Protein products obtained by site-preferred partial crosslinking in protein crystals and "liberated" by redissolution.

The use of protein crystals as a source of nanoscale biotemplates has attracted growing interest in recent years owing to their inherent internal order. As these crystals are vulnerable to environmental changes, potential applications require their stabilization by chemical crosslinking. We have previously shown that such intermolecular chemical crosslinking reactions occurring within protein crystals are not random events, but start at preferred crosslinking sites imposed by the alignment of protein molecules and their packing within the crystalline lattice. Here we propose a new working hypothesis and demonstrate its feasibility in enabling us to extricate homogeneous populations of single protein molecules that display chemical point mutations or of dimers that show homogeneous chemical crosslinking, and that have the potential for isolation of higher structures. Characterization of the crosslinking mechanism and its end products opens the way to the potential retrieval of such specific modified/intermolecular crosslinked products simply by effecting partial crosslinking at identified preferred sites, followed by time-controlled arrest of the crosslinking reaction and dissolution of the crystals by medium exchange complemented by chromatographic purification.

The application of hierarchical cluster analysis to the selection of isomorphous crystals.

It is generally assumed that the quality of X-ray diffraction data can be improved by merging data sets from several crystals. However, this effect is only valid if the data sets used are from crystals that are structurally identical. It is found that frozen macromolecular crystals very often have relatively low structure identity (and are therefore not isomorphous); thus, to obtain a real gain from multi-crystal data sets one needs to make an appropriate selection of structurally similar crystals. The application of hierarchical cluster analysis, based on the matrix of the correlation coefficient between scaled intensities, is proposed for the identification of isomorphous data sets. Multi-crystal single-wavelength anomalous dispersion data sets from four different protein molecules have been probed to test the applicability of this method. The use of hierarchical cluster analysis permitted the selection of batches of data sets which when merged together significantly improved the crystallographic indicators of the merged data and allowed solution of the structure.

The use of workflows in the design and implementation of complex experiments in macromolecular crystallography.

The automation of beam delivery, sample handling and data analysis, together with increasing photon flux, diminishing focal spot size and the appearance of fast-readout detectors on synchrotron beamlines, have changed the way that many macromolecular crystallography experiments are planned and executed. Screening for the best diffracting crystal, or even the best diffracting part of a selected crystal, has been enabled by the development of microfocus beams, precise goniometers and fast-readout detectors that all require rapid feedback from the initial processing of images in order to be effective. All of these advances require the coupling of data feedback to the experimental control system and depend on immediate online data-analysis results during the experiment. To facilitate this, a Data Analysis WorkBench (DAWB) for the flexible creation of complex automated protocols has been developed. Here, example workflows designed and implemented using DAWB are presented for enhanced multi-step crystal characterizations, experiments involving crystal reorientation with kappa goniometers, crystal-burning experiments for empirically determining the radiation sensitivity of a crystal system and the application of mesh scans to find the best location of a crystal to obtain the highest diffraction quality. Beamline users interact with the prepared workflows through a specific brick within the beamline-control GUI MXCuBE.

Experimental procedure for the characterization of radiation damage in macromolecular crystals.

A reliable and reproducible method to automatically characterize the radiation sensitivity of macromolecular crystals at the ESRF beamlines has been developed. This new approach uses the slope of the linear dependence of the overall isotropic B-factor with absorbed dose as the damage metric. The method has been implemented through an automated procedure using the EDNA on-line data analysis framework and the MxCuBE data collection control interface. The outcome of the procedure can be directly used to design an optimal data collection strategy. The results of tests carried out on a number of model and real-life crystal systems are presented.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions.

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

A preliminary neutron crystallographic study of an A-DNA crystal.

The LADI-III diffractometer at the Institut Laue-Langevin has been used to carry out a preliminary neutron crystallographic study of the self-complementary DNA oligonucleotide d(AGGGGCCCCT)(2) in the A conformation. The results demonstrate the viability of a full neutron crystallographic analysis with the aim of providing enhanced information on the ion-water networks that are known to be important in stabilizing A-DNA. This is the first account of a single-crystal neutron diffraction study of A-DNA. The study was carried out with the smallest crystal used to date for a neutron crystallographic study of a biological macromolecule.

A preliminary neutron crystallographic study of thaumatin.

A preliminary neutron crystallographic study of the sweet protein thaumatin is presented. Large hydrogenated crystals were prepared in deuterated crystallization buffer using the gel-acupuncture method. Data were collected to a resolution of 2 A on the LADI-III diffractometer at the Institut Laue Langevin (ILL). The results demonstrate the feasibility of a full neutron crystallographic analysis of this structure aimed at providing relevant information on the location of H atoms, the distribution of charge on the protein surface and localized water in the structure. This information will be of interest for understanding the specificity of thaumatin-receptor interactions and will contribute to further understanding of the molecular mechanisms underlying the perception of taste.