Reexamining the effects of drug loading on the in vivo performance of PEGylated liposomal doxorubicin.

Higher drug loading employed in nanoscale delivery platforms is a goal that researchers have long sought after. But such viewpoint remains controversial because the impacts that nanocarriers bring about on bodies have been seriously overlooked. In the present study we investigated the effects of drug loading on the in vivo performance of PEGylated liposomal doxorubicin (PLD). We prepared PLDs with two different drug loading rates: high drug loading rate, H-Dox, 12.9% w/w Dox/HSPC; low drug loading rate, L-Dox, 2.4% w/w Dox/HSPC (L-Dox had about 5 folds drug carriers of H-Dox at the same Dox dose). The pharmaceutical properties and biological effects of H-Dox and L-Dox were compared in mice, rats or 4T1 subcutaneous tumor-bearing mice. We showed that the lowering of doxorubicin loading did not cause substantial shifts to the pharmaceutical properties of PLDs such as in vitro and in vivo stability (stable), anti-tumor effect (equivalent effective), as well as tissue and cellular distribution. Moreover, it was even more beneficial for mitigating the undesired biological effects caused by PLDs, through prolonging blood circulation and alleviating cutaneous accumulation in the presence of pre-existing anti-PEG Abs due to less opsonins (e.g. IgM and C3) deposition on per particle. Our results warn that the effects of drug loading would be much more convoluted than expected due to the complex intermediation between nanocarriers and bodies, urging independent investigation for each individual delivery platform to facilitate clinical translation and application.

First report of the maize cyst nematode Heterodera zeae in Sichuan Province of Southwest China.

Maize is the largest crop planted in China. Nine species of cyst nematodes have been reported to affect maize production. Heterodera zeae, H. avenae and Punctodera chalcoensis can cause significant maize yield losses annually (Luc et al. 2005). In 1971, the maize cyst nematode H. zeae was first detected in Rajasthan, India (Koshy et al. 1971). Subsequently, it has been reported in many other countries such as the United States, Greece, Pakistan, and Egypt. In China, H. zeae was first identified in the maize fields of Laibin City, Guangxi Zhuang Autonomous Region (Wu et al., 2017). Cui et al. (2020) identified H. zeae in a maize field of Yuzhou City, Henan Province of Central China in 2018. From 2018 to 2022, a survey of cyst-forming nematodes was conducted in Southwest China. Fifteen soil samples of about 500 g each were collected from Luding County, Ganzi Prefecture of Sichuan Province. No major aboveground symptoms were shown on maize, but a few females were observed on the roots of maize in one field. The cysts and second-stage juveniles (J2s) were collected from each soil sample using Cobb's screening gravity method. A total of 8.50±2.0 cysts per 100 ml of soil on the average were observed in the field. A thin subcrystalline layer was discernible only in young cysts. Morphological and molecular studies of cysts and J2s indicated that the nematodes were identified to be H. zeae in a maize-field. Morphologically, the cysts were in a lemon shape, light brown or pearly white in color. The vulval cone was prominent. Fenestra ambifenestrate, and semifenestra were separated by a fairly wide vulval bridge, fenestral length and width were variable, and the cyst wall was shown in a zigzag pattern. The J2s' body was in a vermiform, tapering at both ends, with a hyaline tail. Stylet was strongly developed with round or slightly anteriorly directed knobs. Morphological measurements of the cysts (n = 9) determined that the mean body length was 417.2 µm (403.6 to 439.4 µm), body width was 429.7 µm (397.6 to 456.9µm); length-width ratio was 1.4 (0.75 to 3); fenestra length was 525.3 µm (498.5 to 570.7 µm); and the mean semifenestra width was 458.6 µm (403.6 to 546.3 µm). Morphometric measurements of second-stage juveniles (n = 20) showed a body length of 419.7µm (355.8 to 492.5 µm); a stylet length of 20.8 µm (19.51 to 23.3µm); a tail length of 41.5 µm (20 to 49.4 µm); and a hyaline tail length of 20.7 µm (16.6 to 24 µm). The main morphological characteristics and measured values were basically consistent with those described by Cui et al. (2022), and all of which were similar to those of H. zeae. Amplification of DNA from random single cysts (n = 5) was conducted using the protocol described by Cui et al. (2022). The rDNA-internal transcribed spacer (ITS) was amplified and sequenced using a pair of universal primers TW81 (5'-GTTTCCGTAGGTGAA CCTGC-3') and AB28 (5'-ATATGCTTAAGTTCAGCGGGT-3'). The ITS sequences were deposited at GenBank with the accession number OR811029.1. Alignments of sequences showed an identity of 98% with H. zeae sequences from China (OP692769.2, MW785772.1) and the USA (GU145616.1), which were confirmed using a pair of species-specific primers HzF1 (5'-GGGGAGGTGAATGTGGG-3') and HzR1 (5'-CCTTTGGCAATCGGTGA-3') of H. zeae with a targeted PCR fragment of 393 bp (Cui et al. 2022). Pathogenicity was conducted and confirmed by infection and reproduction on maize. Seeds (cv. Zhengda 619) were sown in three pots that contained 150 ml of a sterile soil mixture (loamy soil: sand=1:1), and 5 cysts (103 eggs/cyst on the average) were inoculated in each pot at 25/30°C, under a 12-h dark/12-h light condition (Cui et al. 2023). Fifteen days after sowing, third- and fourth-stage juveniles were observed in the rootstained with acid fuchsin, and a total of 32 cysts per maize plant on the average were collected at 40 days after sowing. The new cysts' morphological and molecular characteristics were identical to the cysts from the original soil samples. To the best of our knowledge, this is the first report of H. zeae as a pathogen on maize in Sichuan Province, Southwest China. Our findings will be useful for management and further research of maize cyst nematodes.

First record of cyst nematode (Heterodera filipjevi) on winter wheat from Shanxi Province in North China.

