Maternal Di-(2-ethylhexyl)-Phthalate exposure during pregnancy altered energy metabolism in immature offspring and caused hyperglycemia.

Di-(2-ethylhexyl)-phthalate (DEHP), as distinctive endocrine disrupting chemicals, has become a global environmental pollutant harmful to human and animal health. However, the impacts on offspring and mothers with maternal DEHP exposure are largely unknown and the mechanism remains elusive. We established DEHP-exposed maternal mice to investigate the impacts on mother and offspring and illustrate the mechanism from multiple perspectives. Pregnant mice were administered with different doses of DEHP, respectively. Metagenomic sequencing used fecal and transcriptome sequencing using placentas and livers from offspring have been performed, respectively. The results of the histopathology perspective demonstrated that DEHP exposure could disrupt the function of islets impact placentas and fetus development for maternal mice, and cause the disorder of glucose and lipid metabolism for immature offspring mice, resulting in hyperglycemia. The results of the metagenome of gut microbial communities indicated that the dysbiosis of gut microbiota in mother and offspring mice and the dominant phyla transformed through vertical transmission. Transcriptome analysis found DEHP exposure induced mutations of Ahcy and Gstp3, which can damage liver cells and affect the metabolism of the host. DEHP exposure harms pregnant mice and offspring by affecting gene expression and altering metabolism. Our results suggested that exposure of pregnant mice to DEHP during pregnancy and lactation increased the risk of metabolic disorders by altering key genes in liver and gut microbiota, and these results provided new insights into the potential long-term harms of DEHP.

Advanced glycation end products promote the progression of chronic kidney diseases by targeting calpain 6.

Advanced glycation end products (AGEs) are produced by glycosylation or oxidation of proteins and lipids and are tightly involved in the chronic kidney disease (CKD) process. Calpain 6 (CAPN6) is a non-classical calpain that has been reported to be overexpressed in CKD. This study aimed to explore the effects of AGEs in CKD progress and their correlation with CAPN6. AGEs production was measured using ELISA. The CCK-8 assay was used to test cell proliferation. mRNA and protein levels were tested using qRT-PCR and western blot. The progress of glycolysis was tested by calculating the ATP and ECAR content in HK-2 cells. The expression of AGEs and CAPN6 was significantly increased in patients with CKD3, CKD4, and CKD5. AGEs treatment inhibited cell proliferation and glycolysis and accelerated apoptosis. Additionally, CAPN6 knockdown effectively reversed the effects of AGEs in HK-2 cells. In addition, overexpressed CAPN6 played similar role to AGEs, which suppressed cell proliferation and glycolysis and facilitated apoptosis. Moreover, the administration of 2-DG, a glycolysis inhibitor, counteracted the effects of CAPN6 silencing in HK-2 cells. Mechanistically, CAPN6 interacts with NF-κB and PDTC reduced CAPN6 expression in HK-2 cells. This investigation revealed that AGEs facilitate CKD development in vitro by modulating the expression of CAPN6.

Joint effects of recent stressful life events and adverse childhood experiences on perinatal comorbid anxiety and depression.

BACKGROUND: Stressful life events (SLEs) and adverse childhood experiences (ACEs) have been reported to be associated with perinatal depression (PND) or perinatal anxiety (PNA) alone; however, in most cases, majority of PND and PNA coexist and could lead to more serious health consequences. The independent effect of recent SLEs and their joint effects with ACEs on perinatal comorbid anxiety and depression (CAD) remain inadequately explored. METHODS: Based on a longitudinal study, 1082 participants receiving prenatal care in Ma'anshan, China were included. Women were recruited in the first trimester (T1: ≤14+ 6 weeks) and followed up at 15 ~ 27 weeks (T2), 28 ~ 40 weeks (T3), and postpartum (T4). Depression and anxiety status were assessed at all time points, while recent SLEs and ACEs were measured at T1. Logistic regression was conducted to examine the associations of SLEs with the risks of CAD at different time points, as well as their joint effects with ACEs on CAD. RESULTS: Approximately 38.5% of women experienced at least one SLE, which was significantly associated with higher risks of CAD at all time points (p < 0.05). As the number of SLEs increased, the risk of CAD increased (p for trend < 0.05). Specific types of SLEs were associated with CAD in different periods, while only interpersonal events were consistently associated with risks of CAD throughout the whole perinatal period. The joint effects of SLEs with ACEs on CAD were identified throughout the perinatal period, with the highest observed in the first trimester (aOR = 7.47, 95% CI: 3.73-14.95; p for trend < 0.001). CONCLUSION: Our study demonstrated independent associations of recent SLEs and their joint effects with ACEs with risks of perinatal CAD. SLEs combined with ACEs should be recognized as a major risk factor for perinatal CAD and managed at the earliest time to prevent and control CAD.

