Metallic Nanoparticles: A Promising Arsenal against Antimicrobial Resistance-Unraveling Mechanisms and Enhancing Medication Efficacy.

The misuse of antibiotics and antimycotics accelerates the emergence of antimicrobial resistance, prompting the need for novel strategies to combat this global issue. Metallic nanoparticles have emerged as effective tools for combating various resistant microbes. Numerous studies have highlighted their potential in addressing antibiotic-resistant fungi and bacterial strains. Understanding the mechanisms of action of these nanoparticles, including iron-oxide, gold, zinc oxide, and silver is a central focus of research within the life science community. Various hypotheses have been proposed regarding how nanoparticles exert their effects. Some suggest direct targeting of microbial cell membranes, while others emphasize the release of ions from nanoparticles. The most compelling proposed antimicrobial mechanism of nanoparticles involves oxidative damage caused by nanoparticles-generated reactive oxygen species. This review aims to consolidate knowledge, discuss the properties and mechanisms of action of metallic nanoparticles, and underscore their potential as alternatives to enhance the efficacy of existing medications against infections caused by antimicrobial-resistant pathogens.

Silver nanoparticles decorated reduced graphene oxide: Eco-friendly synthesis, characterization, biological activities and embryo toxicity studies.

This study was aimed on the eco-friendly synthesis of silver nanoparticles (AgNPs), reduced graphene oxide (rGO) and AgNPs decorated rGO (rGO/AgNPs) nanocomposite and appraisal of their bioactivities and toxicity. As-prepared nanomaterials were established through high resolution X-ray diffraction (HR-XRD), high resolution transmission electron microscopy (HR-TEM), X-ray photoelectron spectroscopy (XPS), Raman spectroscopy, UV-Vis. spectroscopy and Fourier transform infrared spectroscopy (FT-IR). In this study, leaves extract, graphene oxide (GO) and rGO did not show antibacterial and anticancer activities; no significant embryo toxicity was recorded. On the other hand, AgNPs displayed good antibacterial and anticancer activities; however, higher toxic effects were observed even at the lowest test concentration (0.7 µg/ml). In case of rGO/AgNPs nanocomposite, significant antibacterial activity together with low cytotoxicity was noticed. Interestingly, the embryo toxicity of AgNPs was significantly reduced by rGO, implying the biocompatible nature of as-synthesized nanocomposite. Taken together, these results clearly suggest that rGO/AgNPs nano hybrid composite could be developed as the promising biomaterial for future biomedical applications.

High throughput de novo RNA sequencing elucidates novel responses in Penicillium chrysogenum under microgravity.

In this study, the transcriptional alterations in Penicillium chrysogenum under simulated microgravity conditions were analyzed for the first time using an RNA-Seq method. The increasing plethora of eukaryotic microbial flora inside the spaceship demands the basic understanding of fungal biology in the absence of gravity vector. Penicillium species are second most dominant fungal contaminant in International Space Station. Penicillium chrysogenum an industrially important organism also has the potential to emerge as an opportunistic pathogen for the astronauts during the long-term space missions. But till date, the cellular mechanisms underlying the survival and adaptation of Penicillium chrysogenum to microgravity conditions are not clearly elucidated. A reference genome for Penicillium chrysogenum is not yet available in the NCBI database. Hence, we performed comparative de novo transcriptome analysis of Penicillium chrysogenum grown under microgravity versus normal gravity. In addition, the changes due to microgravity are documented at the molecular level. Increased response to the environmental stimulus, changes in the cell wall component ABC transporter/MFS transporters are noteworthy. Interestingly, sustained increase in the expression of Acyl-coenzyme A: isopenicillin N acyltransferase (Acyltransferase) under microgravity revealed the significance of gravity in the penicillin production which could be exploited industrially.

Plant extract-mediated biogenic synthesis of silver, manganese dioxide, silver-doped manganese dioxide nanoparticles and their antibacterial activity against food- and water-borne pathogens.

Silver nanoparticles (AgNPs), manganese dioxide nanoparticles (MnO2NPs) and silver-doped manganese dioxide nanoparticles (Ag-doped MnO2NPs) were synthesized by simultaneous green chemistry reduction approach. Aqueous extract from the leaves of medicinally important plant Cucurbita pepo was used as reducing and capping agents. Various characterization techniques were carried out to affirm the formation of nanoparticles. HR-TEM analysis confirmed the size of nanoparticles in the range of 15-70 nm and also metal doping was confirmed through XRD and EDS analyses. FT-IR analysis confirmed that the presence of biomolecules in the aqueous leaves extract was responsible for nanoparticles synthesis. Further, the concentration of metals and their doping in the reaction mixture was achieved by ICP-MS. The growth curve and well diffusion study of synthesized nanoparticles were performed against food- and water-borne Gram-positive and Gram-negative bacterial pathogens. The mode of interaction of nanoparticles on bacterial cells was demonstrated through Bio-TEM analysis. Interestingly, AgNPs and Ag-doped MnO2NPs showed better antibacterial activity against all the tested bacterial pathogens; however, MnO2NPs alone did not show any antibacterial properties. Hence, AgNPs and Ag-doped MnO2NPs synthesized from aqueous plant leaves extract may have important role in controlling various food spoilage caused by bacteria.