Heterodera avenae, H. filipjevi, and H. laptipons are considered to be the major cyst nematode pathogens affecting most cereals and causing severe crop losses (Smiley and Yan 2015). In China, H. filipjevi was first recorded in Xuchang, Henan Province (Peng et al. 2010). Recently, H. filipjevi has been found in Anhui, Hebei, Shandong and Xinjiang provinces of China (Cui et al. 2021). To further understand the latest occurrence and distribution of H. filipjevi in China, a survey of cyst nematodes was conducted in the wheat planting area of Shanxi Province of North China from June 2018 to November 2020. White female cysts (5.8 ± 2.99 cysts per plant) were found on wheat roots in the sandy soil, and wheat was displaying symptoms of dwarfing, yellowing, and had few tillers in Licheng of Changzhi (N36°32´010´´, E113°27´039´´; N36°29´050´´, E113°23´023´´; N36°29´035´´, E113°22´020´´) and Zezhou of Jincheng (N35°33´057´´, E112°56´020´´) in Shanxi Province, and second-stage juveniles (J2s) were obtained from 13 soil samples using the sieving-decanting method. Four of the 13 samples were identified as H. filipjevi on the basis of morphological and molecular studies of female cysts and J2s. Morphologically, the cysts were lemon shaped and featured a pronounced vulval cone. The color ranged from light to dark brown. The white female shell was covered with a white crystalline layer. The vulval cone was bifenestrate with horseshoe-shaped bullae numerous and distinct, and a strongly developed underbridge. The main measurements (mean ± SD, range) of cysts (n = 13) were as follows: body length including neck 780.5 ± 53.9 µm (692 to 843 µm); body width 527.3 ± 55.5 µm (435 to 620 µm); length/width ratio 1.50 ± 0.21 (1.20 to 1.93); fenestra length 55.5 ± 4.1 µm (49 to 61 µm); fenestra width 24.8 ± 2.2 µm (21.1 to 28.8 µm); vulval slit length 9.0 ± 0.7 µm (7.8 to 9.6 µm); and underbridge length 66.8 ± 5.0 µm (61 to 77 µm). The measurements of J2s (n = 13) were as follows: body length 554.4 ± 23.4 µm (520to 587 µm); stylet length 22.7 ± 0.7 µm (21.5 to 23.8 µm); tail length 61.0 ± 5.5 µm (51.2 to 68.9 µm); and hyaline tail terminus length 37.3 ± 2.7 µm (33.4 to 42.3 µm). These morphological measurements are within the range characteristic of H. filipjevi (Peng et al. 2010). Genomic DNA was extracted from individual cyst (n = 6) and the rDNA internal transcribed spacer (ITS) sequence was amplified using the universal primers TW81 and AB28 (Joyce et al. 1994). The PCR test for each sample was repeated five times. The obtained ITS sequences (GenBank accession No. OQ421499 to OQ421502, 1054 bp) showed more than 99.5% similarity to those of H. filipjevi from the United States (GU079654 and KP878490), Turkey (KR704304 and KR704292), and China (MW789611, KY448473 and KT314234). The results were confirmed again by the species-specific primers HfF1 and HfR1of H. filipjevi and the target PCR fragments of 646 bp were obtained (Peng et al. 2013). The pathogenicity of H. filipjevi was verified by infesting winter wheat (Triticum aestivum 'Wenmai 19') and studying nematode developmentand reproduction with growth chamber (Cui et al. 2015). Eggs were hatched at 14-16°C, and freshly hatched J2s were used to inoculate wheat plants when the roots were approximately 1-centimeter long. Fifteen wheat plants were inoculated with 200 J2s, and three wheat plants without J2s were set as controls (Cui et al. 2021). Parasitic J2s and third- and fourth-stage juveniles were found in roots stained with acid fuchsin at 5, 15, and 25 days after inoculation (DAI), adult females were detected at 50 DAI, and a mean of 23.7 cysts per pot were extracted at 70 DAI (Cui et al. 2015). The morphological and molecular characteristics of the new cysts were identical to those of the H. filipjevi cysts from the original field samples, and no cysts formed in the control groups. Wheat is the main food and economic crop in Shanxi, and H. filipjevi, a potential threat to cereal crop production in Shanxi, should arouse sufficient attention. H. filipjevi is major cyst nematode pathogens of wheat and shows high prevalence in China. The loss of wheat production due to H. filipjevi is as high as 32.3% when the initial density ≥ 64 eggs/mL in soil (Li 2018). To the best of our knowledge, this is the first report of H. filipjevi in Shanxi Province of North China.

Does This Child With High Blood Pressure Have Secondary Hypertension?: The Rational Clinical Examination Systematic Review.

Importance: Guidelines recommend that all children and adolescents with hypertension undergo evaluation for secondary causes. Identifying clinical factors associated with secondary hypertension may decrease unnecessary testing for those with primary hypertension. Objective: To determine the utility of the clinical history, physical examination, and 24-hour ambulatory blood pressure monitoring for differentiating primary hypertension from secondary hypertension in children and adolescents (aged ≤21 years). Data Sources and Study Selection: The databases of MEDLINE, PubMed Central, Embase, Web of Science, and Cochrane Library were searched from inception to January 2022 without language limits. Two authors identified studies describing clinical characteristics in children and adolescents with primary and secondary hypertension. Data Extraction and Synthesis: For each clinical finding in each study, a 2 × 2 table was created that included the number of patients with and without the finding who had primary vs secondary hypertension. Risk of bias was assessed using the Quality Assessment of Diagnostic Accuracy Studies tool. Main Outcomes and Measures: Random-effects modeling was used to calculate sensitivity, specificity, and likelihood ratios (LRs). Results: Of 3254 unique titles and abstracts screened, 30 studies met inclusion criteria for the meta-analysis and 23 (N = 4210 children and adolescents) were used for pooling in the meta-analysis. In the 3 studies conducted at primary care clinics or school-based screening clinics, the prevalence of secondary hypertension was 9.0% (95% CI, 4.5%-15.0%). In the 20 studies conducted at subspecialty clinics, the prevalence of secondary hypertension was 44% (95% CI, 36%-53%). The demographic findings most strongly associated with secondary hypertension were family history of secondary hypertension (sensitivity, 0.46; specificity, 0.90; LR, 4.7 [95% CI, 2.9-7.6]), weight in the 10th percentile or lower for age and sex (sensitivity, 0.27; specificity, 0.94; LR, 4.5 [95% CI, 1.2-18]), history of prematurity (sensitivity range, 0.17-0.33; specificity range, 0.86-0.94; LR range, 2.3-2.8), and age of 6 years or younger (sensitivity range, 0.25-0.36; specificity range, 0.86-0.88; LR range, 2.2-2.6). Laboratory studies most associated with secondary hypertension were microalbuminuria (sensitivity, 0.13; specificity, 0.99; LR, 13 [95% CI, 3.1-53]) and serum uric acid concentration of 5.5 mg/dL or lower (sensitivity range, 0.70-0.73; specificity range, 0.65-0.89; LR range, 2.1-6.3). Increased daytime diastolic blood pressure load combined with increased nocturnal systolic blood pressure load on 24-hour ambulatory blood pressure monitoring was associated with secondary hypertension (sensitivity, 0.40; specificity, 0.82; LR, 4.8 [95% CI, 1.2-20]). Findings associated with a decreased likelihood of secondary hypertension were asymptomatic presentation (LR range, 0.19-0.36), obesity (LR, 0.34 [95% CI, 0.13-0.90]), and family history of any hypertension (LR, 0.42 [95% CI, 0.30-0.57]). Hypertension stage, headache, and left ventricular hypertrophy did not distinguish secondary from primary hypertension. Conclusions and Relevance: Family history of secondary hypertension, younger age, lower body weight, and increased blood pressure load using 24-hour ambulatory blood pressure monitoring were associated with a higher likelihood of secondary hypertension. No individual sign or symptom definitively differentiates secondary hypertension from primary hypertension.