Association of polycyclic aromatic hydrocarbons exposure with child neurodevelopment and adult emotional disorders: A meta-analysis study.

BACKGROUND: Polycyclic aromatic hydrocarbons (PAHs) have been demonstrated to be neurotoxic. OBJECTIVES: To summarize the existing epidemiological studies to quantify the effects of PAHs exposure on child neurodevelopment and adult emotional disorders. DATA SOURCES AND STUDY ELIGIBILITY CRITERIA: We conducted a systematic literature search for studies of child neurodevelopment and adult emotional disorders published in English up to April 2022 in the databases of PubMed, Web of Science and Embase using combinations of MeSH terms and Entry terms, and the articles were filtered out according to data availability. A variety of common PAHs were included in the meta-analysis: 1-hydroxynaphthalene, 2-hydroxynaphthalene, 2-hydroxyfluorene, 3-hydroxyfluorene, 9-hydroxyfluorene, 1-hydroxyphenanthrene, 2-hydroxyphenanthrene, 3-hydroxyphenanthrene, 4-hydroxyphenanthrene, 9-hydroxyphenanthrene, 1-hydroxypyrene and benzoapyrene (BaP). STUDY EVALUATION AND SYNTHESIS METHODS: We extracted the content of each article, summarized its design characteristics and performed quality evaluation. We combined the odds ratio (OR) available in various studies to obtain the risk of PAHs exposure and adaptive, language, social, attention, motor skills and child depression/anxiety in children ≤ 15 years old. In addition, we also conducted a meta-analysis on the relationship between PAHs exposure and the risk of depression in adults. RESULTS: We included a total of 16 epidemiological studies (4 cross-sectional studies and 12 cohort studies). The sample size of all included studies ranged from 110 to 9625. Prenatal exposure to PAHs was found to be associated with increased risk of social behavior (OR = 1.60, 95% CI: 1.00-2.54), attention (OR = 2.99, 95% CI: 1.48-6.02), motor skill problems (OR = 1.91, 95% CI: 1.27-2.86) and any adverse neurodevelopmental outcome in children (OR = 2.10, 95% CI: 1.69-2.62). In addition, we found that PAHs exposure could increase the risk of adult depression, with 2-hydroxyfluorene exposure showing the highest combined OR (OR = 1.48, 95% CI: 1.10-2.00). CONCLUSIONS: The results suggested that PAHs exposure are associated with increased risk of child neurodevelopment and adult depression. The neurotoxic effects of PAHs exposure in human being should be paid more attention. The results suggested that PAHs exposure are associated with increased risk of child neurodevelopment and adult depression. The neurotoxic effects of PAHs exposure in human being should be paid more attention. Steps should be taken to enhance the biomonitoring of PAHs and to reduce the exposure in general population.

[Combined effect of active smoking history and passive smoking during pregnancy on postpartum depression and anxiety].

