce the safety and efficacy of indigenous TNK-tPA in Indian patients presenting with STEMI, including high-risk sub-groups. The study also highlights the importance of early reperfusion therapy.

Engineered single-chain variable fragment antibody for immunodiagnosis of groundnut bud necrosis virus infection.

Few studies have been done on engineered antibodies for diagnosis of tospovirus infections. The present study was undertaken to develop a single-chain variable fragment (scFv) for specific diagnosis of infection by groundnut bud necrosis virus (GBNV), the most prevalent serogroup IV tospovirus in India. Heavy chain (372 nucleotide [nt]) and light chain (363 nt) variable region clones obtained from a hybridoma were used to make an scFv construct that expressed a ~29-kDa protein in E. coli. The scFv specifically detected GBNV in field samples of cowpea, groundnut, mung bean, and tomato, and it did not recognize watermelon bud necrosis virus, a close relative of GBNV belonging to tospovirus serogroup IV. This study for the first time demonstrated the application of a functional scFv against a serogroup-IV tospovirus.

Development of flaxseed fortified rice - corn flour blend based extruded product by response surface methodology.

Flaxseed imparted the evidence of health benefits in human being. Response surface methodology (RSM) was employed to develop flaxseed fortified rice - corn flour blend based extruded product using twin screw extruder. The effect of roasted flaxseed flour (RFF) fortification (15-25 %), moisture content of feed (12-16 %, wb), extruder barrel temperature (120-140 °C) and screw speed (300-330 RPM) on expansion ratio (ER), breaking strength (BS), bulk density (BD) and overall acceptability (OAA) score of extrudates were investigated using central composite rotatable design (CCRD). Increased RFF level decreased the ER and OAA score significantly while increased BS and BD of extrudates (p < 0.01). Moisture content of extruder feed was positively related to ER (p < 0.01) and OAA (p < 0.05) and negatively related to BD (p < 0.01). Extruder barrel temperature was found to be negatively related to ER and OAA (p < 0.05) and positively related to BD (p < 0.1). Quadratic effect of screw speed was significantly positively related to ER (p < 0.01), BS (p < 0.05) and negatively related to BD (p < 0.01). 15 % RFF fortification with rice flour, 16 % moisture content (wb) of extruder feed, 120 °C extruder barrel temperature and 330 RPM of screw speed gave an optimized product of high desirability with corresponding responses as 3.08 ER, 0.53 kgf BS, 0.106 g.cm(-3) BD and 7.86 OAA.

The asparagine residue in the FRNK box of potyviral helper-component protease is critical for its small RNA binding and subcellular localization.

The multifunctional potyviral helper-component protease (HcPro) contains variable regions with some functionally conserved domains, such as the FRNK box. Natural variants occur at the FRNK box, a conserved central domain, known for its role in RNA binding and RNAi suppression activities, although no dominant natural variants for the N(182) residue are known to occur. Here, a mutant at HcPro(N182L) was developed to investigate its role in natural populations. Using in vitro studies, we found an increase in the small RNA (sRNA) binding potential of HcPro(N182L) without affecting its protein-protein interaction properties, suggesting that the presence of N(182) is critical to maintain threshold levels of sRNAs, but does not interfere in the self-interaction of HcPro. Furthermore, we found that expression of HcPro(N182L) in Nicotiana benthamiana affected plant growth. Transient expression of HcPro(N182L) induced reporter gene expression in 16c GFP transgenic plants more than HcPro did, suggesting that replacement of asparagine in the FRNK box favours RNA silencing suppression. HcPro was found to be distributed in the nucleus and cytoplasm, whereas HcPro(N182L) was observed only in cytoplasmic inclusion bodies in N. benthamiana leaves, when fused to a GFP tag and expressed by agro-infiltration, suggesting mutation favours oligomerization of HcPro. These findings suggest that amino acid N(182) of the conserved FRNK box may regulate RNA silencing mechanisms, and is required for maintenance of the subcellular localization of the protein for its multi-functionality. Hence, the N(182) residue of the FRNK box seems to be indispensable for potyvirus infection during evolution.

First Report of Lettuce mosaic virus Infecting Lactuca sativa in India.