CHK2 activation contributes to the development of oxaliplatin resistance in colorectal cancer.

BACKGROUND: Colorectal cancer (CRC), the most common cancer type, causes high morbidity and mortality. Patients who develop drug resistance to oxaliplatin-based regimens have short overall survival. Thus, identifying molecules involved in the development of oxaliplatin resistance is critical for designing therapeutic strategies. METHODS: A proteomic screen was performed to reveal altered protein kinase phosphorylation in oxaliplatin-resistant (OR) CRC tumour spheroids. The function of CHK2 was characterised using several biochemical techniques and evident using in vitro cell and in vivo tumour models. RESULTS: We revealed that the level of phospho-CHK2(Thr68) was elevated in OR CRC cells and in ~30% of tumour samples from patients with OR CRC. We demonstrated that oxaliplatin activated several phosphatidylinositol 3-kinase-related kinases (PIKKs) and CHK2 downstream effectors and enhanced CHK2/PARP1 interaction to facilitate DNA repair. A phosphorylation mimicking CHK2 mutant, CHK2T68D, but not a kinase-dead CHK2 mutant, CHK2D347A, promoted DNA repair, the CHK2/PARP1 interaction, and cell growth in the presence of oxaliplatin. Finally, we showed that a CHK2 inhibitor, BML-277, reduced protein poly(ADP-ribosyl)ation (PARylation), FANCD2 monoubiquitination, homologous recombination and OR CRC cell growth in vitro and in vivo. CONCLUSION: Our findings suggest that CHK2 activity is critical for modulating oxaliplatin response and that CHK2 is a potential therapeutic target for OR CRC.

Prevalence of Secondary Hypertension in Otherwise Healthy Youths with a New Diagnosis of Hypertension: A Meta-Analysis.

OBJECTIVE: To estimate the prevalence of secondary hypertension among otherwise healthy children with hypertension diagnosed in the outpatient setting. STUDY DESIGN: The MEDLINE, PubMed Central, Embase, Web of Science, and Cochrane Library databases were systematically searched for observational studies reporting the prevalence of secondary hypertension in children who underwent evaluation for hypertension and had no known comorbidities associated with hypertension at the time of diagnosis. Two authors independently extracted the study-specific prevalence of secondary hypertension in children evaluated for hypertension. Prevalence estimates for secondary hypertension were pooled in a random-effects meta-analysis. RESULTS: Nineteen prospective studies and 7 retrospective studies including 2575 children with hypertension were analyzed, with a median of 65 participants (range, 9-486) in each study. Studies conducted in primary care or school settings reported a lower prevalence of secondary hypertension (3.7%; 95% CI, 1.2%-7.2%) compared with studies conducted in referral clinics (20.1%; 95% CI, 11.5%-30.3%). When stratified by study setting, there were no significant subgroup differences according to study design, country, participant age range, hypertension definition, blood pressure device, or study quality. Although the studies applied different approaches to diagnosing secondary hypertension, diagnostic evaluations were at least as involved as the limited testing recommended by current guidelines. CONCLUSIONS: The low prevalence of secondary hypertension among children with a new diagnosis of hypertension identified on screening reinforces clinical practice guidelines to avoid extensive testing in the primary care setting for secondary causes in most children with hypertension.

First report of the root-knot nematode Meloidogyne incognita on Salvia miltiorrhiza Bunge in Henan Province, China.