OBJECTIVE: To explore the independent and combined effects of smoking and passive smoking during pregnancy on maternal depression, anxiety and depressive anxiety comorbidities. METHODS: From August 2020 to February 2022, women who underwent 42-day postpartum examination in Changfeng Women's Center and Shuangfeng Hospital of Hefei were recruited. Their depression and anxiety symptoms were assessed using EPDS Scale and GAD Scale, respectively, and smoking and passive smoking status during pregnancy were collected. Multivariate Logistic regression was used to analyze the independent and combined effects of smoking and passive smoking during pregnancy on postpartum depression, anxiety and depression and anxiety comorbidities. RESULTS: A total of 2 447 parturients were included, whose mean age was(29.23±4.20) years old.58.6% of parturients lived in urban areas.97.2% parturients had unassisted reproduction and 73.5% pregnancy intention was spontaneous. Among them, 362(14.8%) had depression, 523(21.4%) had anxiety, and 270(11.0%) had depression and anxiety comorbidities. In an independent analysis of effects, maternal smoking during pregnancy was statistically associated with postpartum depression(OR=3.86, 95%CI 2.37-6.28), anxiety(OR =2.58, 95%CI 1.60-4.17) and depressive anxiety comorbidity(OR = 3.34, 95%CI 2.00-5.71). Maternal passive smoking during pregnancy was also positively associated with the risk of postpartum depression(OR = 1.56, 95%CI 2.00-5.71), anxiety(OR=1.71, 95%CI 1.24-2.37) and depression and anxiety comorbidities(OR = 1.52, 95%CI 1.02-2.28), and the higher the frequency of exposure to passive smoking, the higher risk of depression, anxiety, and depressive and anxiety comorbidities. No interaction between smoking during pregnancy and passive smoking exposure on postpartum depression(RERI = 0.69, 95%CI-4.62-6.00; AP = 10.84, 95%CI-73.37-95.04; S= 0.58, 95%CI 0.02-15.18), anxiety(RERI=0.27, 95%CI 0.05-0.49; AP=4.02, 95%CI-0.52-8.57; S=0.78, 95%CI 0.64-0.94) and depression and anxiety comorbidities(RERI = 0.07, 95%CI-0.25-0.39; AP=1.74, 95%CI-6.03-9.52; S=0.93, 95%CI 0.68-1.27)was observed. CONCLUSION: Both smoking and passive smoking during pregnancy were positively associated with the risk of postpartum depression, anxiety and depressive anxiety comorbidity.

Gut microbiota and thyroid-associated ophthalmopathy. / è‚ é“èŒç¾¤ä¸Žç”²çŠ¶è ºç›¸å ³çœ¼ç— .

Thyroid-associated ophthalmopathy (TAO) is a multifactorial-mediated autoimmune orbital disease with the highest incidence of orbital disease in adults. Due to the complex clinical manifestations and prolonged course,TAO seriously affect the physical and mental health of patients.The pathogenesis of TAO has not been fully elucidated and the treatment lacks specificity. Therefore, in-depth research on the pathogenesis of TAO is to find effective treatments. In recent years, studies have suggested that there is gut microbiota disorder in TAO, and the risk factors of TAO can promote gut microbiota disorder. Disordered gut microbiota can participate in the occurrence and development of TAO via influencing T cell differentiation, mimicking autoantigens, and influencing host non-coding RNA expression. Modulating the gut microbiota also has therapeutic effects on TAO and is a promising therapeutic approach.

A New Ratiometric Design Strategy Based on Modulation of π-Conjugation Unit for Developing Fluorescent Probe and Imaging of Cellular Peroxynitrite.

Ratiometric fluorescent probes could effectively offset the changes of the autofluorescence and compartmental localization. FRET, ICT, etc. are the common strategies to design probes for biosensing, but these strategies have some deficiencies. Here, we proposed a new design strategy based on π-conjugation modulation, giving two different emission bands in the absence and presence of the target. The new fluorescence probe named Rhod-DCM-B was rationally designed and synthesized, which displayed a fluorescence emission peak at 670 nm because the electron cloud focuses on the conjugated DCM unit. With the addition of ONOO-, the fluorescence emission at 570 nm increased, accompanied by the decrease of fluorescence emission at 670 nm, showing a ratiometric signal change attributed to the opened spirane structure making the electron cloud concentrated on the xanthene core. The mechanism is well confirmed by MS and DFT calculations. Rhod-DCM-B exhibited outstanding sensitivity and excellent selectivity toward ONOO-. Moreover, Rhod-DCM-B was effectively employed to determine endogenous and exogenous ONOO- in living cells. As a marker for inflammation and drug-induced liver injury (DILI) process, ONOO- in vivo was successfully monitored by Rhod-DCM-B and presented a dramatic ratiometric response.