Mechanistic aspects of biologically synthesized silver nanoparticles against food- and water-borne microbes.

In the present study, silver nanoparticles (AgNPs) synthesized from aqueous leaves extract of Malva crispa and their mode of interaction with food- and water-borne microbes were investigated. Formation of AgNPs was conformed through UV-Vis, FE-SEM, EDS, AFM, and HR-TEM analyses. Further the concentration of silver (Ag) in the reaction mixture was conformed through ICP-MS analysis. Different concentration of nanoparticles (1-3 mM) tested to know the inhibitory effect of bacterial pathogens such as Bacillus cereus, Staphylococcus aureus, Listeria monocytogenes, Escherichia coli, Salmonella typhi, Salmonella enterica and the fungal pathogens of Penicillium expansum, Penicillium citrinum, Aspergillus oryzae, Aspergillus sojae and Aspergillus niger. Interestingly, nanoparticles synthesized from 2 to 3 mM concentration of AgNO3 showed excellent inhibitory activities against both bacterial and fungal pathogens which are well demonstrated through well diffusion, poison food technique, minimum inhibitory concentration (MIC), and minimum fungicidal concentration (MFC). In addition, mode of interaction of nanoparticles into both bacterial and fungal pathogens was documented through Bio-TEM analysis. Further the genomic DNA isolated from test bacterial strains and their interaction with nanoparticles was carried out to elucidate the possible mode of action of nanoparticles against bacteria. Interestingly, AgNPs did not show any genotoxic effect against all the tested bacterial strains which are pronounced well in agarose gel electrophoresis and for supporting this study, UV-Vis and Bio-TEM analyses were carried out in which no significant changes observed compared with control. Hence, the overall results concluded that the antimicrobial activity of biogenic AgNPs occurred without any DNA damage.

In silico modelling of ciprofloxacin specific aptamer for the development of high-performance biosensor.

Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of -8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au-S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10-9 - 200 × 10-9 M), detection limit (1.0 × 10-9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.

Computer aided aptamer selection for fabrication of electrochemical sensor to detect Aflatoxin B1.

Aflatoxin B1 (AFB1) is a naturally occurring toxin produced by Aspergillus flavus and Aspergillus parasiticus. The AFB1 is classified as a potent carcinogen and poses significant health risks both to humans and animals. Early detection of the toxin in post-harvest agricultural products will save lives and promote healthy food production. In this study, stratified docking approach was utilized to screen and identify potential aptamers that can bind to AFB1. ssDNA sequences were acquired from the Mendeley dataset, secondary and tertiary structures were predicted through a series of bioinformatics pipelines. Further, the final DNA tertiary structures were minimized and SiteMap algorithm was used to probe and locate binding cavities. According to the final XP docking result, a 34 nt sequence (5'-ATCCTGTGAGGAATGCTCATGCATAGCAAGGGCT-3') aptamer with a docking score of -5.959 kcal/mol was considered for 200 ns MD Simulation. Finally, the screened DNA-aptamer was immobilized over the gold surface based on Au-S chemistry and utilized for the detection of AFB1. The fabricated DNA-aptamer electrode demonstrated a good analytical performance including wide linear range (1.0 to 1000 ng L-1), detection limit (1.0 ng L-1), high stability, and reproducibility.Communicated by Ramaswamy H. Sarma.

In vitro embryotoxicity and mode of antibacterial mechanistic study of gold and copper nanoparticles synthesized from Angelica keiskei (Miq.) Koidz. leaves extract.