Salvia miltiorrhiza Bunge is an important Chinese herbal medicine, mainly used to treat cardiovascular disease. At present, the planting area of S. miltiorrhiza is near 20,000 hectares in China, mainly in Shandong, Henan, Shanxi, Shaanxi and Sichuan provinces. Root-knot nematode (Meloidogyne spp.) is one of the most devastating pathogens on S. miltiorrhiza. In November 2020, we observed that some S. miltiorrhiza plants grew poorly with smaller, fewer and chlorotic leaves and even necrosis on some middle and lower ones in a Chinese herbal medicine planting base (34° 4' 11.52'' N; 113° 25' 51.40'' E) in Yuzhou City, Henan Province, China. Furthermore, the galls and egg masses were visible on the roots of S. miltiorrhiza, which were the typical symptoms caused by root-knot nematodes. Ten samples of galled roots and rhizosphere soils were collected, bagged and taken to the lab for tests. Females and J2s were extracted from these samples. White, pear-shaped females were observed in the roots, and the average number of second-stage juveniles (J2s) was 121.5 ± 10.8 per 100 ml of soil. The perineal patterns of females showed a high dorsal arch, which was either square or trapezoid with either smooth or wavy striae and without obvious lateral lines. The main morphometrics of females (n=20, mean ± SE; range) were as follows: body length (L)  = 609.0  ±â€¯ 62.5 µm (492.4 to 716.4 µm); maximum body width (W) = 377.0  ±â€¯ 28.6 µm (329.7 to 436.1 µm); stylet length  =  17.0  ±â€¯ 1.8 µm (14.2 to 20.5 µm); and distance from dorsal esophageal gland orifice to stylet knobs (DGO) =  3.3  ±â€¯ 0.3 µm (2.8 to 3.9 µm). The J2s were in vermiform, and stylet knobs were prominent and rounded. The tail of J2s possessed a transparent area with an obtuse tip. J2s (n  =  20) were measured (mean ± SD; range) as follows: L  =  401.2  ±â€¯ 29.3 µm (358.2 to 456.1 µm); W = 14.1 ± 1.1 µm (12.5 to 16.0 µm); L/W  = 28.6  ±â€¯ 1.0 (26.7 to 30.4); stylet length =  10.3  ±â€¯ 0.6 µm (9.1 to 11.2 µm); DGO  =  2.4  ±â€¯ 0.1 µm (2.1 to 2.6 µm); and tail length  =  49.3  ± 2.8 µm (45.2 to 54.7 µm). All the key morphometrics were similar to those of the M. incognita population described by Song et al. (2019). The PCR amplifications of rDNA-internal transcribed spacer (ITS) fragments generated an amplicon of 544 bp from a single female or/and J2s (n = 22) using the universal primers M18S (5'-AACCTGCTGCTGGATCATTAC-3') and M28S (5'-GTATGCTTAAGTTCAGCG-3') (Feng et al. 2010). The PCR amplifications were repeated five times for each sample, and the products were purified and sequenced. The obtained sequnce was deposited in GenBank with Acc. No. OM304617.1. The amplified ITS region sequence was identical to those of M. incognita from India (KT869139.1) and China (MT490926.1 and MT071559.1). For confirmation, the primers species-specific for M. incognita (Inc-K14-F, 5'- GGGATGTGTAAATGCTCCTG -3' and Inc-K14-R, 5'- CCCGCTACACCCTCAACTTC -3') were further used for amplification. Expected PCR amplicon of 399 bp was acquired, which was consistent with previous report for M. incognita (Randig et al. 2002). Pathogenicity and reproduction of this M. incognita population on S. miltiorrhiza was confirmed and examined. Seeds of S. miltiorrhiza were sown in the pots filled with 200 ml of autoclaved soil mixture (loamy soil/sand, 1:1). Two weeks later, a total of 12 plants were inoculated each with 400 J2s, which were hatched from a field-derived M. incognita population. Four plants without nematode inoculation were used as the control. The plants grew in a chamber at 25/30 °C under 12-h dark/12-h light conditions. The parasitic J2s, J3s, J4s and females in roots were observed under a stereomicroscope at 5, 15 and 30 days post inoculation (dpi). At 35 dpi, an average of 98.3 ± 15.7 galls and 23.8 ± 6.9 egg masses per S. miltiorrhiza plant were counted, and the root gall index reached 6 according to the 0-10 RKN rating scale (Poudyal et al. 2005). Nematodes were re-isolated from the roots and their morphological and molecular characteristics were identical to the nematodes obtained from the original samples. Furthermore, all the inoculated S. miltiorrhiza roots showed typical RKN galls with the same symptoms as those initially observed in the field. No symptoms were developed on the non-inoculated control plants, and from which no nematodes were isolated. The nematode on S. miltiorrhiza was therefore certified as M. incognita. Han et al. (2019) isolated and morphologically identified M. incognita from the roots of S. miltiorrhiza and Trichosanthes kirilowii Maximin in Changqing area of Shandong Province, China, but did not perform the Koch's Rule. To our knowledge, this is the first formal report of M. incognita infecting S. miltiorrhiza in Henan Province, China. With the increase of Chinese herbal medicine planting area, plant parasitic nematodes are becoming more and more serious and have become an limiting factor on medicinal plant production, and the yield losses can be as high as 70%. This finding provides important and solid information for growers of Chinese medicinal plants, based on which suitable management action should be taken.

First record of Aphelenchoides besseyi on foxtail millet (Setaria italica) in Henan Province of China.

Aphelenchoides besseyi is one of the important plant-parasitic nematodes on rice, reducing approximate 10-20% of the rice yield annually (Jones et al. 2013). Foxtail millet (Setaria italica) has been a major cereal crop in Northern China, especially in the semi-arid areas of this region, for thousands of years. In August of 2019 and 2020, a survey of nematodes on autumn grain crops was performed each year. One foxtail millet field (N34° 58' 027″ and E113° 39' 059″) in Yuanyang County of Henan Province caught our attention. Some upper leaves showed chlorosis without or with necrotic tips, and flag leaves presented crinkling and distortion, stalks were colored, earheads were vertical, glumes were brown or light black and open, and grains became thin. A total of ten samples were collected, and the nematodes were isolated from the spike pieces by shallow plate method and counted under a stereomicroscope. The average number of nematodes per earhead of foxtail millet counted up to 1738.75 ± 107.72. Morphologically, females were slender with a short stylet, an oval metacorpus with a distinct valve, a labial region slightly wider than the first body annulus and a conoid tail with a terminus bearing a star-shaped mucro with four pointed processes. The females were characterized as follows (mean ± SD; n=20): body length (L) = 668.92 ± 12.73 µm (647.38 to 689.70 µm); maximum body width (W) = 14.35 ± 1.11 µm (12.12 to 16.88 µm); L/W = 46.83 ± 2.94 (40.44 to 50.03); tail length = 38.93 ± 3.48 µm (33.41 to 45.92 µm); L/tail length = 17.31 ± 1.44 (14.47 to 19.62); and stylet length (ST) = 11.57 ± 0.57 µm (10.77 to 12.34 µm). The males had three pairs of ventrosubmedian papillae with the first one adanal, spicula curved with a slight basal process, terminus bearing four mucrones arranged variably, and the whole worm was in 'J' shape. The males could be described as follows (mean ± SD, n = 20): L = 606.66 ± 10.70 µm (586.49 to 626.37 µm); W = 13.95 ± 0.60 µm (12.71 to 14.94 µm); L/W = 43.55 ± 1.69 (40.73 to 46.43); tail length = 35.54 ± 1.93 µm (31.41 to 38.18 µm); L/tail length = 17.07 ± 0.79 (16.05 to 18.67); ST = 11.53 ± 0.56 µm (1061 to 12.76 µm). All the key morphometrics were consistent with those of A. besseyi reported from Brazil (Favoreto et al. 2018) and China (Lin et al. 2004; Ou et al. 2014). The amplifications of rDNA internal transcribed spacer (ITS) fragments generated a PCR fragment of 830 bp from a single nematode, using the primers set TW81 (5'-GTTTCCGTAGGTGAACCTGC-3') and AB28 (5'-ATATGCTTAAGTTCAGCGGGT-3') (Joyce et al. 1994). Five independent PCR experiments were conducted, and all the PCR products were purified and sequenced. Nucleotide sequence of ITS-rDNA was deposited in GenBank with Accession Number OK090549.1. The obtained ITS region sequence was more than 99% identical to those of A. besseyi reported from China (MW216945.1) and India (JF826518.1, JF826519.1 and JF826517.1). These ITS sequence results further supported that the isolated nematodes were A. besseyi. Subsequently, the species-specific primers of A. besseyi (BSF, 5'-TCGATGAAGAACGCAGTGAATT-3' and BSR, 5'-AGATCAAAAGCCAATCGAATCAT-3') were used for confirmation by PCR (Cui et al. 2010). An expected PCR fragment of 312 bp was obtained, which was consistent with those of A. besseyi reported previously. The pathogenicity of identified A. besseyi was confirmed by infection of foxtail millet (Setaria italica cv. 'Yugu33'). Foxtail millet budding seeds were sown in the pots contained 150 mL of sterile soil mixture. In two weeks, 10 seedlings were inoculated with 100 A. besseyi each, and 4 plants were non-inoculated as the control. The foxtail millet seedlings were grown in a plant-growth chamber at 25/30°C under 12 h dark/12 h light. On the average, 73.3 and 138.2 of A. besseyi were isolated from each plant at 15 and 40 days post inoculation, respectively. Both the morphological and molecular characteristics were identical with those nematodes obtained from the original samples. All the upper leaves of the inoculated plants showed chlorosis and necrosis, symptoms that were similar to those observed in the field, and neither symptom developed on the non-inoculated control plants, nor were nematodes re-isolated from the control plants. To the best of our knowledge, this is the first record of A. besseyi on foxtail millet in Henan Province of North China. Henan is one of the most important grain-producing areas in China, and A. besseyi is an important domestic quarantine nematode, which may become a severe threat to cereal production in Henan Province. Our findings will be very beneficial for A. besseyi management and further research on foxtail millet in Henan Province of North China.