A longitudinal cohort study of gestational diabetes mellitus and perinatal depression.

BACKGROUND: The association between gestational diabetes mellitus (GDM) and perinatal depression (PND) remains controversial. Our study aimed to comprehensively assess this association in a longitudinal cohort study with repeated measurements of depression. METHODS: Our cohort study was nested in a pilot study of an implementation study aiming to screen and manage perinatal depression within the primary health system in China. Women were recruited in the first trimester from May-September 2019 and followed four times up to 1 year postpartum. Data on sociodemographic characteristics and depression were collected using self-developed questionnaires incorporating the Edinburgh Postnatal Depression Scale (EPDS). Oral glucose tolerance test at 24 ~ 28 weeks and fasting plasma glucose (FPG) data were extracted from medical records. Depression throughout the whole period was divided into different trajectories. Associations of GDM with PND at different time periods and PND of different trajectories were determined by logistic regression. The path of association between blood glucose and depression over time was estimated with an autoregressive cross-lagged model. RESULTS: In total, 1043 women were included in this analysis and 313 (30.0%) were diagnosed with GDM. The prevalence of depression in the first, second, and third trimesters and postpartum period were 17.2, 6.9, 6.8 and 9.0%, respectively. GDM was neither significantly associated with PND at any time point nor with any specific trajectory of depression. Except for autoregressive paths, no cross-lagged path of FPG and scores of EPDS was significant. CONCLUSIONS: Our study indicates no association between GDM/blood glucose and PND.

Research progress in Th17 cells and the relevant cytokines in Graves' ophthalmopathy. / Th17ç»†èƒžåŠå ¶ç›¸å ³å› å­åœ¨Gravesçœ¼ç— ä¸­çš„ç ”ç©¶è¿›å±•.

Graves' ophthalmopathy is the most common clinical orbital disease, and T helper (Th) cells play an important role in the development of Graves' ophthalmopathy. Th17 cells are a major subpopulation of Th cells and abnormally highly expressed in patients with Graves' ophthalmopathy. Th17 cells and the related cytokines interleukin (IL)-17A, IL-21 and IL-23 are involved in regulating the inflammatory response, fibrosis and adipogenesis. Th17 cells are unstable and exhibit a degree of plasticity, and they can differentiate into IL-17A and interferon (IFN)-γ dual-producing Th17.1 cells, which exacerbate the pathogenicity of Th17 cells. In addition, Th17 cells and the relevant factors are strongly associated with disease activity and severity in Graves' ophthalmopathy.

Assessment of health inequality between urban-to-urban and rural-to-urban migrant older adults in China: a cross-sectional study.

BACKGROUND: Many studies focused on health inequality between migrant older adults and local older adults, while few study concerned the health inequalities between urban-to-urban and rural-to-urban migrant older adults. This study aimed to compare physical health and mental health between these two groups in Hangzhou, Zhejiang Province, China, and to explore the relationship between cognitive social capital, social integration and health among migrant older adults. METHODS: A two-stage stratified sampling method was employed to recruit participants from May to August 2013 in Hangzhou. Measurement data were compared with student's t-tests and multivariate analysis of variance (MANOVA). Multiple linear regression was adopted in this study. RESULTS: A total of 1000 of participants who met the inclusion criteria were analyzed, consisting of 527 (52.7%) urban-to-urban and 473 (47.3%) rural-to-urban migrant older adults. There were no statistically significant difference in physical health and mental health between urban-to-urban and rural-to-urban groups on the whole. However, urban-to-urban migrant older adults had a higher reciprocity and social integration than did in rural-to-urban group (13.36 vs. 12.50, p < 0.01; 40.07 vs. 38.50, p < 0.01). And both of cognitive social capital and social integration were positively related to physical health (social reciprocity: t = 6.69, p < 0.01; social trust: t = 3.27, p < 0.01; social integration: t = 5.66, p < 0.01) and mental health (social reciprocity: t = 4.49, p < 0.01; social trust: t = 5.15, p < 0.01; social integration: t = 10.02, p < 0.01). Overall, the female, widowed, and the oldest among migrant older adults had a worse health. CONCLUSIONS: Social capital and social integration were played important roles in health of migrant older adults. The female rural-to-urban migrant older adults, those aged over 70 years, and older adults who were not in marriage should be especially concerned in health policy making.