In January 2012, lettuce (Lactuca sativa L.) plants (19 out of 38) of one of the accessions (EC687345, variety NVRS-10:001818) exhibiting mild mosaic and stunted growth symptoms were observed at the Indian Agricultural Research Institute (IARI) experimental farm, New Delhi. Similar disease symptoms in lettuce plants in India were previously described (3) and the associated virus was characterized for host range, dilution end point, thermal inactivation point, and longevity in vitro. In this study, definitive molecular evidence is presented for the presence of Lettuce mosaic virus (LMV) infecting lettuce in India. Analysis of preparations from leaves of symptomatic samples with an electron microscope revealed flexuous virus particles measuring 750 × 13 nm, suggesting the association of a potyvirus (4). To identify the potyvirus infecting these lettuce plants, the 3' terminal portion of the genome including the part of the nuclear inclusion b (NIb), complete coat protein (CP) region, and 3' untranslated region (UTR) was amplified by RT-PCR, cloned, and sequenced. Total RNA was extracted from infected leaves using an RNeasy Plant Mini Kit (Qiagen, Valencia, CA) and subjected to RT-PCR using potyvirus specific forward (5' ACCACAGGATCCGGBAAYAAYAGYGGDCARCC 3') and reverse (5' CACGGATCCCGGG(T17)V 3') primers (2). PCR products (~1.8 kb) were cloned into pGEM-T Easy vector (Promega, Madison, WI) and sequenced (GenBank Accession No. JQ794776). Sequence comparisons revealed the CP of the virus infecting lettuce (834 bp) shared 96 to 100% nucleotide and deduced amino acid sequence identity with the corresponding regions of LMV isolates AJ306288 and AJ297630 from the United Kingdom, CAA46603 and NC003605 from the United States, AJ278854 and AJ278854 from Brazil, and AJ488153 from China, thus complying with the cut off range of 90 to 99% for identifying isolates/strains of the same virus (1). Similarly, 99 to 100% nucleotide sequence identity was observed with the corresponding region of the 3'UTR (245 bp) while 93 to 96% nucleotide identity of NIb region (654 bp) with LMV isolates. These results confirm that the virus infecting the symptomatic lettuce plants was an isolate of LMV. The amino acid sequences (DAG and WCIEN) conserved among majority of potyviruses were also present. Since the virus is aphid transmissible, its natural infection on other hosts and spread can't be ruled out. References: (1) M. J. Adams et al. Arch Virol. 150:459, 2005. (2) A. Gibbs and A. Mackenzie. J. Virol. Methods 63:9, 1997. (3) T. K. Nariani and P. S. Pathanian. Indian Phytopathol. 13:172, 1960. (4) D. D. Shukla et al. The Potyviridae, page 338, 1994.

Pharmacologic reperfusion therapy with indigenous tenecteplase in 15,222 patients with ST elevation myocardial infarction - the Indian Registry.

OBJECTIVE: To study the efficacy and safety of single intravenous bolus administration of indigenously developed tenecteplase (TNK-tPA) in the management of patients with ST-elevation myocardial infarction (STEMI) in clinical practice. METHODS: Observational, prescription-event monitoring study. RESULTS: Data of 15,222 patients who had STEMI and received weight adjusted TNK injection was analyzed. Overall 95.43% patients had clinically successful thrombolysis (CST). In the different subgroups, hypertensives, diabetics, smokers and hyperlipidemic patients had CST rates comparable to the general patient data. CST rates were significantly lower in the elderly patients (>70 years; 92.11%; p < 0.0001), in patients with history of Ischemic Heart Disease (IHD, 93.86%; p = 0.0004) and in patients receiving delayed treatment (>6 h after onset of chest pain; 85.38%; p < 0.0001). CST was significantly higher in patients who received an early thrombolysis (<3 h after onset of chest pain; 96.54%; p = 0.006). Overall mortality was 1.69%, while it was significantly higher in the elderly (4.42%), patients with history of IHD (2.67%), females (2.93%) and in those who received delayed treatment (4.98%). The overall incidences of intracranial hemorrhage (ICH), bleeding excluding ICH, stroke and ventricular tachyarrhythmia were 0.39%, 2.01%, 0.16% and 2.35% respectively. Age >70 years, diabetes, hyperlipidemia and history of IHD were associated with a higher incidence of heart failure, myocardial re-infarction or ventricular tachyarrhythmias. However, incidence of ICH and bleeding other than ICH was comparable amongst all patient subgroups. CONCLUSION: This study confirms the safety and efficacy of indigenous tenecteplase in Indian patients with STEMI, including high risk subgroups. It also highlights the fact that delayed treatment denotes denial of benefits of pharmacologic reperfusion therapy.

Study on incidence of bleeding in hospitalized patients after antithrombotic therapy at a tertiary care hospital.