The present study demonstrated the in vitro embryotoxicity assessment of gold nanoparticles (AuNPs) and copper nanoparticles (CuNPs) prepared from the leaves extract of Angelica keiskei (Miq.) Koidz. and addressed their mode of antibacterial mechanisms. Both AuNPs and CuNPs were rapidly synthesized and the formations were observed within 1 h and 24 h, respectively. Further the morphological images of the nanoparticles were confirmed through transmission electron microscopy (TEM), field emission scanning electron microscopy (FE-SEM) and atomic force microscopy (AFM). The high-resolution X-ray diffraction (HR-XRD) analysis of the biosynthesized AuNPs and CuNPs were matched with joint committee on powder diffraction standards (JCPDS) file no of 04-0784 and 89-5899, respectively. A strong prominent Au and Cu signals were observed through energy dispersive spectroscopy (EDS) analysis. Fourier transform infrared spectroscopy (FT-IR) analysis confirmed the responsible phytochemicals for the synthesis of AuNPs and CuNPs. In order to assess the toxic effects of AuNPs and CuNPs, bactericidal activity was performed against few of the test pathogens in which the effective inhibition was observed against Gram-negative bacteria than the Gram-positive bacteria. The mode of action and interaction of nanoparticles were performed on the bacterial pathogens and the results concluded that the interaction of nanoparticles initially initiated on the surface of the cell wall adherence followed by ruptured the cells and caused the cell death. In addition to the antibacterial activity, in vitro embryotoxicity studies were performed against zebrafish embryos and the results confirmed that 200 µg/ml concentration of AuNPs showed the embryotoxicity, whereas 2 µg/ml of CuNPs resulted the embryotoxicity. Furthermore, the morphological anomalies of zebrafish embryos revealed the toxic nature of the synthesized nanoparticles.

In vitro toxicological assessment and biosensing potential of bioinspired chitosan nanoparticles, selenium nanoparticles, chitosan/selenium nanocomposites, silver nanoparticles and chitosan/silver nanocomposites.

Hydrogen peroxide (H2O2) is widely used in various industries and biological fields. H2O2 rapidly contaminants with water resources and hence simple detection process is highly wanted in various fields. The present study was focused on the biosensing, antimicrobial and embryotoxicity of bioinspired chitosan nanoparticles (Cs NPs), selenium nanoparticles (Se NPs), chitosan/selenium nanocomposites (Cs/Se NCs), silver nanoparticles (Ag NPs) and chitosan/silver nanocomposites (Cs/Ag NCs) synthesized using the aqueous Cucurbita pepo Linn. leaves extract. The physico-chemical properties of as-synthesized nanomaterials were confirmed by various spectroscopic and microscopic techniques. Further, hydrogen peroxide (H2O2) sensing properties and their sensitivities were confirmed by cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS) and chronoamperometry (CA) methods, in which Cs/Ag NCs showed pronounced sensing properties. In addition, the mode of antibacterial interaction results clearly demonstrated the effective inhibitory activity of as-prepared Ag NPs and Cs/Ag NCs against Gram negative pathogenic bacteria. The highest embryotoxicity was recorded at 0.19 µg/ml of Ag NPs and 1.56 µg/ml of Se NPs. Intriguingly, the embryo treated with Cs/Se NCs and Cs/Ag NCs significantly reduced the toxicity in the presence of Cs matrix. However, Cs/Se NCs did not show good response in H2O2 sensing than the Cs/Ag NCs, implying the biocompatibility of Cs/Ag NCs. Overall, the obtained results clearly suggest that Cs/Ag NCs could be suitable for dual applications such as for the detection of environmental pollutant biosensors and for biomedical research.

In vivo toxicity evaluation of biologically synthesized silver nanoparticles and gold nanoparticles on adult zebrafish: a comparative study.

In this study, toxicity of biologically synthesized silver nanoparticles (AgNPs) and gold nanoparticles (AuNPs) was compared using zebrafish as a model organism. At 96 h, LC50 of AgNPs and AuNPs was found to be 24.5 µg/L and 41 mg/L, respectively. Following the LC50 determination, half of the LC50 of AgNPs (12.25 µg/L) and AuNPs (20.5 mg/L) was exposed to adult zebrafishes for 14 days. Morphological changes, liver marker enzymes, reactive oxygen species (ROS) generation, genotoxic effects and mRNA expression levels of oxidative stress and innate immune response related genes were studied using nanoparticle treated gill, liver and blood cells. In this study, AgNP-treated gill and liver tissues showed a number of morphological changes such as cell membrane damage, irregular cell outlines, pyknotic nuclei and complete disruption of gill and liver cells; on the contrary, AuNPs treated liver tissues alone showed such changes. The levels of liver marker enzymes such as alanine aminotransferase and aspartate aminotransferase were increased after AgNPs treatment when compared to AuNPs treatment. AgNP-treated liver cells showed higher levels of ROS generation than the control; on the other hand, AuNPs treatment exhibited lower levels of ROS generation than the control. Interestingly, AgNP-treated blood cells showed micronuclei formation and nuclear abnormalities, while AuNPs treatment did not show such effects. Based on these observations, it is clear that AgNPs may cause oxidative stress and immunotoxicity to adult zebrafish than the AuNPs. However, these results clearly reveal the significance of relatively safe and less toxic bionanomaterials for possible biomedical applications.

