RESUMO
BACKGROUND: Melatonin is considered to be a polyfunctional master regulator in animals and higher plants. Exogenous melatonin inhibits plant infection by multiple diseases; however, the role of melatonin in Cucumber green mottle mosaic virus (CGMMV) infection remains unknown. RESULTS: In this study, we demonstrated that exogenous melatonin treatment can effectively control CGMMV infection. The greatest control effect was achieved by 3 days of root irrigation at a melatonin concentration of 50 µM. Exogenous melatonin showed preventive and therapeutic effects against CGMMV infection at early stage in tobacco and cucumber. We utilized RNA sequencing technology to compare the expression profiles of mock-inoculated, CGMMV-infected, and melatonin+CGMMV-infected tobacco leaves. Defense-related gene CRISP1 was specifically upregulated in response to melatonin, but not to salicylic acid (SA). Silencing CRISP1 enhanced the preventive effects of melatonin on CGMMV infection, but had no effect on CGMMV infection. We also found exogenous melatonin has preventive effects against another Tobamovirus, Pepper mild mottle virus (PMMoV) infection. CONCLUSIONS: Together, these results indicate that exogenous melatonin controls two Tobamovirus infections and inhibition of CRISP1 enhanced melatonin control effects against CGMMV infection, which may lead to the development of a novel melatonin treatment for Tobamovirus control.
Assuntos
Melatonina , Tobamovirus , Reguladores de Crescimento de Plantas , Cisteína , Melatonina/farmacologia , Tobamovirus/genética , Nicotiana/genética , Doenças das Plantas/genéticaRESUMO
A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.
RESUMO
AIMS/INTRODUCTION: The predictive value of admission hyperglycemia in the long-term prognosis of acute myocardial infarction patients is still controversial. We aimed to investigate this value based on the diabetes status. MATERIALS AND METHODS: We carried out a multicenter, retrospective study of 1,288 acute myocardial infarction patients enrolled in 11 hospitals between March 2014 and June 2019 in Chengdu, China. The patients were classified into those with diabetes and those without diabetes, each was further divided into: hyperglycemia and non-hyperglycemia subgroups, according to the optimal cut-off value of the blood glucose to predict all-cause mortality during follow up. The end-points were all-cause death and major adverse cardiovascular and cerebrovascular events, including all-cause death, non-fatal myocardial infarction, vessel revascularization and non-fatal stroke. RESULTS: In the follow-up period of 15 months, we observed 210 (16.3%), 6 (0.5%), 57 (4.4%) and 34 (2.6%) cases of death, non-fatal myocardial infarction, revascularization and non-fatal stroke, respectively. The optimal cut-off values of admission blood glucose for patients with diabetes and patients without diabetes to predict all-cause mortality during follow up were 14.80 and 6.77 mmol/L, respectively. We divided patients with diabetes (n = 331) into hyperglycemia (n = 92) and non-hyperglycemia (n = 239), and patients without diabetes (n = 897) into hyperglycemia (n = 425) and non-hyperglycemia (n = 472). The cumulative rates of all-cause death and major adverse cardiovascular and cerebrovascular events among the patients in each hyperglycemia group was higher than that in the corresponding non-hyperglycemia group (P < 0.001). In patients without diabetes, admission hyperglycemia was an independent predictor of all-cause mortality and major adverse cardiovascular and cerebrovascular events. CONCLUSION: Admission hyperglycemia was an independent predictor for long-term prognosis in acute myocardial infarction patients without diabetes.
Assuntos
Hiperglicemia/mortalidade , Infarto do Miocárdio/mortalidade , Admissão do Paciente/estatística & dados numéricos , Doença Aguda , Idoso , Glicemia/análise , Doenças Cardiovasculares/sangue , Doenças Cardiovasculares/etiologia , Doenças Cardiovasculares/mortalidade , Causas de Morte , Transtornos Cerebrovasculares/sangue , Transtornos Cerebrovasculares/etiologia , Transtornos Cerebrovasculares/mortalidade , China , Diabetes Mellitus/sangue , Diabetes Mellitus/mortalidade , Feminino , Humanos , Hiperglicemia/sangue , Hiperglicemia/complicações , Masculino , Pessoa de Meia-Idade , Infarto do Miocárdio/sangue , Infarto do Miocárdio/etiologia , Valor Preditivo dos Testes , Prognóstico , Estudos Retrospectivos , Medição de Risco , Acidente Vascular Cerebral/sangue , Acidente Vascular Cerebral/etiologia , Acidente Vascular Cerebral/mortalidade , Fatores de TempoRESUMO
The new movement towards green chemistry and renewable feedstocks makes microbial production of chemicals more competitive. Among the numerous chemicals, organic acids are more attractive targets for process development efforts in the renewable-based biorefinery industry. However, most of the production costs in microbial processes are higher than that in chemical processes, among which over 60% are generated by separation processes. Therefore, the research of separation and purification processes is important for a promising biorefinery industry. This review highlights the progress of recovery processes in the separation and purification of organic acids, including their advantages and disadvantages, current situation, and future prospects in terms of recovery yields and industrial application.