Identification of two CUL7 variants in two Chinese families with 3-M syndrome by whole-exome sequencing.

BACKGROUND: 3-M syndrome is a rare autosomal recessive disorder characterized by primordial growth retardation, large head circumference, characteristic facial features, and mild skeletal changes, which is associated with the exclusive variants in three genes, namely CUL7, OBSL1, and CCDC8. Only a few 3-M syndrome patients have been reported in Chinese population. METHODS: Children with unexplained severe short stature, facial dysmorphism, and normal intelligence in two Chinese families and their relatives were enrolled. Trio-whole-exome sequencing (trio-WES) and pathogenicity prediction analysis were conducted on the recruited patients. A conservative analysis of the mutant amino acid sequences and function prediction analysis of the wild-type (WT) and mutant CUL7 protein were performed. RESULTS: We identified a homozygous missense variant (NM_014780.4: c.4898C > T, p.Thr1633Met) in CUL7 gene in a 6-month-old female infant from a non-consanguineous family, and a homozygous frameshift variant (NM_014780.4: c.3722_3749 dup GGCTGGCACAGCTGCAGCAATGCCTGCA, p. Val1252Glyfs*23) in CUL7 gene in two affected siblings from a consanguinity family. These two variants may affect the properties and structure of CUL7 protein. CONCLUSION: These two rare variants were observed in Chinese population for the first time and have not been reported in the literature. Our findings expand the variant spectrum of 3-M syndrome in Chinese population and provide valuable insights into the early clinical manifestations and pathogenesis of 3-M syndrome for pediatricians and endocrinologists.

Association of polymorphisms in the HBG1-HBD intergenic region with HbF levels.

BACKGROUND: Increased levels of fetal hemoglobin (HbF) can improve the clinical course of the patients with sickle cell anemia (SCA) or ß-thalassemia. The HBG1-HBD intergenic region plays an important role in this process. However, very few studies investigated whether the variations in this region have an effect on HbF expression. METHODS: We retrieved all the SNP data in the HBG1-HBD intergenic region and defined the haplotype blocks, then performed cluster analysis and selected a tagSNP. A total of 500 normal individuals and 300 ß-thalassemia carriers were enrolled. After routine blood and hemoglobin capillary electrophoresis testing, ß-thalassemia mutations were detected using PCR-reverse dot blot. The genotypes of the rs4910736 (A > C) and rs10128556 (C > T) were determined using Sanger sequencing; the relationship between the two SNPs and the levels of HbF was analyzed. RESULTS: Two haplotype blocks were constructed. Block 1 included seven haplotypes divided into two groups M and N by 11 tagSNPs, among which rs4910736 was selected as a tagSNP, while block 2 included three haplotypes. We found that the haplotypes of block 1 were statistically associated with HbF levels, but the non-tagSNP rs10128556 was shown to be more strongly associated with HbF levels than rs4910736. CONCLUSION: This work proved that the haplotypes in the HBG1-HBD intergenic region and SNP rs10128556 are both statistically associated with HbF levels, revealing the association of polymorphisms in the HBG1-HBD intergenic region with HbF levels.

Repeated Measurements of Paraben Exposure during Pregnancy in Relation to Fetal and Early Childhood Growth.