OBJECTIVES: To monitor the different antithrombotic drug combinations, determine the incidence, magnitude of bleeding and the association of HAS-BLED risk scoring schema with the magnitude of bleeding as defined using TIMI bleeding criteria. METHODS: A prospective observational study in a cohort of patients for a period of 8 months, at one of the tertiary care center-Krishna Institute of Medical Sciences, Hyderabad, was conducted. Consecutive patients were enrolled and followed from the date of admission till the adverse events are perceived/date of discharge. Pearson Correlation Statistics (Fisher's z Transformation) is applied to assess the association between HAS-BLED risk factors and the total risk score with bleeding criteria. RESULTS: A total of 400 cases were collected during the 8-month study period, of which 372 satisfied the inclusion criteria. Among them 34 (9.1%) bleeding cases were reported with mean (+/- SD) age of 57.8 (+/- 14.19) years. Bleeding occurred mostly in males 79.4% and a HAS-BLED Score of > or = 3 has been observed in 67.6% (n = 23) patients out of 34 bled patients. Two antiplatelets + One anticoagulant is the most common combination which caused bleeding in 41.2% (n = 14). Stroke history, bleeding predisposition, labile INR's are the HAS-BLED risk factors which are significant (< 0.05) with the TIMI Bleeding Criteria. CONCLUSION: There was a linear correlation between the HAS-BLED risk score and the TIMI bleeding criteria-higher the risk score the more frequent is the incidence of major bleeding. A HAS-BLED risk score of > or = 3 is associated with TIMI major bleeding.

First Report of Grapevine leafroll-associated virus 1 Infecting Grapevines in India.

Viticulture, one of the most remunerative farming enterprises of India, is seriously affected by leafroll disease, which accounts for 62% of the losses in grape production worldwide due to viral diseases (4). Grapevine leafroll-associated virus 3 and 1 (GLRaV-3 and GLRaV-1) of the family Closteroviridae are the two most common viruses associated with the leafroll disease of grapevine (1). GLRaV-3 was previously confirmed in India through RT-PCR, cloning, and sequencing (2). A survey was conducted during 2010 and 2011 in the Nashik and Pune regions of western India and reddening of interveinal areas and downward rolling, typical symptoms of leafroll disease in dark fruited cultivars, were observed, first in 2010 and subsequently in 2011. Fourteen leafroll symptomatic samples from seven cultivars of seven vineyards were collected during 2011. Samples were subjected to double antibody sandwich (DAS)-ELISA using commercially available antibodies against GLRaV-3 and GLRaV-1 (Bioreba, Reinach, Switzerland) (2). An asymptomatic sample from another cultivar of a different vineyard and samples from two plantlets of two different cultivars produced in tissue culture were used as negative controls. GLRaV-1 was detected in two cultivars, Shiraj (Nashik region) and Pinot Noir (Pune region) using DAS-ELISA. GLRaV-1 was detected either alone in cultivar Pinot Noir or as mixed infection with GLRaV-3 in cultivar Shiraj. To further confirm the presence of GLRaV-1 in these two cultivars, crude extract from petioles of these two cultivars were subjected to one step reverse transcription (RT)-PCR using GLRaV-1 specific primers pORF9F and pORF9R (GGCTCGAGATGGCGTCACTTATACCTA and CCTCTAGACACCAAATTGCTAGCGA, respectively) (3). The ˜650 bp amplicons were cloned in pGEM-T easy vector and three independent clones of each amplicon were sequenced in both directions. The cloned amplified product was 646 bp, including 630 bp of p24 protein (ORF9) of GLRaV-1. Comparative sequence analysis, using the BioEdit 7.0.3 program ( http://www.mbio.ncsu.edu/BioEdit/BioEdit.html ), of ORF9 of the virus under study from the cultivars Pinot Noir and Shiraj shared maximum sequence identity of 95.8 and 96.1%, respectively, at the nucleotide level with the Clatervine isolate from the United States (GenBank Accession No. HQ833477). The corresponding values of maximum identities at the amino acid level were 96.6 and 96.1%, respectively, with the same Clatervine isolate. The maximum identity between these two isolates of GLRaV-1 was 96.1% at nucleotide level and 95.7% at amino acid level. To the best of our knowledge, this study represents the first report of GLRaV-1 from India. Grape production in India could be impacted by this virus; thus, identification of the virus is important. References: (1) B. Akbas et al. Hort. Sc. (Prague). 36: 97, 2009. (2) S. Kumar et al. Virus Genes. 45:195, 2012. (3) A. Little and M. A. Rezaian. Arch. Virol. 151:753, 2006. (4) A. Little et al. Virus Res. 80:109, 2001.

First Report of Groundnut bud necrosis virus in Tomato in Bangladesh.