AUY922 induces retinal toxicity through attenuating TRPM1.

BACKGROUND: Ocular adverse events are common dose-limiting toxicities in cancer patients treated with HSP90 inhibitors, such as AUY922; however, the pathology and molecular mechanisms that mediate AUY922-induced retinal toxicity remain undescribed. METHODS: The impact of AUY922 on mouse retinas and cell lines was comprehensively investigated using isobaric tags for relative and absolute quantitation (iTRAQ)­based proteomic profiling and pathway enrichment analysis, immunohistochemistry and immunofluorescence staining, terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay, MTT assay, colony formation assay, and western blot analysis. The effect of AUY922 on the Transient Receptor Potential cation channel subfamily M member 1 (TRPM1)-HSP90 chaperone complex was characterized by coimmunoprecipitation. TRPM1-regulated gene expression was analyzed by RNAseq analysis and gene set enrichment analysis (GSEA). The role of TRPM1 was assessed using both loss-of-function and gain-of-function approaches. RESULTS: Here, we show that the treatment with AUY922 induced retinal damage and cell apoptosis, dysregulated the photoreceptor and retinal pigment epithelium (RPE) layers, and reduced TRPM1 expression. Proteomic profiling and functional annotation of differentially expressed proteins reveals that those related to stress responses, protein folding processes, regulation of apoptosis, cell cycle and growth, reactive oxygen species (ROS) response, cell junction assembly and adhesion regulation, and proton transmembrane transport were significantly enriched in AUY922-treated cells. We found that AUY922 triggered caspase-3-dependent cell apoptosis, increased ROS production and inhibited cell growth. We determined that TRPM1 is a bona fide HSP90 client and characterized that AUY922 may reduce TRPM1 expression by disrupting the CDC37-HSP90 chaperone complex. Additionally, GSEA revealed that TRPM1-regulated genes were associated with retinal morphogenesis in camera-type eyes and the JAK-STAT cascade. Finally, gain-of-function and loss-of-function analyses validated the finding that TRPM1 mediated the cell apoptosis, ROS production and growth inhibition induced by AUY922. CONCLUSIONS: Our study demonstrates the pathology of AUY922-induced retinal toxicity in vivo. TRPM1 is an HSP90 client, regulates photoreceptor morphology and function, and mediates AUY922-induced cytotoxicity.

First report of Heterodera filipjevi on winter wheat from Hebei Province in North China.