Parabens are potential endocrine disruptors with short half-lives in the human body. To date, few epidemiological studies regarding repeated paraben measurements during pregnancy associated with fetal and childhood growth have been conducted. Within a Chinese prenatal cohort, 850 mother-infant pairs from whom a complete set of maternal urine samples were acquired during three trimesters were included, and the levels of five parabens were measured. We assessed the associations of both average and trimester-specific urinary paraben levels with weight and height z-scores at birth, 6 months, 1, and 2 years of age. In all infants, each doubling increase in average ethyl paraben (EtP) was associated with -2.82% (95% CI: -5.11%, -0.53%) decrease in weight z-score at birth, whereas no significant age-specific associations were identified. After stratifying by sex, we further observed age-specific association of average EtP with -3.96% (95% CI: -7.03%, -0.89%) and -3.38% (95% CI: 6.72%, -0.03%) reduction in weight z-scores at 1 and 2 years in males, respectively. Third-trimester EtP was negatively associated with weight z-scores at birth, 1 and 2 years in males. Our results suggested negative associations between prenatal paraben exposure and fetal and childhood growth, and the third trimester may be the window of susceptibility.

Melanization of a meristematic mutant of Fonsecaea monophora increase the pathogenesis in a BALB/c mice infection model.

The role of melanin in agents of chromoblastomycosis in vivo still remains unclear. In this study, we addressed the question in a BALB/c mice infection model by using an albino mutant, which generated from a melanized meristematic mutant of F. monophora. The most severe clinical manifestations of infected mice were observed at 10-25 dpi (day post infection) and 7-15 dpi for melanized and albino strain, respectively. Histopathologic examination were similar in both groups at 15 dpi (acute infection phase), but not at 30 dpi (sustained infection phase) and 45 dpi (recovery phase). Sclerotic body could be revealed in melanized strain infection group compare with albino strain infection group at 45 dpi. We found significantly elevated of TH2 cytokines in melanized strain infected group at 15 dpi, while increased expression level of TH1 and TH17 cytokines in albino strain infection group at 15 and 30 dpi. In conclusion, the present data addressed our speculation that melanization of this meristematic mutant of F. monophora could increase the pathogenesis in vivo. The inhibition of TH1 and TH17, exacerbated TH2 ability of melanized F. monophora is the key to escape the host immune system at the initial recognition and persistence in BALB/c mice.

Impact of parental migration on psychosocial well-being of children left behind: a qualitative study in rural China.

BACKGROUND: Tens of millions of rural "left-behind children (LBC)" in China grow up experiencing prolonged separation from their migrant worker parents. This study aimed to explore how children are affected by parental migration, from the perspectives of children, parents, and grandparents, focusing on the experiences of prolonged parent-child separation and relationship dynamics in the extended family. METHODS: Qualitative in-depth interviews were conducted in a migrant-sending rural area of eastern China. Participants included 25 children (aged 7 to 14), 17 parents, and 13 grandparents, from 30 families, as well as 24 key informants from the communities. Data analysis followed a grounded theory approach. RESULTS: The results showed that despite the original purpose of benefiting children, parental migration resulted in challenges in child psychosocial well-being, due to the emotional impacts from prolonged parent-child separation. Parental absence also led to inadequate care and support for left-behind children. The negative effects of parental migration may be exacerbated by other vulnerabilities such as parents' divorce, poverty and grandparent caregivers' frailty. Concerns about child well-being made some migrants decide to return home permanently, because of the altered trade-offs of migration. CONCLUSION: Prolonged separation following migration often disrupts parent-child relationships and results in psychosocial difficulties in LBC, especially among those who live with multiple adversities in the family. Community-based interventions may help migrant parents and co-resident caregivers to better engage children and promote their resilience.

Comparison of access to health services among urban-to-urban and rural-to-urban older migrants, and urban and rural older permanent residents in Zhejiang Province, China: a cross-sectional survey.