An unusual disease of tomato characterized by leaf mottling and necrotic streaks on veins, shortened internodes, necrosis of terminal buds, and concentric rings on fruits was observed during 2010 to 2011 surveys in tomato growing regions of Godagari Upzila, Rajshahi district, Bangladesh. Disease incidence in popularly grown F1 hybrid cultivars, which include Sobal, Abhiruchi, Salamat, Bangobir, and BARI hybrid tomato-5 and -6 in about 40 commercial fields, ranged from 40 to 90%. Extracts from the field samples (n = 10) reacted with polyclonal antiserum to Groundnut bud necrosis virus (GBNV) in direct antigen coated ELISA, suggesting the association of a tospovirus antigenically related to serogroup IV topsovirus (1). To identify whether the tospovirus was a distinct virus species, ELISA-positive samples were subjected to total RNA extraction with an RNeasy Plant Mini Kit (Qiagen, Chatsworth, CA) followed by reverse transcription (RT)-PCR with tospovirus-specific primers (5'-ATGGTTGAAAAGAGCAAGAATGATGC-3') and degenerate primer (5'-CTTCTTATGAAGTGTACTCACCATAAGTCATCC-3') derived from the conserved sequences of GBNV, Watermelon bud necrosis virus (WBNV), and Capsicum chlorosis virus (CaCV) (2). The RT-PCR product was cloned into pGEM-T Easy vector (Promega, Madison, WI) and sequenced at Department of Biochemistry, University of Delhi, South Campus, Delhi, India (GenBank Accession No. JQ692083). The sequences of cloned fragments were assembled. Analysis of the 477-bp region of the nucleocapsid protein (N) gene revealed that the tomato tospovirus shared maximum identity both at the nucleotide (96%) and amino acid (97%) levels with the corresponding region of GBNV. In contrast, only 78 to 81% and 85 to 87% identity at nucleotide and amino acid levels, respectively, was observed with the corresponding region of the N genes of CaCV, WBNV, and Watermelon silver mottle virus. These results suggested the association of GBNV with the diseased tomato samples. To our knowledge, this is the first report of GBNV infecting tomato in Bangladesh and regular surveys are necessary to ascertain the prevalence and incidence of GBNV in other crops. References: (1) R. K. Jain et al. J. Virol. Methods 130:162, 2005. (2) M. Tsompana and J. W. Moyer. Tospovirus. Page 157 in: Encyclopedia of Virology. Academic Press, New York, 2009.

Aerobic rice genotypes displayed greater adaptation to water-limited cultivation and tolerance to polyethyleneglycol-6000 induced stress.

Water scarcity and drought have seriously threatened traditional rice cultivation practices in several parts of the world including India. In the present investigation, experiments were conducted to see if the water-efficient aerobic rice genotypes developed at UAS, Bangalore (MAS25, MAS26 and MAS109) and IRRI, Philippines (MASARB25 and MASARB868), are endowed with drought tolerance or not. A set of these aerobic and five lowland high-yielding (HKR47 and PAU201, Taraori Basmati, Pusa1121 and Pusa1460) indica rice genotypes were evaluated for: (i) yield and yield components under submerged and aerobic conditions in field, (ii) root morphology and biomass under aerobic conditions in pots in the nethouse, (iii) PEG-6000 (0, -1, -2 and -3 bar) induced drought stress at vegetative stage using a hydroponic culture system and (iv) polymorphism for three SSR markers associated with drought resistance traits. Under submerged conditions, the yield of aerobic rice genotypes declined by 13.4-20.1 % whereas under aerobic conditions the yield of lowland indica/Basmati rice varieties declined by 23-27 %. Under water-limited conditions in pots, aerobic rice genotypes had 54-73.8 % greater root length and 18-60 % higher fresh root biomass compared to lowland indica rice varieties. Notably, root length of MASARB25 was 35 % shorter than MAS25 whereas fresh and dry root biomass of MASARB25 was 10 % and 64 % greater than MAS25. The lowland indica were more sensitive to PEG-stress with a score of 5.9-7.6 for Basmati and 6.1-6.7 for non-aromatic indica rice varieties, than the aerobic rice genotypes (score 2.7-3.3). A set of three microsatellite DNA markers (RM212, RM302 and RM3825) located on chromosome 1 which has been shown to be associated with drought resistance was investigated in the present study. Two of these markers (RM212 and RM302) amplified a specific allele in all the aerobic rice genotypes which were absent in lowland indica rice genotypes.

Identifying high risk patients post myocardial infarction with reduced left ventricular function using loop recorders INSPIRE-ELR clinical study.