Three of the cereal cyst nematodes, Heterodera avenae, H. filipjevi and H. latipons are considered to be the most economically important cyst nematodes that affect cultivated cereals around the world. H. filipjevi was first detected in China from Xuchang, Henan Province in 2010 (Peng et al. 2010) and now has been recorded in the Central China of Henan, Shandong and Anhui provinces and the Northwest China of Xinjiang Uygur Autonomous Region (Cui et al. 2020). In June 2019, 42 samples consisting of roots and soil were collected from winter wheat fields in Hebei Province of North China. Cysts were detected in 37 soil samples with a mean of 6.4 ± 1.67 cysts per 100 ml of soil. Cysts and second-stage juveniles (J2s) were extracted from root and soil following Cobb's sieving gravity method. Morphological and molecular studies of J2s and cysts confirmed its identity with H. filipjevi in 5 samples from Handan (N36°10'052" and E114°35'056"; N36°37'054" and E114°22'052"), Xingtai (N36°53'060" and E114°30'011") and Shijiazhuang (N 37°26'048" and E 116°05'039") in Hebei Province, China. Morphologically, the cysts are lemon-shaped, light or dark brown in color. The vulval cone is bifenestrate with horseshoe-shaped semifenestrae, strongly globular bullae, and well-developed underbridge. Measurements (mean +_ sd (range)) of cysts (n=10), body length not including neck is 743.0 ± 36.1 µm (665 - 780 µm), body width is 559.0 ± 50.0 µm (455 - 639 µm), length / width ratio is 1.33 ± 0.07 (1.20 - 1.46); neck length is 99.3 ± 8.8 µm (85 - 122 µm); fenestrae length is 56.8 ± 5.0 µm (49 - 65 µm) and width is 25.5 ± 1.8 µm (21.1 - 27.8 µm); underbridge length is 84.0 ± 8.1 µm (62 - 93 µm); and vulval slit length is 8.6 ± 0.5 µm (7.2 - 9.1 µm). Measurements of J2s (n = 12), body length is 541 ± 11.4 µm (490 - 578 µm); stylet length is 22.3 ± 0.5 µm (22.0 - 25.0 µm) with anchor-shaped basal knobs; tail length is 57.7 ± 3.7 µm (52.7 - 65.2 µm), and hyaline tail terminal length is 36.5 ± 2.8 µm (32 - 39.8 µm). The tail had a sharp terminus. Morphology of the cysts and J2s were consistent with the record of H. filipjevi (Peng et al. 2010; Subbotin et al. 2010). The amplifications of rDNA-internal transcribed spacer (ITS) fragments were generated with a PCR fragment of 1054 bp from single cysts of each population, using primers TW81 and AB28 (Joyce et al. 1994). The PCR tests for each sample were repeated five times. The PCR product was purified and sequenced. All nucleotide sequences of ITS-rDNA were submitted to GenBank under accession numbers MW282843-6. Sequences from the ITS region were more than 99.5% identical to those of H. filipjevi from Egypt (KF225725), Turkey (KR704308, KR704293 and MN848333) and China (KT314234, MT254744 and KY448473). These results from ITS supported its identity as H. filipjevi. The results were also confirmed by species specific sequence characterized amplified region primers of H. filipjevi (Peng et al. 2013). Pathogenicity of the H. filipjevi was confirmed by infection of winter wheat (Triticum aestivum L cv. 'Aikang58') and examination of the nematode development and reproduction. Wheat seeds were germinated in petri dishes and then transplanted into five polyvinyl chloride tubs (3 cm in diameter, 25 cm in length) that contained 150 cm3 of a sterile soil mixture (loamy soil: sand = 1:1), each with 5 cysts (mean of 252.0 eggs/cyst). Plants were grown in an artificial climate box for one week at 14/18°C, two weeks at 16/20°C, five weeks at 18/25°C and two weeks at 22/30°C, under 8 h of darkness/16 h light and normal culturing practices (Cui et al. 2015). The parasitic J2s, third and fourth-stage juveniles, and adult females were observed in roots stained with acid fuchsin at 10, 20, 30, and 50 days after inoculation (DAI), and an average of 32.0 cysts per tubes were extracted 70 DAI. The new cyst' morphological and molecular characteristics were identical to the H. filipjevi cysts from the original soil samples. Three other tubes without cysts were set as control and there were no newly formed cysts. Heterodera avenae and H. filipjevi had been detected in a total of 16 wheat-producing provinces in China, which resulted in losses of 1.9 billion CNY year-1 (Cui et al. 2015). To our knowledge, this is the first report of H. filipjevi in Hebei Province of North China. Cereal cyst nematodes are easily transferred to non-infested areas by many avenues, resulting in increased species and pathotype complexity (Cui et al. 2020). Once H. filipjevi continues to spread in main wheat producing area of China, it could become be a new threat to cereals production. It is time to take effective control methods to prevent H. filipjevi further dispersal, especially through the farming machinery transmission. Hebei Province is one of the most important major grain-producing areas, our findings will be very beneficial for H. filipjevi management and further research on winter wheat in Hebei Province, North China.

Treatment of Lung Cancer by Peptide-Modified Liposomal Irinotecan Endowed with Tumor Penetration and NF-κB Inhibitory Activities.

Current chemotherapy for lung cancer achieved limited efficacy due to poor tumor targeting and tissue penetration. Another obstacle in the therapy is activated nuclear factor-κB (NF-κB) in tumor cells, which plays a crucial role in promotion of antiapoptosis and drug resistance. In this study, we utilized a multifunctional liposome loaded with irinotecan and surface modified with a cell-permeable NF-κB inhibitor (CB5005), for treatment of non-small-cell lung carcinoma. CB5005 downregulated the level of NF-κB-related protein in the nuclei of A549 cells, and increased cellular uptake of the modified liposomes. In vivo antitumor activity in mice bearing A549 xenografts revealed that modification with CB5005 significantly improved the tumor inhibition rate of irinotecan. Immunohistochemical assays showed that the tumors treated with CB5005-modified liposomes possessed the most apoptotic cells and the lowest level of p50 in the cell nuclei. These results strongly suggest that antitumor efficacy of the irinotecan liposomes can be enhanced by tumor-penetrating and NF-κB-inhibiting functions of CB5005. Consequently, CB5005-modified liposomes provide a possible synergistic therapy for lung cancer, and would also be appropriate for other types of tumors associated with elevated NF-κB activity.

First record of Heterodera elachista infecting rice in Henan Province of central China.

From June 2018 to November 2019, a survey for cyst-forming nematodes was conducted in rice fields in Henan Province of central China. Cysts were recovered from two rice fields (N32° 14' 048″8 and E115° 4' 008″) at Huangchuan County, leading to more intensive sampling. A further 25 soil samples were then collected with a valve bag from each of these two locations. Cysts and second-stage juveniles (J2) were recovered from roots and soil following Cobb's gravity sieving method. Live cysts were detected in all soil samples with a mean of 6.7±1.5 cysts per 100 ml of soil. Morphologically, the cysts were spherical to lemon-shaped, light to dark brown in color with subcrystalline layer. The vulval cone was well developed, cone terminus with a few large, peripheral, dark brown bullae lacking finger-like projections, and the ambifenestrae were almost rounded with two semifenestrae; width and length of the semifenestrae were similar. The vulval bridge was narrow, with a medium sized underbridge. Cyst measurements (n = 8) determined a mean body length of 431.1 ± 47.23 (351.0 - 516.0) µm, body width 304.3 ± 47.40 (240.0 - 381.0) µm; body length to width ratio 1.42 ± 0.10 (1.2 to 1.6); fenestrae length 39.4 ± 7.06 (26.0 - 47.0) µm; fenestrae width 36.5 ± 5.96 (25.0 - 43.0) µm; vulva slit length 37.1 ± 3.62 (30.0 - 42.0) µm; and the mean underbridge length 75.0 ± 3.39 (70.0 - 81.0) µm. Morphometric J2 measurements (n = 10) included a body length of 432.3 ± 53.26 (379.0 - 512.0) µm; stylet length 20.8 ± 1.87 (18.0 - 24) µm with rounded knobs; tail length 63.1 ± 7.92 (52.0 - 75.0) µm with a hyaline terminal tail length of 35.8 ± 6.14 (28.0 - 45.0) µm. The key morphometrics of this isolate were intermediate to those of the Japanese isolates (Nobbs et al. 1992.) and Chinese isolates (Ding et al. 2012), and other morphological character values were within the range of those reported for Heterodera elachista (Nobbs et al. 1992; Tanha Maafi et al. 2003). Amplification of DNA from single cysts (n = 7) was conducted using the protocol described by Ding et al. (2012). rDNA - ITS sequences were amplified with the universal primers TW81 and AB28 (Joyce et al. 1994). The PCR product was purified and sequenced. The ITS sequences were submitted to GenBank under accession numbers MT579616. Comparisons showed a sequence identity of more than 99.9% for H. elachista sequence MN720080 from Korea and 99.5% for H. elachista sequences JN864884 and JN202916 from China. Species identification was also confirmed using sequence characterized amplified region (SCAR) methods with H. elachista-specific primers He-F/He-R (Qi, 2012). An expected PCR fragment of approximately 434 bp was obtained, which was consistent with those previously reported for H. elachista. Pathogenicity was confirmed by infection and reproduction on rice (Oryza sativa cv. 'Nipponbare'). Seeds were sown into three tubes containing 150 ml of a sterile soil mixture (loamy soil: sand = 1:1), each with 5 cysts (mean of 185 eggs/cyst) and cultivated in an artificial climate box at 25/30°C, under a 12-h dark/12-h light cycle. Three other tubes without cysts were set as control. Two weeks after sowing, stunting and reduction of leaf length were observed and third- and fourth-stage juveniles were observed in roots stained with acid fuchsin. On average, 142 cysts per 150 ml soil were recovered at 5 weeks after sowing. The newly formed cysts corresponded morphologically and molecularly to the cysts from the original soil samples. The globally recognized and economically important rice-damaging cyst nematodes include H. oryzae, H. oryzicola, H. elachista, H. sacchari and H. graminophila (Zhuo et al. 2014). Ohshima (1974) first reported H. elachista, which was originally recorded as H. oryzae in Japan by Luc and Brizuela (1961). H. elachista was then detected from a rice field at Mazandaran Province in Iran (Tanha Maafi et al., 2003), and in upland rice fields in Hunan (Ding et al., 2012) and Guangxi, China (Zhuo et al. 2014). To the best of our knowledge, this is the first report of H. elachista as a pathogen on rice in Henan Province, in central China. According to our field observations, H. elachista was much more serious in direct-seeded rice field than in the transplanted rice fields. H. elachista was also reported attacking corn (Xiao et al., 2019). Henan is the most important corn-producing province in China, thus H. elachista is a potential threat to corn production in Henan. Our findings will be very beneficial for H. elachista management and further research on direct-seeded rice and corn in Henan Province, central China.