BACKGROUND: While much literature reported the access of Chinese older migrants to health services, little was known about the differences among sub-groups of older adults, including urban-to-urban and rural-to-urban migrants, and urban and rural permanent residents. This study aimed to examine the access of these four groups to health services in Zhejiang Province, China and provide an evidence for the development of health services policies. METHODS: A cross-sectional survey was conducted in community-dwelling older adults (aged 60 years or above) in 2013. Participants were recruited by random sampling. Demographic information and access to health services for the elderly populations were obtained via interviews using a self-designed structured questionnaire. Pearson's chi-square tests and Cochran-Mantel-Haenszel (CMH) tests were performed to examine the differences in access to health services among the four groups. Binary logistic regression was conducted to explore the associations of participants' visits to doctors with their group status after controlling confounding factors. RESULTS: The two-week hospital visiting rates were significantly lower in migrants (55.56% in rural-to-urban and 62.50% in urban-to-urban) than that in urban and rural permanent residents (67.40 and 82.25%, respectively; p < 0.01). The majority of older adults who received a diagnosis indicating need for hospital treatment accepted the treatment, with no significant difference among the four groups after controlling for health service need (χ2 = 7.08, p = 0.07). On the other hand, 30.05% of the older adults did not visit a doctor when they got ailments in the past 2 weeks prior to the survey, and 16.42% (33/201) did not receive hospital treatment after receiving a diagnosis indicating need for hospital treatment. Factors including age, marital status, educational attainment, major financial source, and living with family members did not influence health services use. CONCLUSIONS: Targeted social and health policies integrating the strengths of government, society and families should be implemented to further improve health services use for different groups of older adults.

Novel Chlorinated Polyfluorinated Ether Sulfonates and Legacy Per-/Polyfluoroalkyl Substances: Placental Transfer and Relationship with Serum Albumin and Glomerular Filtration Rate.

Per- and polyfluoroalkyl substances (PFASs) may cross the placental barrier and lead to fetal exposure. However, little is known about the factors that influence maternal-fetal transfer of these chemicals. PFAS concentrations were analyzed in 100 paired samples of human maternal sera collected in each trimester and cord sera at delivery; these samples were collected in Wuhan, China, 2014. Linear regression was used to estimate associations of transfer efficiencies with factors. Chlorinated polyfluorinated ether sulfonates (Cl-PFAESs, 6:2 and 8:2) were frequently detected (>99%) in maternal and cord sera. A significant decline in PFAS levels during the three trimesters was observed. A U-shape trend for transfer efficiency with increasing chain length was observed for both carboxylates and sulfonates. Higher transfer efficiencies of PFASs were associated with advancing maternal age, higher education, and lower glomerular filtration rate (GFR). Cord serum albumin was a positive factors for higher transfer efficiency (increased 1.1-4.1% per 1g/L albumin), whereas maternal serum albumin tended to reduce transfer efficiency (decreased 2.4-4.3% per 1g/L albumin). Our results suggest that exposure to Cl-PFAESs may be widespread in China. The transfer efficiencies among different PFASs were structure-dependent. Physiological factors (e.g., GFR and serum albumin) were observed for the first time to play critical roles in PFAS placental transfer.

The effect of migration on social capital and depression among older adults in China.

PURPOSE: An estimated 9 million elderly people accompanied their adult children to urban areas in China, raising concerns about their social capital and mental health following re-location. The aim of this study was to examine the effect of migration on social capital and depression among this population. METHODS: Multistage stratified cluster sampling was applied to recruit the migrant and urban elderly in Hangzhou from May to August, 2013. Data were collected from face-to-face interviews by trained college students using a standardized questionnaire. Social capital measurements included cognitive (generalized trust and reciprocity) and structure (support from individual and social contact) aspects. Depression was measured by Geriatric Depression Scale-30 (GDS-30). Chi-square tests and binary logistic regression models were used for analysis. RESULTS: A total of 1248 migrant elderly and 1322 urban elderly were eligible for analysis. After adjusting for a range of confounder factors, binary logistic regression models revealed that migrant elderly reported significantly lower levels of generalized trust [OR = 1.34, 95% CI (1.10-1.64)], reciprocity [OR = 1.55, 95% CI (1.29-1.87)], support from individual [OR = 1.96, 95% CI (1.61-2.38)] and social contact [OR = 3.27, 95% CI (2.70-3.97)]. In the full adjusted model, migrant elderly were more likely to be mentally unhealthy [OR = 1.85, 95% CI (1.44-2.36)] compared with urban elderly. CONCLUSIONS: Migrant elderly suffered from a lower mental health status and social capital than their urban counterparts in the emigrating city. Attention should focus on improving the social capital and mental health of this growing population.