AIMS: Sudden cardiac death (SCD) continues to be a devastating complication amongst survivors of myocardial infarction (MI). Mortality is high in the initial months after MI. The aims of the INSPIRE-ELR study were to assess the proportion of patients with significant arrhythmias early after MI and the association with mortality during 12 months of follow-up. METHODS: The study included 249 patients within 14 days after MI with left ventricular ejection fraction (LVEF) ≤35% at discharge in 11 hospitals in India. Patients received a wearable external loop recorder (ELR) 5 ± 3 days after MI to monitor arrhythmias for 7 days. RESULTS: Patients were predominantly male (86%) with a mean age of 56 ± 12 years. In 82%, reperfusion had been done and all received standard of care cardiovascular medications at discharge. LVEF was 32.2 ± 3.9%, measured 5.1 ± 3.0 days after MI. Of the 233 patients who completed monitoring (7.1 ± 1.5 days), 81 (35%) experienced significant arrhythmias, including Ventricular Tachycardia/Fibrillation (VT/VF): 10 (4.3%); frequent Premature Ventricular Contractions (PVCs): 65 (28%); Atrial Fibrillation (AF): 8 (3.4%); chronic atrial flutter: 4 (1.7%); 2nd or 3rd degree Atrioventricular (AV) block: 4 (1.7%); and symptomatic bradycardia: 8 (3.4%). In total, 26 patients died. Mortality was higher in patients with clinically significant arrhythmia (at 12 months: 23.6% vs 4.8% with 19 vs 7 deaths, hazard ratio (HR) = 5.5, 95% confidence interval (CI) 2.3 to 13.0, p < 0.0001). Excluding 7 deaths during ELR monitoring, HR = 4.5, p < 0.001. CONCLUSION: ELR applied in patients with acute MI and LV dysfunction at the time of discharge identifies patients with high mortality risk.

Novel pathway for the degradation of 2-chloro-4-nitrobenzoic acid by Acinetobacter sp. strain RKJ12.

The organism Acinetobacter sp. RKJ12 is capable of utilizing 2-chloro-4-nitrobenzoic acid (2C4NBA) as a sole source of carbon, nitrogen, and energy. In the degradation of 2C4NBA by strain RKJ12, various metabolites were isolated and identified by a combination of chromatographic, spectroscopic, and enzymatic activities, revealing a novel assimilation pathway involving both oxidative and reductive catabolic mechanisms. The metabolism of 2C4NBA was initiated by oxidative ortho dehalogenation, leading to the formation of 2-hydroxy-4-nitrobenzoic acid (2H4NBA), which subsequently was metabolized into 2,4-dihydroxybenzoic acid (2,4-DHBA) by a mono-oxygenase with the concomitant release of chloride and nitrite ions. Stoichiometric analysis indicated the consumption of 1 mol O(2) per conversion of 2C4NBA to 2,4-DHBA, ruling out the possibility of two oxidative reactions. Experiments with labeled H(2)(18)O and (18)O(2) indicated the involvement of mono-oxygenase-catalyzed initial hydrolytic dechlorination and oxidative denitration mechanisms. The further degradation of 2,4-DHBA then proceeds via reductive dehydroxylation involving the formation of salicylic acid. In the lower pathway, the organism transformed salicylic acid into catechol, which was mineralized by the ortho ring cleavage catechol-1,2-dioxygenase to cis, cis-muconic acid, ultimately forming tricarboxylic acid cycle intermediates. Furthermore, the studies carried out on a 2C4NBA(-) derivative and a 2C4NBA(+) transconjugant demonstrated that the catabolic genes for the 2C4NBA degradation pathway possibly reside on the ∼55-kb transmissible plasmid present in RKJ12.

Interstitial pH and pO2 gradients in solid tumors in vivo: high-resolution measurements reveal a lack of correlation.

The partial pressure of oxygen (pO2) and pH play critical roles in tumor biology and therapy. We report here the first combined, high-resolution (< or = 10 microns) measurements of interstitial pH and pO2 profiles between adjacent vessels in a human tumor xenograft, using fluorescence ratio imaging and phosphorescence quenching microscopy. We found (1) heterogeneity in shapes of pH and pO2 profiles; (2) a discordant relation between local pH profiles and corresponding pO2 profiles, yet a strong correlation between mean pH and pO2 profiles; (3) no correlation between perivascular pH/pO2 and nearest vessel blood flow; and (4) well-perfused tumor vessels that were hypoxic and, consequently, large hypoxic areas in the surrounding interstitium. Such multiparameter measurements of the in vivo microenvironment provide unique insights into biological processes in tumors and their response to treatment.