Octopus-like Flexible Vector for Noninvasive Intraocular Delivery of Short Interfering Nucleic Acids.

Gene therapy is promising for chronic posterior ocular diseases, which are causal factors for severe vision impairment and even blindness worldwide. However, the inherent absorption barriers of the eye restrict intraocular delivery of therapeutic nucleic acids via topical instillation. Safe and efficient nonviral vectors for ocular gene therapy are still unmet clinical desires. Herein, an octopus-like flexible multivalent penetratin (MVP) was designed to facilitate condensation and delivery of therapeutic nucleic acids using multiarm polyethylene glycol (PEG) as a core and conjugating penetratin at each end of the PEG arms as outspread tentacles. Among the MVPs, 8-valent penetratin (8VP) stably compacted nucleic acids into positively charged polyplexes smaller than 100 nm, promoting cellular uptake efficiency (approaching 100%) and transfection rate (over 75%). After being instilled into the conjunctival sac, 8VP enabled rapid (<10 min) and prolonged (>6 h) distribution of nucleic acids in the retina via a noncorneal pathway. In a retinoblastoma-bearing mice model, topical instillation of 8VP/siRNA efficiently inhibited the protein expression of intraocular tumor without toxicity. MVP is advantageous over the commercial transfection reagent in safety and efficiency, and therefore provides a promising vector for noninvasive intraocular gene delivery.

Three-Dimensional Cuprous Lead Bromide Framework with Highly Efficient and Stable Blue Photoluminescence Emission.

Considering the instability and low photoluminescence quantum yield (PLQY) of blue-emitting perovskites, it is still challenging and attractive to construct single crystalline hybrid lead halides with highly stable and efficient blue light emission. Herein, by rationally introducing d10 transition metal into single lead halide as new structural building unit and optical emitting center, we prepared a bimetallic halide of [(NH4 )2 ]CuPbBr5 with new type of three-dimensional (3D) anionic framework. [(NH4 )2 ]CuPbBr5 exhibits strong band-edge blue emission (441 nm) with a high PLQY of 32 % upon excitation with UV light. Detailed photophysical studies indicate [(NH4 )2 ]CuPbBr5 also displays broadband red light emissions derived from self-trapped states. Furthermore, the 3D framework features high structural and optical stabilities at extreme environments during at least three years. To our best knowledge, this work represents the first 3D non-perovskite bimetallic halide with highly efficient and stable blue light emission.

ERK1/2/mTOR/Stat3 pathway-mediated autophagy alleviates traumatic brain injury-induced acute lung injury.

Acute lung injury (ALI) is one of several complications in patients with traumatic brain injury (TBI). Autophagy is a primary homeostatic process that promotes cell survival under stress. Accumulating evidence implicates autophagy in the pathogenesis of ALI under various conditions. However, the role of autophagy in TBI-induced ALI remains unknown. The aim of this study was to adjust autophagy with pharmacological agents to determine its functional significance in TBI-induced ALI. Rats were preconditioned with autophagy promoter rapamycin or inhibitor 3-methyladenine before they were challenged with TBI. Extracellular signal-regulated kinase 1/2 (ERK1/2) inhibitor U0126, mechanistic target of rapamycin (mTOR) inhibitor rapamycin, and signal transducer and activator of transcription 3 (Stat3) inhibitor S31-201 were used to test the role of ERK1/2/mTOR/Stat3 signaling pathway in regulating autophagy. Autophagy is activated in lung tissues after TBI. Enhancement of autophagy suppressed apoptosis, inflammation and oxidative stress in lung tissues, which were activated after TBI, whereas inhibition of autophagy aggravated these critical pathological changes. Autophagy also improved TBI-induced impairment in pulmonary barrier function, oxygenation function and static compliance. Furthermore, TBI-induced autophagy was mediated by ERK1/2/mTOR/Stat3 pathway, which may serve to reduce ALI and improve pulmonary barrier function, oxygenation function and static compliance. These findings are important for the prevention and treatment of TBI-induced ALI.

Characterization of Putative Effectors from the Cereal Cyst Nematode Heterodera avenae.