Simultaneous Bioreduction of Multiple Oxidized Contaminants Using a Membrane Biofilm Reactor.

This study tests a hydrogen-based membrane biofilm reactor (MBfR) to investigate simultaneous bioreduction of selected oxidized contaminants, including nitrate (-N), sulfate (), bromate (), chromate (Cr(VI)) and para-chloronitrobenzene (p-CNB). The experiments demonstrate that MBfR can achieve high performance for contaminants bioreduction to harmless or immobile forms in 240 days, with a maximum reduction fluxes of 0.901 g -N/m2·d, 1.573 g /m2·d, 0.009 g /m2·d, 0.022 g Cr(VI)/m2·d, and 0.043 g p-CNB/m2·d. Increasing H2 pressure and decreasing influent surface loading enhanced removal efficiency of the reactor. Flux analysis indicates that nitrate and sulfate reductions competed more strongly than , Cr(VI) and p-CNB reduction. The average H2 utilization rate, H2 flux, and H2 utilization efficiency of the reactor were 0.026 to 0.052 mg H2/cm3·d, 0.024 to 0.046 mg H2/cm2·d, and 97.5% to 99.3% (nearly 100%). Results show the hydrogen-based MBfR may be suitable for removing multiple oxidized contaminants in drinking water or groundwater.

A nested case-control study of prenatal vanadium exposure and low birthweight.

STUDY QUESTION: Is prenatal vanadium exposure associated with adverse birth outcomes? SUMMARY ANSWER: The odds of low birthweight (LBW) are increased 2.23-fold in mothers with a urinary vanadium of ≥2.91 µg/g creatinine compared with that in mothers with a urinary vanadium of ≤1.42 µg/g creatinine. WHAT IS KNOWN ALREADY: Human exposure to vanadium occurs through intake of food, water and polluted air. Vanadium has been suggested to have fetotoxicity and developmental toxicity in animal studies, and epidemiological studies have reported an association between a decrease in birthweight and vanadium exposure estimated from particulate matter. STUDY DESIGN, SIZE, DURATION: A nested case-control study involving 816 study participants (204 LBW cases and 612 matched controls) was conducted with data from the prospective Healthy Baby Cohort between 2012 and 2014 in the province of Hubei, China. PARTICIPANTS/MATERIALS, SETTING, METHODS: Vanadium concentrations in 816 maternal urine samples collected before delivery [the median gestational age was 39 weeks (range 27-42 weeks)] were measured by inductively coupled plasma mass spectrometry. Information on the infants' birth outcomes was obtained from medical records. Conditional logistic regression was used to calculate the odds ratios (ORs) and 95% confidence intervals (CIs). MAIN RESULTS AND THE ROLE OF CHANCE: The median urinary vanadium concentration of the cases was much higher than that of the controls (3.04 µg/g creatinine versus 1.93 µg/g creatinine). The results revealed a significant positive trend between the odds of LBW and level of maternal urinary vanadium [relative to the lowest tertile; adjusted OR = 1.69 (95% CI: 0.92, 3.10) for the medium tertile; adjusted OR = 2.23 (95% CI: 1.23, 4.05) for the highest tertile; P-trend = 0.02]. Additionally, the association was not modified by maternal age (P for heterogeneity = 0.70) or infant gender (P for heterogeneity = 0.21). LIMITATIONS, REASONS FOR CAUTION: The maternal urine sample was collected before labor, and the maternal urinary vanadium levels measured at one point in time may not accurately reflect the vanadium burden during the entire pregnancy. WIDER IMPLICATIONS OF THE FINDINGS: The results of this study can enrich the biological monitoring data on urinary vanadium in pregnant women; and may be evidence that vanadium may affect fetal development. STUDY FUNDING/COMPETING INTERESTS: This work was supported by the National Natural Science Foundation of China (21437002, 81372959 and 81402649), the R&D Special Fund for Public Welfare Industry (Environment) (201309048) and the Fundamental Research Funds for the Central Universities, HUST (2016YXZD043). The authors have no conflicts of interest to declare.