Anticancer activity of biologically synthesized silver and gold nanoparticles on mouse myoblast cancer cells and their toxicity against embryonic zebrafish.

The aim of this study was to evaluate the anticancer activity of bioinspired silver nanoparticles (AgNPs) and gold nanoparticles (AuNPs) against mouse myoblast cancer cells (C2C12). Both AgNPs and AuNPs were biologically synthesized using Spinacia oleracea Linn., aqueous leaves extract. UV-Vis. spectrophotometer, high resolution-transmission electron microscopy (HR-TEM), field emission-scanning electron microscopy (FE-SEM) and X-ray diffraction (XRD) studies supported the successful synthesis of AgNPs and AuNPs. Both these NPs have shown cytotoxicity against C2C12 cells even at very low concentration (5µg/mL). Acridine orange/Ethidium bromide (AO/EB) dual staining confirmed the apoptotic morphological features. The levels of caspase enzymes (caspase-3 and caspase-7) were significantly up-regulated in NPs treated myoblast cells than the plant extract. Furthermore, in zebrafish embryo toxicity study, AgNPs showed 100% mortality at 3µg/mL concentration while AuNPs exhibited the same at much higher concentration (300mg/mL). Taken together, these results provide a preliminary guidance for the development of biomaterials based drugs to fight against the fatal diseases for example cancer.

Interaction of silver and gold nanoparticles in mammalian cancer: as real topical bullet for wound healing- A comparative study.

The present study evaluates in vitro cytotoxic effects and the mode of interaction of biologically synthesized Ag and Au nanoparticles (NPs) using Brassica oleracea L. var. capitata f. rubra (BOL) against HT-1080 cancer cells and bacterial cells as well as their wound healing efficacy using a mouse model. UV-visible spectroscopy, scanning electron microscopy, high-resolution transmission electron microscopy, and energy-dispersive X-ray analysis have ascertained the formation of nano-sized Ag and Au particles. Fourier transform infrared analysis has confirmed that polyphenol and amide groups in BOL act as capping as well as reducing agents. The free radical scavenging activity under in vitro conditions is found to be higher for the Ag NPs when compared to the Au NPs. Acridine orange-ethidium bromide dual staining and comet assay have indicated that the cytotoxic effects are mediated through nuclear morphological changes and DNA damage. The intracellular localization of Ag and Au NPs in HT-1080 cells and their subsequent effect on apoptosis and necrosis were analyzed by flow cytometry while the mode of interaction was established by scanning electron microscopy under field emission mode and by bio-transmission electron microscopy. These methods of analysis clearly revealed that the Ag and Au NPs have easily entered and accumulated into the cytosol and nucleus, resulting in activation of inflammatory and apoptosis pathways, which in turn cause damage in DNA. Further, mRNA and protein expression of caspase-3 and caspase-7, TNF-α, and NF-κB have provided sufficient clues for induction of intrinsic and extrinsic apoptosis and inflammatory pathways in Ag NP- and Au NP-treated cells. Evaluation of wound healing properties of Ag and Au NPs using a mouse model indicates rapid healing of wounds. In addition, no clear toxic effects and no nuclear abnormalities in peripheral blood cells are observed. Ag NPs appear to be a better anticancer therapeutic agent than Au NPs. Nonetheless, both Ag NPs and Au NPs show potential for promoting topical wound healing without any toxic effects. Graphical abstract Schematic representation of biological synthesis of Ag and Au NPs and its application on cancer and wound healing.

In Vivo toxicological assessment of biologically synthesized silver nanoparticles in adult Zebrafish (Danio rerio).

The present study examines the deleterious effect of biologically synthesized silver nanoparticles in adult zebrafish. Silver nanoparticles (AgNPs) used in the study were synthesized by treating AgNO3 with aqueous leaves extract of Malva crispa Linn., a medicinal herb as source of reductants. LC50 concentration of AgNPs at 96 h was observed as 142.2 µg/l. In order to explore the underlying toxicity mechanisms of AgNPs, half of the LC50 concentration (71.1 µg/l) was exposed to adult zebrafish for 14 days. Cytological changes and intrahepatic localization of AgNPs were observed in gills and liver tissues respectively, and the results concluded a possible sign for oxidative stress. In addition to oxidative stress the genotoxic effect was observed in peripheral blood cells like presence of micronuclei, nuclear abnormalities and also loss in cell contact with irregular shape was observed in liver parenchyma cells. Hence to confirm the oxidative stress and genotoxic effects the mRNA expression of stress related (MTF-1, HSP70) and immune response related (TLR4, NFKB, IL1B, CEBP, TRF, TLR22) genes were analyzed in liver tissues and the results clearly concluded that the plant extract mediated synthesis of AgNPs leads to oxidative stress and immunotoxicity in adult zebrafish.