Few molecular details of effectors of Heterodera avenae parasitism are known. We performed a high-throughput sequencing analysis of the H. avenae transcriptome at five developmental stages. A total of 82,549 unigenes were ultimately obtained, and 747 transcripts showed best hits to genes putatively encoding carbohydrate-active enzymes in plant-parasitic nematodes that play an important role in the invasion process. A total of 1,480 unigenes were homologous to known phytonematode effectors, and 63 putative novel effectors were identified in the H. avenae transcriptomes. Twenty-three unigenes were analyzed by qRT-PCR and confirmed to be highly expressed during at least one developmental stage. For in situ hybridization, 17 of the 22 tested putative effectors were specifically expressed and located in the subventral gland cells, and five putative novel effectors were specifically expressed in the dorsal gland. Furthermore, 115 transcripts were found to have putative lethal RNA interference (RNAi) phenotypes. Three target genes with lethal RNAi phenotypes and two of the four tested putative effectors were associated with a decrease in the number of cysts through in vitro RNAi technology. These transcriptomic data lay a foundation for further studies of interactions of H. avenae with cereal and H. avenae parasitic control.

Fstl1 Promotes Glioma Growth Through the BMP4/Smad1/5/8 Signaling Pathway.

BACKGROUND: Gliomas result in the highest morbidity and mortality rates of intracranial primary central nervous system tumors because of their aggressive growth characteristics and high postoperative recurrence. They are characterized by genetic instability, intratumoral histopathological variability and unpredictable clinical behavior in patients. Proliferation is a key aspect of the clinical progression of malignant gliomas, complicating complete surgical resection and enabling tumor regrowth and further proliferation of the surviving tumor cells. METHODS: The expression of Fstl1 was detected by western blotting and qRT-PCR. We used cell proliferation and colony formation assays to measure proliferation. Then, flow cytometry was used to analyze cell cycle progression. The expression of Fstl1, p-Smad1/5/8 and p21 in GBM tissue sections was evaluated using immunohistochemical staining. Furthermore, we used coimmunoprecipitation (Co-IP) and immunoprecipitation to validate the relationship between Fstl1, BMP4 and BMPR2. Finally, we used orthotopic xenograft studies to measure the growth of tumors in vivo. RESULTS: We found that follistatin-like 1 (Fstl1) was upregulated in high-grade glioma specimens and that its levels correlated with poor prognosis. Fstl1 upregulation increased cell proliferation, colony formation and cell cycle progression, while its knockdown inhibited these processes. Moreover, Fstl1 interacted with bone morphogenetic protein (BMP) 4, but not BMP receptor (BMPR) 2, and competitively inhibited their association. Furthermore, Fstl1 overexpression suppressed the activation of the BMP4/Smad1/5/8 signaling pathway, while BMP4 overexpression reversed this effect. CONCLUSION: Our study demonstrated that Fstl1 promoted glioma growth through the BMP4/Smad1/5/8 signaling pathway, and these findings suggest potential new glioblastoma treatment strategies.

Rapid and sensitive MALDI MS analysis of oligosaccharides by using 2-hydrazinopyrimidine as a derivative reagent and co-matrix.

Sensitive analysis of oligosaccharides by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is significantly hampered by the low ionization efficiency of oligosaccharides. Derivatization affords a feasible way to enhance the MALDI intensities of oligosaccharides by introducing an easily ionized and/or hydrophobic tag to their reducing ends. However, tagging and subsequent desalting processes are quite time-consuming. Herein, we develop a rapid and sensitive approach for oligosaccharide derivatization by using 2-hydrazinopyrimidine (2-HPM). As a result of the presence of an electron-withdrawing N-heterocycle, 2-HPM can quantitatively derivatize oligosaccharides within 15 min and selectively facilitate their ionization. Additionally, 2-HPM acts as co-matrix to enhance the MALDI signal of oligosaccharides, and therefore the tedious enrichment and purification processes prior to MALDI analysis are avoided. This approach is applied to the analysis of various oligosaccharides released from glycopeptides, glycoprotein, and biological samples. After derivatization, a significant increase of MALDI intensities (greater than 10-fold) was observed for all the tested neutral and sialylated oligosaccharides. Moreover, the enhanced fragmentation of MS/MS brings much convenience to the structural elucidation of oligosaccharides. Graphical abstract Improved MALDI MS analysis of oligosaccharides by using 2-hydrazinopyrimidine as a derivative tag and co-matrix.

Diethylaminoethyl Sepharose (DEAE-Sepharose) microcolumn for enrichment of glycopeptides.

N-Glycosylation is one of the most prevalent protein post-translational modifications and is involved in many biological processes, such as protein folding, cellular communications, and signaling. Alteration of N-glycosylation is closely related to the pathogenesis of diseases. Thus, the investigation of protein N-glycosylation is crucial for the diagnosis and treatment of disease. In this research, we applied diethylaminoethanol (DEAE) Sepharose solid-phase extraction microcolumns for N-glycopeptide enrichment. This method integrated the advantages of Click Maltose and zwitterionic HILIC (ZIC-HILIC) and showed a relatively higher specificity for N-glycosylated peptides. This strategy was then applied to tryptic digests of normal human serum, followed by deglycosylation using peptide-N-glycosidase F (PNGase F) in H218O. Subsequent LC-MS/MS analysis allowed for the assignment of 219 N-glycosylation sites from 115 serum N-glycoproteins. This study provides an alternative approach for N-glycopeptide enrichment and the method employed is effective for large-scale N-glycosylation site identification. Graphical abstract Proposed mechanism of glycopeptides enrichment using DEAE-Sepharose.

Noninvasive delivery of oligonucleotide by penetratin-modified polyplexes to inhibit protein expression of intraocular tumor.

Our present study aimed to develop an antisense oligonucleotide (ASO) delivery system to achieve gene silencing in intraocular tumor via topical instillation. ASO specific for luciferase was chosen as model drug, polyamidoamine (PG5) was employed to condense ASO, and penetratin (Pene) was used to enhance cellular uptake. Nanoscale PG5/ASO/Pene polyplex was stabilized via noncovalent bonding. In vitro evaluations indicated that PG5/ASO/Pene exhibited improved cell-penetrating and gene silencing ability compared with naked ASO and PG5/ASO. Subcutaneous and orthotopic tumor models expressing luciferase were established in nude mice. After treated by PG5/ASO/Pene, immunohistochemical results of subcutaneous tumors showed significant inhibition of luciferase expression via peritumoral injection, and bioluminescence from orthotopic tumor was obviously weakened via topical instillation. To date, few works were successful in noninvasive treatment of intraocular diseases using antisense strategy, this penetratin-modified polyplex could be a promising vector to inhibit protein expression by effectively delivering ASOs into the eye.